Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
8-67342480-G-T c.-232G>T 5_prime_UTR_premature_start_codon_gain ADHFE1 4 82408 4.8539E-5 41204 0 1.01792E-4
8-67342571-T-C c.-141T>C 5_prime_UTR_premature_start_codon_gain ADHFE1 1 79750 1.25392E-5 39875 0 3.18431E-5
8-67342591-T-C c.-121T>C 5_prime_UTR_premature_start_codon_gain ADHFE1 1 78608 1.27214E-5 39304 0 NA
8-67342612-A-G c.-100A>G splice_region ADHFE1 5 76614 6.52622E-5 38307 0 NA
8-67344752-A-G p.Met1? start_lost ADHFE1 2 44652 4.47908E-5 22326 0 NA
8-67344753-T-C p.Met1? start_lost ADHFE1 2 44626 4.48169E-5 22313 0 NA
8-67344757-C-T c.-209C>T 5_prime_UTR_premature_start_codon_gain ADHFE1 8 44346 1.804E-4 22173 0 0.00587212
8-67344758-G-C p.Ala3Pro missense ADHFE1 1 44294 2.25764E-5 22147 0 0.0010661
8-67344764-G-A p.Ala5Thr missense ADHFE1 1 43762 2.28509E-5 21881 0 2.08768E-4
8-67344765-C-T p.Ala5Val missense ADHFE1 280 43778 0.00639591 21889 0 0.0240799
8-67344767-C-T p.Arg6* stop_gained ADHFE1 31 43392 7.14417E-4 21696 0 0.00183599
8-67344770-G-A p.Ala7Thr missense ADHFE1 2 43360 4.61255E-5 21680 0 0.00105152
8-67344770-G-C p.Ala7Pro missense ADHFE1 1 43360 2.30627E-5 21680 0 NA
8-67344774-G-A p.Arg8Gln missense ADHFE1 1 42444 2.35605E-5 21222 0 6.37105E-5
8-67344776-G-C p.Val9Leu missense ADHFE1 6 42300 1.41844E-4 21150 0 3.94789E-4
8-67344778-C-T c.-188C>T 5_prime_UTR_premature_start_codon_gain ADHFE1 1 41992 2.38141E-5 20996 0 1.86748E-5
8-67344778-CG-C p.Ala10fs frameshift ADHFE1 1 41992 2.38141E-5 20996 0 NA
8-67344792-G-A p.Arg14Lys missense ADHFE1 3 41040 7.30994E-5 20520 0 6.37024E-5
8-67344811-G-A c.59+1G>A splice_donor ADHFE1 1 39566 2.52742E-5 19783 0 NA
8-67344812-T-C c.59+2T>C splice_donor ADHFE1 3 39454 7.60379E-5 19727 0 NA
8-67352391-C-T c.60-6C>T splice_region ADHFE1 1 82412 1.21342E-5 41206 0 0.00152545
8-67352391-C-G c.60-6C>G splice_region ADHFE1 1 82490 1.21227E-5 41245 0 NA
8-67352414-A-T p.His26Leu missense ADHFE1 1 82934 1.20578E-5 41467 0 NA
8-67352425-T-TA p.Tyr30fs frameshift ADHFE1 1 82884 1.20651E-5 41442 0 4.039E-6
8-67352426-A-G p.Tyr30Cys missense ADHFE1 3 82798 3.62328E-5 41399 0 1.0138E-4
8-67352434-G-A p.Asp33Asn missense+splice_region ADHFE1 1 82858 1.20688E-5 41429 0 NA
8-67352440-A-G c.97+6A>G splice_region ADHFE1 1 82792 1.20785E-5 41396 0 4.0624E-6
8-67352441-C-T c.97+7C>T splice_region ADHFE1 1 82590 1.2108E-5 41295 0 4.06316E-6
8-67355039-G-A p.Trp22* stop_gained ADHFE1 1 82852 1.20697E-5 41426 0 NA
8-67355049-T-C p.Phe26Leu missense ADHFE1 1 82878 1.20659E-5 41439 0 3.18492E-5
8-67355060-CA-C p.Thr43fs frameshift ADHFE1 1 82866 1.20677E-5 41433 0 1.65747E-5
8-67355064-A-C p.Thr43Thr synonymous ADHFE1 1 82874 1.20665E-5 41437 0 1.65769E-5
8-67355067-T-C p.Asp44Asp synonymous ADHFE1 1 82836 1.2072E-5 41418 0 6.36862E-5
8-67355072-C-T p.Ala46Val missense ADHFE1 1 82796 1.20779E-5 41398 0 NA
8-67355078-A-T p.Ter35Cysext*? stop_lost ADHFE1 1 82696 1.20925E-5 41348 0 NA
8-67355079-G-GATGGCT c.144_144+1insATGGCT splice_donor ADHFE1 1 82672 1.2096E-5 41336 0 NA
8-67355081-T-A c.144+2T>A splice_donor ADHFE1 1 82618 1.21039E-5 41309 0 NA
8-67355087-C-T c.144+8C>T splice_region ADHFE1 1 82544 1.21148E-5 41272 0 NA
8-67356594-T-G c.98-8T>G splice_region ADHFE1 1 83142 1.20276E-5 41571 0 NA
8-67356605-G-C p.Gly34Ala missense ADHFE1 1 83206 1.20184E-5 41603 0 3.97969E-6
8-67356615-A-G p.Asn53Ser missense ADHFE1 1 83226 1.20155E-5 41613 0 NA
8-67356627-G-C p.Gly57Ala missense ADHFE1 19 83234 2.28272E-4 41617 0 5.09554E-4
8-67356644-G-A p.Glu63Lys missense ADHFE1 1 83232 1.20146E-5 41616 0 NA
8-67356651-G-T p.Gly65Val missense ADHFE1 1 83224 1.20158E-5 41612 0 NA
8-67356656-G-GACCTAAAAAACATGGGTGCTAAAAATGTGTGCTTGATGACAGA c.*34+1_*34+2insACCTAAAAAACATGGGTGCTAAAAATGTGTGCTTGATGACAGA splice_donor ADHFE1 1 83200 1.20192E-5 41600 0 NA
8-67356825-G-A c.*35-4G>A splice_region ADHFE1 3 83218 3.60499E-5 41609 0 1.64834E-5
8-67356829-G-C p.Asp67His missense+splice_region ADHFE1 1 83258 1.20109E-5 41629 0 1.64799E-5
8-67356832-C-G p.Leu68Val missense ADHFE1 106 83262 0.00127309 41631 0 0.0040282
8-67356832-C-T p.Leu68Leu synonymous ADHFE1 4 83268 4.80377E-5 41634 0 7.96229E-6
8-67356834-A-G p.Leu68Leu synonymous ADHFE1 1 83270 1.20091E-5 41635 0 3.98092E-6
8-67356841-A-T p.Met71Leu missense ADHFE1 1 83300 1.20048E-5 41650 0 NA
8-67356870-A-G p.Thr80Thr synonymous ADHFE1 1 83358 1.19964E-5 41679 0 NA
8-67356876-G-C p.Lys82Asn missense ADHFE1 3 83364 3.59868E-5 41682 0 2.47101E-5
8-67356902-A-G p.Gln91Arg missense ADHFE1 1 83376 1.19939E-5 41688 0 3.9763E-6
8-67356910-A-G p.Met94Val missense ADHFE1 2 83384 2.39854E-5 41692 0 1.64728E-5
8-67356924-G-C p.Val98Val synonymous ADHFE1 2 83390 2.39837E-5 41695 0 NA
8-67356935-T-C p.Ile102Thr missense ADHFE1 1 83396 1.1991E-5 41698 0 6.25E-4
8-67356939-CT-C p.Phe104fs frameshift ADHFE1 60 83392 7.19493E-4 41696 1 0.00302115
8-67356944-C-T p.Thr105Met missense ADHFE1 1 83392 1.19916E-5 41696 0 1.98821E-5
8-67356945-G-A p.Thr105Thr synonymous ADHFE1 33 83392 3.95721E-4 41696 0 9.87513E-4
8-67356954-T-G p.Asp108Glu missense ADHFE1 1 83386 1.19924E-5 41693 0 3.9769E-6
8-67356956-A-G p.Asn109Ser missense ADHFE1 1 83388 1.19921E-5 41694 0 NA
8-67356958-G-A p.Val110Met missense ADHFE1 2 83386 2.39848E-5 41693 0 3.97735E-6
8-67356973-A-C p.Thr115Pro missense ADHFE1 1 83380 1.19933E-5 41690 0 NA
8-67356975-G-A p.Thr115Thr synonymous ADHFE1 1 83374 1.19941E-5 41687 0 5.03525E-4
8-67356977-A-T p.Asp116Val missense ADHFE1 2 83374 2.39883E-5 41687 0 2.47235E-5
8-67356981-A-G p.Ser117Ser splice_region+synonymous ADHFE1 6 83368 7.19701E-5 41684 0 6.25E-4
8-67356983-G-GT c.*189_*189+1insT splice_donor ADHFE1 2 83366 2.39906E-5 41683 0 NA
8-67356983-G-GCTTCATGGAAGCTATTGA c.*189_*189+1insCTTCATGGAAGCTATTGA splice_donor ADHFE1 1 83366 1.19953E-5 41683 0 NA
8-67356983-G-GCTTCATGGAAGCTATTGAGTTTGCCCAAAAGGGA c.*189_*189+1insCTTCATGGAAGCTATTGAGTTTGCCCAAAAGGGA splice_donor ADHFE1 1 83366 1.19953E-5 41683 0 NA
8-67357461-A-C p.Glu121Ala missense ADHFE1 1 83338 1.19993E-5 41669 0 4.20751E-6
8-67357471-G-A p.Glu124Glu synonymous ADHFE1 1 83362 1.19959E-5 41681 0 NA
8-67357484-G-A p.Gly129Arg missense ADHFE1 16 83400 1.91847E-4 41700 0 6.69472E-4
8-67357498-C-T p.Ala133Ala synonymous ADHFE1 1 83406 1.19895E-5 41703 0 8.23954E-6
8-67357500-A-G p.Tyr134Cys missense ADHFE1 2 83410 2.39779E-5 41705 0 NA
8-67357500-A-T p.Tyr134Phe missense ADHFE1 1 83410 1.1989E-5 41705 0 NA
8-67357506-C-A p.Ala136Asp missense ADHFE1 8 83414 9.59072E-5 41707 0 3.82312E-4
8-67357510-C-T p.Val137Val synonymous ADHFE1 5 83418 5.99391E-5 41709 0 2.47137E-5
8-67357518-G-A p.Gly140Asp missense ADHFE1 2 83414 2.39768E-5 41707 0 NA
8-67357520-T-G p.Ser141Ala missense ADHFE1 1 83412 1.19887E-5 41706 0 3.98229E-6
8-67357521-C-G p.Ser141Cys missense ADHFE1 1 83410 1.1989E-5 41705 0 3.98302E-6
8-67357527-T-C p.Met143Thr missense ADHFE1 2 83416 2.39762E-5 41708 0 1.19349E-5
8-67357527-T-G p.Met143Arg missense ADHFE1 1 83416 1.19881E-5 41708 0 NA
8-67357544-G-A p.Ala149Thr missense ADHFE1 1 83402 1.19901E-5 41701 0 8.2371E-6
8-67357545-C-G p.Ala149Gly missense ADHFE1 1 83398 1.19907E-5 41699 0 3.18613E-5
8-67357559-T-C p.Ser154Pro missense ADHFE1 1 83394 1.19913E-5 41697 0 3.97744E-6
8-67357569-A-G p.His157Arg missense ADHFE1 2 83406 2.39791E-5 41703 0 NA
8-67357577-T-A p.Phe160Ile missense ADHFE1 2 83398 2.39814E-5 41699 0 NA
8-67357596-C-T p.Ala166Val missense ADHFE1 1 83396 1.1991E-5 41698 0 8.23913E-6
8-67357599-C-G p.Pro167Arg missense ADHFE1 1 83398 1.19907E-5 41699 0 NA
8-67357619-G-A p.Val174Met missense ADHFE1 1 83380 1.19933E-5 41690 0 4.95E-5
8-67357622-T-C p.Ser175Pro missense ADHFE1 9 83376 1.07945E-4 41688 0 9.55536E-5
8-67357623-C-CT p.Val176fs frameshift ADHFE1 1 83374 1.19941E-5 41687 0 NA
8-67357643-A-T p.Ile182Phe missense ADHFE1 1 83322 1.20016E-5 41661 0 NA
8-67357646-G-T p.Ala183Ser missense ADHFE1 2 83310 2.40067E-5 41655 0 NA
8-67357649-G-GTGCCAACTACCTCAGGAACCGGGA c.*386_*386+1insTGCCAACTACCTCAGGAACCGGGA splice_donor ADHFE1 1 83272 1.20088E-5 41636 0 NA
8-67357650-G-A c.*386+1G>A splice_donor ADHFE1 2 83248 2.40246E-5 41624 0 6.37308E-5
8-67359518-C-T p.Arg125Trp missense ADHFE1 32 82844 3.86268E-4 41422 0 0.0040282
8-67359519-G-A p.Gly191Arg missense ADHFE1 2 82844 2.41418E-5 41422 0 3.98197E-6
8-67359520-G-A p.Gly191Glu missense ADHFE1 2 82858 2.41377E-5 41429 0 NA
8-67359522-A-C p.Ser192Arg missense ADHFE1 1 82872 1.20668E-5 41436 0 8.24824E-6
8-67359523-G-A p.Ser192Asn missense ADHFE1 1 82868 1.20674E-5 41434 0 7.96337E-6
8-67359523-G-C p.Ser192Thr missense ADHFE1 1 82868 1.20674E-5 41434 0 8.24824E-6
8-67359528-A-G p.Thr194Ala missense ADHFE1 1 82894 1.20636E-5 41447 0 3.98175E-6
8-67359533-T-A p.Thr195Thr synonymous ADHFE1 1 82900 1.20627E-5 41450 0 NA
8-67359547-T-G p.Phe200Cys missense ADHFE1 2 82894 2.41272E-5 41447 0 NA
8-67359549-G-T p.Asp201Tyr missense ADHFE1 1 82888 1.20645E-5 41444 0 3.18695E-5
8-67359553-A-G p.Tyr202Cys missense ADHFE1 3 82834 3.6217E-5 41417 0 6.36983E-5
8-67359567-G-A p.Val207Ile missense ADHFE1 1 82840 1.20715E-5 41420 0 8.2511E-6
8-67359574-T-A p.Ile209Asn missense+splice_region ADHFE1 1 82792 1.20785E-5 41396 0 8.25314E-6
8-67359574-T-C p.Ile209Thr missense+splice_region ADHFE1 2 82792 2.41569E-5 41396 0 3.98232E-6
8-67359575-T-C p.Ile209Ile splice_region+synonymous ADHFE1 1 82782 1.20799E-5 41391 0 1.65079E-5
8-67359583-AC-A c.*464+8delC splice_region ADHFE1 1 82670 1.20963E-5 41335 0 NA
8-67361106-C-A p.Thr212Asn missense ADHFE1 1 83144 1.20273E-5 41572 0 6.37186E-5
8-67361109-C-T p.Ser213Leu missense ADHFE1 3 83146 3.60811E-5 41573 0 3.29565E-5
8-67361121-A-G p.Lys217Arg missense ADHFE1 6 83222 7.20963E-5 41611 0 6.3743E-5
8-67361129-C-A p.Leu220Met missense ADHFE1 1 83236 1.2014E-5 41618 0 NA
8-67361129-C-T p.Thr128Ile missense ADHFE1 3 83236 3.60421E-5 41618 0 1.78978E-4
8-67361139-T-C p.Ile223Thr missense ADHFE1 7 83234 8.41002E-5 41617 0 6.36943E-5
8-67361147-C-A p.Leu226Met missense ADHFE1 2 83258 2.40217E-5 41629 0 NA
8-67361162-A-G p.Met231Val missense ADHFE1 4 83234 4.80573E-5 41617 0 3.18471E-5
8-67361165-C-G p.Pro232Ala missense ADHFE1 1 83260 1.20106E-5 41630 0 NA
8-67361171-C-T p.Arg234* stop_gained ADHFE1 1 83230 1.20149E-5 41615 0 1.19322E-5
8-67361172-G-A p.Arg234Gln missense ADHFE1 3 83230 3.60447E-5 41615 0 3.97753E-6
8-67361174-G-A p.Val235Met missense ADHFE1 1 83226 1.20155E-5 41613 0 1.64739E-5
8-67361178-T-C p.Val236Ala missense ADHFE1 1 83194 1.20201E-5 41597 0 NA
8-67361180-G-A p.Ala237Thr missense ADHFE1 2 83184 2.40431E-5 41592 0 9.06081E-5
8-67361186-A-G p.Ser239Gly missense ADHFE1 1 83182 1.20218E-5 41591 0 2.47121E-5
8-67361200-G-A p.Val243Val synonymous ADHFE1 2 83128 2.40593E-5 41564 0 7.95634E-6
8-67361205-G-GCCATGCCCTGGA c.*570_*570+1insCCATGCCCTGGA splice_donor ADHFE1 4 83086 4.81429E-5 41543 2 NA
8-67361208-A-G c.*570+3A>G splice_region ADHFE1 1 83046 1.20415E-5 41523 0 3.18613E-5
8-67364198-G-A p.Glu249Lys missense ADHFE1 2 83040 2.40848E-5 41520 0 NA
8-67364201-T-A p.Ser250Thr missense ADHFE1 3 83084 3.6108E-5 41542 0 1.27535E-4
8-67364204-T-C p.Tyr251His missense ADHFE1 1 83112 1.2032E-5 41556 0 NA
8-67364205-A-G p.Tyr251Cys missense ADHFE1 7 83100 8.42359E-5 41550 0 6.37308E-5
8-67364223-ACCTGCGGAGC-A p.Leu258fs frameshift ADHFE1 1 83254 1.20114E-5 41627 0 3.18756E-5
8-67364228-C-T p.Arg259Trp missense ADHFE1 2 83270 2.40183E-5 41635 0 3.18532E-5
8-67364229-G-A p.Arg259Gln missense ADHFE1 2 83274 2.40171E-5 41637 0 3.58049E-5
8-67364235-C-G p.Pro261Arg missense ADHFE1 1 83292 1.2006E-5 41646 0 NA
8-67364241-C-T p.Pro263Leu missense ADHFE1 1 83316 1.20025E-5 41658 0 NA
8-67364258-C-T p.Arg269Trp missense ADHFE1 1 83336 1.19996E-5 41668 0 8.23764E-6
8-67364259-G-A p.Arg269Gln missense ADHFE1 2 83334 2.39998E-5 41667 0 3.18512E-5
8-67364265-C-T p.Ala271Val missense ADHFE1 2 83330 2.4001E-5 41665 0 1.19331E-5
8-67364266-G-A p.Ala271Ala synonymous ADHFE1 57 83342 6.83929E-4 41671 1 0.00181506
8-67364272-G-A p.Gln273Gln synonymous ADHFE1 7 83346 8.39872E-5 41673 0 2.86533E-4
8-67364273-G-A p.Gly274Ser missense ADHFE1 1 83342 1.19988E-5 41671 0 6.25E-4
8-67364275-C-T p.Gly274Gly synonymous ADHFE1 4 83346 4.79927E-5 41673 0 9.06215E-5
8-67364287-C-T p.Ile278Ile synonymous ADHFE1 2 83334 2.39998E-5 41667 0 3.1839E-5
8-67364296-T-A p.Ile281Ile synonymous ADHFE1 2 83320 2.40038E-5 41660 0 3.18552E-5
8-67364303-A-G p.Ile284Val missense ADHFE1 1 83308 1.20036E-5 41654 0 1.64913E-5
8-67364308-C-T p.His285His synonymous ADHFE1 5 83312 6.00154E-5 41656 0 NA
8-67364309-G-A p.Ala286Thr missense ADHFE1 2 83302 2.4009E-5 41651 1 3.97893E-5
8-67364310-C-T p.Ala286Val missense ADHFE1 3 83298 3.60153E-5 41649 0 4.95499E-5
8-67364310-C-A p.Ala286Glu missense ADHFE1 1 83298 1.20051E-5 41649 0 NA
8-67364311-G-A p.Ala286Ala synonymous ADHFE1 1 83298 1.20051E-5 41649 0 6.25E-4
8-67364315-C-T p.Arg288Trp missense ADHFE1 2 83294 2.40113E-5 41647 0 3.18492E-5
8-67364320-C-T p.Ile289Ile synonymous ADHFE1 5 83276 6.00413E-5 41638 0 9.95667E-5
8-67364327-A-G p.Lys292Glu missense ADHFE1 1 83258 1.20109E-5 41629 0 1.66E-5
8-67364335-G-A p.Leu294Leu synonymous ADHFE1 1 83242 1.20132E-5 41621 0 2.79127E-5
8-67364339-AG-A p.Lys292fs frameshift ADHFE1 3 83218 3.60499E-5 41609 0 3.59138E-5
8-67364340-G-GGGCC c.*723_*723+1insGGCC splice_donor ADHFE1 3 83212 3.60525E-5 41606 0 NA
8-67364340-G-C p.Arg296Thr missense+splice_region ADHFE1 1 83212 1.20175E-5 41606 0 8.35869E-6
8-67364341-G-T c.*723+1G>T splice_donor ADHFE1 2 83216 2.40338E-5 41608 0 1.67322E-5
8-67364343-A-G c.*723+3A>G splice_region ADHFE1 1 83182 1.20218E-5 41591 0 NA
8-67365943-A-T c.888-2A>T splice_acceptor ADHFE1 1 76552 1.3063E-5 38276 0 4.14226E-6
8-67365949-G-A p.Val298Ile missense ADHFE1 6 76562 7.83679E-5 38281 0 9.55657E-5
8-67365953-A-G p.Asn299Ser missense ADHFE1 1 76564 1.3061E-5 38282 0 NA
8-67365963-C-A p.Asp302Glu missense ADHFE1 21 76558 2.74302E-4 38279 0 6.36943E-4
8-67366307-C-A p.Pro301Thr missense ADHFE1 1 83276 1.20083E-5 41638 0 NA
8-67366311-A-G p.Asp302Gly missense ADHFE1 13 83268 1.56122E-4 41634 0 7.166E-5
8-67366327-G-A p.Arg307Arg synonymous ADHFE1 1 83214 1.20172E-5 41607 0 NA
8-67366330-T-G p.Ser308Ser synonymous ADHFE1 5 83198 6.00976E-5 41599 0 9.55292E-5
8-67366349-G-C p.Ala315Pro missense ADHFE1 1 83070 1.2038E-5 41535 0 NA
8-67366351-T-C p.Ala315Ala synonymous ADHFE1 1 83060 1.20395E-5 41530 0 NA
8-67366354-T-C p.Phe316Phe synonymous ADHFE1 1 83044 1.20418E-5 41522 0 3.18451E-5
8-67366355-G-C p.Ala317Pro missense ADHFE1 1 83024 1.20447E-5 41512 0 NA
8-67366355-G-A p.Ala317Thr missense ADHFE1 3 83024 3.61341E-5 41512 0 5.9701E-5
8-67366358-G-A p.Gly318Ser missense ADHFE1 1 83026 1.20444E-5 41513 0 5.03525E-4
8-67366361-A-G p.Ile319Val missense ADHFE1 2 82998 2.4097E-5 41499 0 6.25E-4
8-67366364-G-A p.Gly320Ser missense ADHFE1 2 82960 2.4108E-5 41480 0 6.37024E-5
8-67366364-G-C p.Gly320Arg missense ADHFE1 1 82960 1.2054E-5 41480 0 NA
8-67366374-A-T p.Asn323Ile missense ADHFE1 15 82836 1.81081E-4 41418 0 5.03525E-4
8-67366381-T-G p.Gly325Gly synonymous ADHFE1 10 82680 1.20948E-4 41340 0 1.59347E-5
8-67366384-T-A p.Val326Val synonymous ADHFE1 1 82636 1.21013E-5 41318 0 NA
8-67366398-C-G c.*822+6C>G splice_region ADHFE1 1 82328 1.21465E-5 41164 0 1.19887E-5
8-67369047-T-C c.*823-5T>C splice_region ADHFE1 20 82878 2.41319E-4 41439 1 0.00155604
8-67369054-A-G p.His330Arg missense+splice_region ADHFE1 3 82992 3.61481E-5 41496 0 3.34107E-5
8-67369061-G-A p.Met332Ile missense ADHFE1 1 83030 1.20438E-5 41515 0 NA
8-67369088-G-C p.Lys341Asn missense ADHFE1 9 83086 1.08321E-4 41543 0 4.45945E-4
8-67369090-T-C p.Met342Thr missense ADHFE1 2 83092 2.40697E-5 41546 0 2.48293E-5
8-67369093-A-G p.Tyr343Cys missense ADHFE1 1 83076 1.20372E-5 41538 0 4.1579E-6
8-67369094-T-C p.Tyr343Tyr synonymous ADHFE1 1 83068 1.20383E-5 41534 0 NA
8-67369097-A-C p.Lys344Asn missense ADHFE1 1 83058 1.20398E-5 41529 0 4.2214E-6
8-67369104-G-A p.Asp347Asn missense ADHFE1 1 82792 1.20785E-5 41396 0 3.18613E-5
8-67369121-C-T p.His352His synonymous ADHFE1 1 82220 1.21625E-5 41110 0 NA
8-67369129-TGGTAAAATCATAAGAATAAATTATTTAATTAAATATTATAATCATCCCAATTTCCATAAATATATTTGCCAATTCTCGCCTGCTTAGAGTATGGGGTAAAGTAACTTAACATCTAGAATATGCAGGGAAGAACAGCTTTGTCATCTGCCGGTCACCGCATTTCGTTTCTCCCCA-T p.His357fs frameshift ADHFE1 1 81802 1.22246E-5 40901 0 NA
8-67369130-G-GCCCCATGGCCTTTCTGTGGTGCTCACGTCCCCA c.*901_*901+1insCCCCATGGCCTTTCTGTGGTGCTCACGTCCCCA splice_donor ADHFE1 1 81650 1.22474E-5 40825 0 NA
8-67369130-G-A p.Val355Val splice_region+synonymous ADHFE1 2 81650 2.44948E-5 40825 0 NA
8-67369304-G-GC p.His357fs frameshift ADHFE1 1 83264 1.201E-5 41632 0 NA
8-67369308-C-T p.His357Tyr missense ADHFE1 2 83300 2.40096E-5 41650 0 3.18768E-5
8-67369310-T-C p.His357His synonymous ADHFE1 1 83300 1.20048E-5 41650 0 NA
8-67369315-T-A p.Leu359His missense ADHFE1 1 83300 1.20048E-5 41650 0 8.25191E-6
8-67369326-C-T p.Leu363Phe missense ADHFE1 2 83324 2.40027E-5 41662 0 3.18715E-5
8-67369330-C-T p.Thr364Met missense ADHFE1 4 83324 4.80054E-5 41662 0 9.06917E-5
8-67369331-G-T p.Thr364Thr synonymous ADHFE1 1 83320 1.20019E-5 41660 0 5.03525E-4
8-67369331-G-A p.Thr364Thr synonymous ADHFE1 1 83320 1.20019E-5 41660 0 6.37877E-5
8-67369336-C-T p.Pro366Leu missense ADHFE1 2 83334 2.39998E-5 41667 0 5.03525E-4
8-67369338-G-A p.Ala367Thr missense ADHFE1 3 83328 3.60023E-5 41664 0 3.18878E-5
8-67369339-C-T p.Ala367Val missense ADHFE1 20 83328 2.40015E-4 41664 0 6.25E-4
8-67369340-G-A p.Ala367Ala synonymous ADHFE1 5 83320 6.00096E-5 41660 0 7.4173E-5
8-67369342-T-C p.Val368Ala missense ADHFE1 1 83320 1.20019E-5 41660 0 NA
8-67369346-C-T p.Phe369Phe synonymous ADHFE1 1 83310 1.20034E-5 41655 0 3.18593E-5
8-67369350-T-C p.Phe371Leu missense ADHFE1 4 83302 4.80181E-5 41651 0 3.18695E-5
8-67369350-T-G p.Phe371Val missense ADHFE1 1 83302 1.20045E-5 41651 0 NA
8-67369354-C-T p.Thr372Met missense ADHFE1 4 83300 4.80192E-5 41650 0 9.8894E-5
8-67369355-G-C p.Thr372Thr synonymous ADHFE1 15065 82722 0.182116 41361 1445 0.189325
8-67369373-G-C p.Glu378Asp missense ADHFE1 1 83250 1.2012E-5 41625 0 8.24729E-6
8-67369374-C-T p.Arg379* stop_gained ADHFE1 3 83234 3.6043E-5 41617 0 3.29897E-5
8-67369375-G-A p.Arg379Gln missense ADHFE1 2 83218 2.40333E-5 41609 0 6.25E-4
8-67369378-A-T p.His380Leu missense ADHFE1 1 83206 1.20184E-5 41603 0 5.03525E-4
8-67369379-C-T p.His380His synonymous ADHFE1 1 83206 1.20184E-5 41603 0 3.97947E-6
8-67369395-A-T p.Ile386Leu missense ADHFE1 2 83064 2.40778E-5 41532 0 NA
8-67369398-CT-C p.Leu387fs frameshift ADHFE1 1 83040 1.20424E-5 41520 0 NA
8-67369405-T-G c.*998+4T>G splice_region ADHFE1 1 82900 1.20627E-5 41450 0 NA
8-67369409-C-A c.*998+8C>A splice_region ADHFE1 1 82806 1.20764E-5 41403 0 8.28665E-6
8-67372548-G-A p.Asp390Asn missense ADHFE1 1 83214 1.20172E-5 41607 0 8.24878E-5
8-67372552-C-T p.Thr391Ile missense ADHFE1 3 83216 3.60508E-5 41608 0 3.29924E-5
8-67372554-C-T p.Arg392Cys missense ADHFE1 2 83226 2.4031E-5 41613 0 3.1839E-5
8-67372555-G-A p.Arg392His missense ADHFE1 2 83232 2.40292E-5 41616 0 1.64954E-5
8-67372572-G-A p.Asp398Asn missense ADHFE1 2 83250 2.4024E-5 41625 0 3.97788E-6
8-67372584-G-C p.Val402Leu missense ADHFE1 1 83270 1.20091E-5 41635 0 NA
8-67372597-C-T p.Thr406Met missense ADHFE1 2 83270 2.40183E-5 41635 0 3.97798E-6
8-67372598-G-A p.Thr406Thr synonymous ADHFE1 3 83270 3.60274E-5 41635 0 4.9478E-5
8-67372599-C-G p.Leu407Val missense ADHFE1 1 83276 1.20083E-5 41638 0 3.18492E-5
8-67372602-C-T p.Arg408Trp missense ADHFE1 1 83268 1.20094E-5 41634 0 2.47431E-5
8-67372603-G-A p.Arg408Gln missense ADHFE1 1 83268 1.20094E-5 41634 0 1.64965E-5
8-67372615-T-C p.Phe412Ser missense ADHFE1 1 83282 1.20074E-5 41641 0 NA
8-67372616-C-T p.Phe412Phe synonymous ADHFE1 1 83286 1.20068E-5 41643 0 8.25723E-6
8-67372617-G-A p.Asp413Asn missense ADHFE1 3 83286 3.60205E-5 41643 0 1.65172E-5
8-67372628-T-G p.Val416Val synonymous ADHFE1 1 83288 1.20065E-5 41644 0 NA
8-67372657-C-A p.Ser426Tyr missense ADHFE1 1 83230 1.20149E-5 41615 0 NA
8-67372659-A-G p.Lys427Glu missense ADHFE1 2 83234 2.40286E-5 41617 0 6.73446E-5
8-67372670-C-A p.Ile430Ile synonymous ADHFE1 3 83192 3.60612E-5 41596 0 6.25E-4
8-67372674-G-A p.Ala432Thr missense ADHFE1 13 83156 1.56333E-4 41578 0 1.59226E-4
8-67372680-G-A p.Val434Met missense ADHFE1 1 83126 1.20299E-5 41563 0 3.18431E-5
8-67372686-G-A p.Gly436Arg missense ADHFE1 1 83078 1.20369E-5 41539 0 1.25127E-5
8-67372690-C-T p.Thr437Met missense ADHFE1 1 83014 1.20462E-5 41507 0 6.0667E-5
8-67372691-G-A p.Thr437Thr synonymous ADHFE1 3 82966 3.61594E-5 41483 0 3.18552E-5
8-67372702-T-A c.*1156+2T>A splice_donor ADHFE1 1 82860 1.20685E-5 41430 0 NA
8-67380499-T-C c.*1157-5T>C splice_region ADHFE1 2 82358 2.42842E-5 41179 0 NA
8-67380502-A-G c.*1157-2A>G splice_acceptor ADHFE1 3 82492 3.63672E-5 41246 0 3.18471E-4
8-67380507-A-G p.Arg442Gly missense ADHFE1 18 82688 2.17686E-4 41344 0 3.39826E-4
8-67380509-G-A p.Arg442Arg synonymous ADHFE1 3 82726 3.62643E-5 41363 0 5.79883E-5
8-67380511-T-C p.Val443Ala missense ADHFE1 4 82748 4.83395E-5 41374 0 4.02492E-6
8-67380525-C-T p.Pro448Ser missense ADHFE1 1 82944 1.20563E-5 41472 0 4.13271E-5
8-67380528-T-C p.Cys449Arg missense ADHFE1 43160 81664 0.528507 40832 11768 0.584089
8-67380529-G-A p.Cys449Tyr missense ADHFE1 1 82964 1.20534E-5 41482 0 3.18492E-5
8-67380531-C-T p.Pro450Ser missense ADHFE1 1 82984 1.20505E-5 41492 0 NA
8-67380533-C-G p.Pro450Pro synonymous ADHFE1 1 82990 1.20496E-5 41495 0 8.27568E-6
8-67380553-C-G p.Ala457Gly missense ADHFE1 78 83018 9.39555E-4 41509 1 5.9079E-4
8-67380558-C-G p.Leu459Val missense ADHFE1 6 83018 7.22735E-5 41509 1 5.58254E-5
8-67380573-A-G p.Met464Val missense ADHFE1 4 83004 4.81904E-5 41502 0 9.55536E-5
8-67380579-CTG-C p.Tyr467fs frameshift ADHFE1 1 82950 1.20555E-5 41475 0 8.68614E-6
8-67380581-G-GT p.Tyr467fs frameshift ADHFE1 3 82928 3.6176E-5 41464 0 1.59226E-4