Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-14260749-TGTC-T c.*933_*935delGAC splice_region LPHN1 38 43006 8.83598E-4 21503 0 0.00119408
19-14260749-TG-T c.*935delC splice_region LPHN1 6 43092 1.39237E-4 21546 0 1.19408E-4
19-14260750-G-T c.*935C>A splice_region LPHN1 94 39888 0.0023566 19944 0 0.0354911
19-14260750-GTC-TTT c.*933_*935delGACinsAAA splice_region LPHN1 18 42578 4.22754E-4 21289 0 NA
19-14260751-TC-T c.*933delG splice_region LPHN1 2 42676 4.68647E-5 21338 0 8.61846E-5
19-14260752-C-T c.*933G>A splice_region LPHN1 192 40252 0.00476995 20126 0 0.0243859
19-14261714-CG-C p.Asp1465fs frameshift LPHN1 1 79528 1.25742E-5 39764 0 NA
19-14261714-C-T p.Gly1466Arg missense LPHN1 1 79528 1.25742E-5 39764 0 3.19264E-5
19-14261715-G-A p.Asp1465Asp synonymous LPHN1 2 79524 2.51496E-5 39762 0 6.3857E-5
19-14261716-T-TGCAGAGCA p.Asp1465fs frameshift LPHN1 1 79504 1.2578E-5 39752 0 NA
19-14261720-CA-C p.Asp1463fs frameshift LPHN1 1 79508 1.25774E-5 39754 0 NA
19-14261721-A-G p.Asp1463Asp synonymous LPHN1 1 79444 1.25875E-5 39722 0 NA
19-14261723-C-T p.Asp1463Asn missense LPHN1 1 79350 1.26024E-5 39675 0 3.19101E-5
19-14261723-C-G p.Asp1463His missense LPHN1 1 79350 1.26024E-5 39675 0 NA
19-14261736-C-T p.Glu1458Glu synonymous LPHN1 1 79140 1.26358E-5 39570 0 4.13551E-6
19-14261741-G-C p.Leu1457Val missense LPHN1 1 78978 1.26618E-5 39489 0 2.00973E-5
19-14261742-G-T p.Gly1456Gly synonymous LPHN1 1 78856 1.26813E-5 39428 0 1.02596E-5
19-14261743-C-A p.Gly1456Val missense LPHN1 2 78826 2.53723E-5 39413 0 NA
19-14261752-G-T p.Ala1453Glu missense LPHN1 19 78756 2.41251E-4 39378 0 2.06011E-4
19-14261758-T-C p.Tyr1451Cys missense LPHN1 1 78576 1.27265E-5 39288 0 1.68284E-5
19-14261760-G-C p.Gly1450Gly synonymous LPHN1 2 78314 2.55382E-5 39157 0 6.39141E-5
19-14261765-C-T p.Glu1449Lys missense LPHN1 1 77702 1.28697E-5 38851 0 4.26778E-6
19-14261766-G-A p.His1448His synonymous LPHN1 14 77600 1.80412E-4 38800 0 7.35348E-5
19-14261777-G-A p.Arg1445Cys missense LPHN1 5 75442 6.62761E-5 37721 0 6.95352E-5
19-14261780-G-A p.Arg1444Trp missense LPHN1 1 74786 1.33715E-5 37393 0 1.44317E-5
19-14261787-G-A p.Tyr1441Tyr synonymous LPHN1 2 73798 2.7101E-5 36899 0 NA
19-14261795-C-A p.Gly1439Cys missense LPHN1 1 71952 1.38982E-5 35976 0 NA
19-14261809-C-T p.Arg1434Gln missense LPHN1 4 67554 5.92119E-5 33777 0 5.08647E-4
19-14261826-C-T p.Pro1428Pro synonymous LPHN1 1 61148 1.63538E-5 30574 0 4.07011E-5
19-14261827-G-T p.Pro1428Gln missense LPHN1 5 60876 8.21342E-5 30438 0 3.88174E-4
19-14261831-G-A p.Arg1427Cys missense LPHN1 1 57924 1.7264E-5 28962 0 2.60512E-5
19-14261832-C-T p.Ser1426Ser synonymous LPHN1 4 57142 7.0001E-5 28571 0 8.50557E-5
19-14261839-T-C p.Tyr1424Cys missense LPHN1 1 53878 1.85605E-5 26939 0 7.12809E-6
19-14261842-T-A p.Tyr1423Phe missense LPHN1 1 52622 1.90035E-5 26311 0 NA
19-14261845-A-C p.Ile1422Ser missense LPHN1 1 51206 1.9529E-5 25603 0 NA
19-14261849-C-T p.Glu1421Lys missense LPHN1 1 47994 2.08359E-5 23997 0 2.19587E-4
19-14261849-C-G p.Glu1421Gln missense LPHN1 4 47972 8.3382E-5 23986 0 0.0117647
19-14261849-C-CG p.Glu1421fs frameshift LPHN1 2 47992 4.16736E-5 23996 0 1.45716E-4
19-14261850-G-A p.Pro1420Pro synonymous LPHN1 1 51130 1.9558E-5 25565 0 NA
19-14261851-G-A p.Pro1420Leu missense LPHN1 4 51308 7.79606E-5 25654 0 1.78228E-5
19-14261852-G-C p.Pro1420Ala missense LPHN1 1 50922 1.96379E-5 25461 0 NA
19-14261858-C-CG p.Gly1418fs frameshift LPHN1 36 46018 7.82303E-4 23009 0 0.00689348
19-14261858-C-G p.Gly1418Arg missense LPHN1 2 46064 4.34179E-5 23032 0 0.0299564
19-14261858-C-CGGGG p.Gly1418fs frameshift LPHN1 1 46106 2.16892E-5 23053 0 3.49895E-4
19-14261858-C-T p.Gly1418Ser missense LPHN1 1 46130 2.16779E-5 23065 0 1.11185E-4
19-14261859-G-A p.Pro1417Pro synonymous LPHN1 3 47752 6.28246E-5 23876 0 1.99884E-5
19-14261863-G-A p.Pro1416Leu missense LPHN1 1 47014 2.12703E-5 23507 0 1.90534E-5
19-14261865-TGC-GGG p.Ala1415Pro missense LPHN1 6 45094 1.33055E-4 22547 0 NA
19-14261865-T-G p.Ala1415Ala synonymous LPHN1 13 44666 2.91049E-4 22333 0 0.0191676
19-14261866-G-A p.Ala1415Val missense LPHN1 1 45944 2.17656E-5 22972 0 2.87974E-5
19-14261867-C-CGGGGGGGGGG p.Ala1415fs frameshift LPHN1 21 44670 4.70114E-4 22335 0 0.00251256
19-14261867-C-G p.Ala1415Pro missense LPHN1 4 44248 9.03996E-5 22124 0 0.0334797
19-14261867-C-CGGGGGGGGGGG p.Ala1415fs frameshift LPHN1 2 44700 4.47427E-5 22350 0 9.30579E-5
19-14261867-C-T p.Ala1415Thr missense LPHN1 1 44702 2.23704E-5 22351 0 9.30579E-5
19-14261868-G-A p.Pro1414Pro synonymous LPHN1 2 46426 4.30793E-5 23213 0 2.83409E-5
19-14261869-GGA-G p.Pro1414fs frameshift LPHN1 2 46524 4.29886E-5 23262 0 NA
19-14261871-A-G p.Pro1413Pro synonymous LPHN1 14 44948 3.11471E-4 22474 0 0.0404656
19-14261871-A-AGGGGGCGGGGGGGGGGGGGG p.Ala1415fs frameshift LPHN1 1 45602 2.19289E-5 22801 0 NA
19-14261877-T-G p.Pro1411Pro synonymous LPHN1 21 47322 4.43768E-4 23661 0 0.0341545
19-14261877-T-TGGGGGGGGGGGG p.Pro1411_Pro1412insProProProPro disruptive_inframe_insertion LPHN1 10 48112 2.07848E-4 24056 0 6.77966E-4
19-14261877-T-TGGGGGAAGTGGGGGGGGGCGGGGGGGGGGGGGGGGGGGG p.Pro1411_Pro1412insProProProProProProArgProProProLeuProPro disruptive_inframe_insertion LPHN1 1 48140 2.07727E-5 24070 0 NA
19-14261877-T-TGGGGGGGGGGGGGG p.Ala1415fs frameshift LPHN1 1 48140 2.07727E-5 24070 0 NA
19-14261877-T-TGGGAAGTTTGGGGGGGGGCGGGGGGGGGGGGGGGGGGGG p.Pro1411_Pro1412insProProProProProProArgProProProAsnPhePro disruptive_inframe_insertion LPHN1 1 48140 2.07727E-5 24070 0 NA
19-14261877-T-TGGGGGGGGGGGGGGGGGGGGG p.Pro1411_Pro1412insProProProProProProPro disruptive_inframe_insertion LPHN1 1 48138 2.07736E-5 24069 0 NA
19-14261877-T-TGGGGGTGTTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG p.Ala1415fs frameshift LPHN1 1 48140 2.07727E-5 24070 0 NA
19-14261877-T-TGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG p.Pro1411_Pro1412insProProProProProProProProProPro disruptive_inframe_insertion LPHN1 4 48140 8.3091E-5 24070 0 NA
19-14261877-T-TGGGGGGGGGGGGGGGGGGGG p.Ala1415fs frameshift LPHN1 1 48140 2.07727E-5 24070 0 NA
19-14261877-T-TGGGGGTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG p.Ala1415fs frameshift LPHN1 1 48140 2.07727E-5 24070 0 NA
19-14261877-T-TGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG p.Ala1415fs frameshift LPHN1 5 48136 1.03872E-4 24068 0 NA
19-14261877-T-TGGGGGGGGGCGGGGGGGGGGGGGGGGGGGG p.Pro1411_Pro1412insProProProProProProArgProProPro disruptive_inframe_insertion LPHN1 2 48140 4.15455E-5 24070 0 NA
19-14261877-T-TGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG p.Ala1415fs frameshift LPHN1 3 48136 6.23234E-5 24068 0 NA
19-14261877-T-TGGGGTGGTTTGGGGGGGGGCGGGGGGGGGGGGGGGGGGGG p.Ala1415fs frameshift LPHN1 1 48140 2.07727E-5 24070 0 NA
19-14261877-T-TGGGGGGGGGGGGGGGGGGGGGGGGGGGGG p.Ala1415fs frameshift LPHN1 2 48140 4.15455E-5 24070 0 NA
19-14261877-T-TGGGGTTTTGGGGGGGGGCGGGGGGGGGGGGGGGGGGGG p.Ala1415fs frameshift LPHN1 1 48140 2.07727E-5 24070 0 NA
19-14261877-T-TGGGGAGGTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG p.Ala1415fs frameshift LPHN1 1 48140 2.07727E-5 24070 0 NA
19-14261877-T-TTTTAGTGTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG p.Ala1415fs frameshift LPHN1 1 48140 2.07727E-5 24070 0 NA
19-14261877-T-TGGGGGGGGGGGTGAGGTAGTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG p.Ala1415fs frameshift LPHN1 1 48140 2.07727E-5 24070 0 NA
19-14261882-G-C p.Pro1410Ala missense LPHN1 1 49278 2.0293E-5 24639 0 NA
19-14261882-G-GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGC p.Pro1410fs frameshift LPHN1 1 49282 2.02914E-5 24641 0 NA
19-14261882-G-GGGGGC p.Pro1410fs frameshift LPHN1 1 49272 2.02955E-5 24636 0 NA
19-14261882-G-GGGGGGC p.Leu1409_Pro1410insAlaPro conservative_inframe_insertion LPHN1 1 49282 2.02914E-5 24641 0 NA
19-14261885-G-C p.Leu1409Val missense LPHN1 1 50860 1.96618E-5 25430 0 9.11378E-6
19-14261896-G-A p.Pro1405Leu missense LPHN1 1 52228 1.91468E-5 26114 0 NA
19-14261897-G-C p.Pro1405Ala missense LPHN1 3 52116 5.75639E-5 26058 0 1.32661E-4
19-14261915-C-T p.Asp1399Asn missense LPHN1 2 52722 3.79348E-5 26361 0 2.82167E-4
19-14261916-C-T p.Pro1398Pro synonymous LPHN1 24 52642 4.5591E-4 26321 0 9.97823E-4
19-14261917-G-A p.Pro1398Leu missense LPHN1 1 52958 1.88829E-5 26479 0 5.06757E-4
19-14261922-G-A p.Ser1396Ser synonymous LPHN1 2 53172 3.76138E-5 26586 0 NA
19-14261925-G-A p.Pro1395Pro synonymous LPHN1 1 53390 1.87301E-5 26695 0 5.76834E-5
19-14261928-T-C p.Ser1394Ser synonymous LPHN1 1 53084 1.88381E-5 26542 0 NA
19-14261935-C-T p.Arg1392Gln missense LPHN1 1 53402 1.87259E-5 26701 0 1.0635E-5
19-14261936-G-A p.Arg1392Trp missense LPHN1 1 53466 1.87035E-5 26733 0 1.56878E-5
19-14261941-T-C p.Asn1390Ser missense LPHN1 2 54302 3.68311E-5 27151 0 3.2078E-5
19-14261943-G-A p.Ala1389Ala synonymous LPHN1 1 54458 1.83628E-5 27229 0 1.15287E-4
19-14261946-C-T p.Gly1388Gly synonymous LPHN1 34 54764 6.20846E-4 27382 0 4.12669E-4
19-14261949-G-A p.Ser1387Ser synonymous LPHN1 68 54884 0.00123898 27442 0 0.00254065
19-14261952-G-A p.Ala1386Ala synonymous LPHN1 1 55636 1.7974E-5 27818 0 2.04968E-5
19-14261958-G-C p.Leu1384Leu synonymous LPHN1 18 56296 3.19739E-4 28148 0 9.38771E-4
19-14261960-G-C p.Leu1384Val missense LPHN1 2 56282 3.55353E-5 28141 0 1.173E-4
19-14261960-G-A p.Leu1384Phe missense LPHN1 1 56280 1.77683E-5 28140 0 4.52112E-6
19-14261961-G-A p.Ser1383Ser synonymous LPHN1 1 56368 1.77406E-5 28184 0 NA
19-14261968-C-T p.Arg1381Gln missense LPHN1 2 56526 3.53819E-5 28263 0 3.20184E-5
19-14261969-G-C p.Arg1381Gly missense LPHN1 6 56856 1.0553E-4 28428 0 5.07614E-4
19-14261975-G-C p.Pro1379Ala missense LPHN1 1 58206 1.71804E-5 29103 0 NA
19-14261975-G-A p.Pro1379Ser missense LPHN1 1 58206 1.71804E-5 29103 0 NA
19-14261980-G-A p.Ser1377Phe missense LPHN1 1 58582 1.70701E-5 29291 0 1.18231E-5
19-14261992-C-T p.Arg1373Gln missense LPHN1 1 59514 1.68028E-5 29757 0 1.53009E-4
19-14262003-G-A p.Gly1369Gly synonymous LPHN1 2 61006 3.27837E-5 30503 0 7.15059E-5
19-14262011-C-T p.Glu1367Lys missense LPHN1 1 63264 1.58068E-5 31632 0 NA
19-14262011-C-G p.Glu1367Gln missense LPHN1 28 63262 4.42604E-4 31631 0 2.64194E-4
19-14262012-G-A p.Ala1366Ala synonymous LPHN1 3 63280 4.74083E-5 31640 0 3.60652E-4
19-14262015-C-T p.Thr1365Thr synonymous LPHN1 4 64120 6.2383E-5 32060 0 1.69836E-5
19-14262025-T-C p.Glu1362Gly missense LPHN1 1 65836 1.51893E-5 32918 0 6.25782E-4
19-14262027-C-T p.Ser1361Ser synonymous LPHN1 41 65978 6.21419E-4 32989 0 0.0021006
19-14262041-C-T p.Asp1357Asn missense LPHN1 2 68192 2.9329E-5 34096 0 3.19693E-5
19-14262049-T-C p.Tyr1354Cys missense LPHN1 1 68864 1.45214E-5 34432 0 NA
19-14262052-A-G p.Leu1353Pro missense LPHN1 3 69070 4.34342E-5 34535 0 1.25603E-5
19-14262057-C-T p.Ser1351Ser synonymous LPHN1 1 69258 1.44388E-5 34629 0 1.84176E-5
19-14262058-G-C p.Ser1351Trp missense LPHN1 1 69556 1.43769E-5 34778 0 NA
19-14262060-C-G p.Gln1350His missense LPHN1 2 69898 2.86131E-5 34949 0 9.19354E-6
19-14262098-T-C p.Lys1338Glu missense LPHN1 1 73730 1.3563E-5 36865 0 NA
19-14262116-C-T p.Glu1332Lys missense LPHN1 2 75266 2.65724E-5 37633 0 0.00151668
19-14262122-G-A p.Arg1330Trp missense LPHN1 1 76028 1.3153E-5 38014 0 NA
19-14262126-A-G p.Ala1328Ala synonymous LPHN1 1 76268 1.31117E-5 38134 0 1.28107E-4
19-14262130-C-A p.Gly1327Val missense LPHN1 7 76912 9.10131E-5 38456 0 6.40369E-5
19-14262130-C-G p.Gly1327Ala missense LPHN1 1 76912 1.30019E-5 38456 0 NA
19-14262131-C-T p.Gly1327Ser missense LPHN1 1 76982 1.299E-5 38491 0 9.50878E-6
19-14262134-C-A p.Gly1326Trp missense LPHN1 2 76854 2.60234E-5 38427 0 5.11949E-6
19-14262137-GCCCGCCCGCCTCTTCCTCGCC-G p.Gly1318_Gly1324del conservative_inframe_deletion LPHN1 1 76936 1.29978E-5 38468 0 NA
19-14262138-C-A p.Gly1324Gly synonymous LPHN1 1 77282 1.29396E-5 38641 0 5.0636E-6
19-14262139-C-T p.Gly1324Glu missense LPHN1 1 77474 1.29076E-5 38737 0 1.59474E-5
19-14262141-G-A p.Gly1323Gly synonymous LPHN1 2 77306 2.58712E-5 38653 0 1.02577E-5
19-14262144-C-A p.Ala1322Ala synonymous LPHN1 1 78374 1.27593E-5 39187 0 NA
19-14262144-C-T p.Ala1322Ala synonymous LPHN1 3 78374 3.8278E-5 39187 0 1.04182E-4
19-14262145-G-A p.Ala1322Val missense LPHN1 6 78296 7.66323E-5 39148 0 6.98669E-5
19-14262154-TCGCCCC-T p.Gly1317_Gly1318del disruptive_inframe_deletion LPHN1 12 78850 1.52188E-4 39425 0 8.82932E-5
19-14262155-C-T p.Glu1319Lys missense LPHN1 1 78936 1.26685E-5 39468 0 NA
19-14262156-G-A p.Gly1318Gly synonymous LPHN1 64 78788 8.12306E-4 39394 0 0.0023363
19-14262156-G-GCCCCCC p.Gly1317_Gly1318dup disruptive_inframe_insertion LPHN1 1 78788 1.26923E-5 39394 0 4.75281E-6
19-14262156-G-GCCCCC p.Glu1319fs frameshift LPHN1 1 78792 1.26916E-5 39396 0 NA
19-14262157-C-G p.Gly1318Ala missense LPHN1 2 78990 2.53197E-5 39495 0 4.71507E-6
19-14262159-C-T p.Gly1317Gly synonymous LPHN1 1 79194 1.26272E-5 39597 0 3.19468E-5
19-14262161-C-T p.Gly1317Arg missense LPHN1 3 79158 3.78989E-5 39579 0 4.70987E-6
19-14262162-G-C p.Gly1316Gly synonymous LPHN1 4 78400 5.10204E-5 39200 0 0.00203666
19-14262162-G-A p.Gly1316Gly synonymous LPHN1 1 78412 1.27532E-5 39206 0 3.0828E-5
19-14262168-T-C p.Pro1314Pro synonymous LPHN1 2 77926 2.56654E-5 38963 0 0.0426396
19-14262170-G-C p.Pro1314Ala missense LPHN1 1 78234 1.27822E-5 39117 0 NA
19-14262172-A-C p.Val1313Gly missense LPHN1 2 78474 2.54861E-5 39237 0 4.68951E-6
19-14262173-C-T p.Val1313Met missense LPHN1 39 78640 4.95931E-4 39320 0 2.75161E-4
19-14262174-A-G p.Pro1312Pro synonymous LPHN1 1 78728 1.2702E-5 39364 0 1.39873E-5
19-14262195-C-T p.Pro1305Pro synonymous LPHN1 2 79834 2.5052E-5 39917 0 3.19754E-5
19-14262196-G-A p.Pro1305Leu missense LPHN1 3 80032 3.7485E-5 40016 0 3.19714E-5
19-14262203-G-A p.Pro1303Ser missense LPHN1 1 80386 1.244E-5 40193 0 6.39672E-5
19-14262213-C-T p.Ala1299Ala synonymous LPHN1 20 80904 2.47207E-4 40452 0 3.98129E-4
19-14262214-G-A p.Ala1299Val missense LPHN1 10 80906 1.236E-4 40453 0 1.91939E-4
19-14262215-C-T p.Ala1299Thr missense LPHN1 1 80982 1.23484E-5 40491 0 8.48817E-6
19-14262216-G-A p.Ser1298Ser synonymous LPHN1 1 81054 1.23375E-5 40527 0 3.19795E-5
19-14262225-C-G p.Gly1295Gly synonymous LPHN1 2 81510 2.45369E-5 40755 0 6.38896E-5
19-14262225-C-T p.Gly1295Gly synonymous LPHN1 1 81510 1.22684E-5 40755 0 4.13151E-6
19-14262228-C-G p.Arg1294Arg synonymous LPHN1 38 81628 4.65527E-4 40814 0 3.19305E-4
19-14262228-C-T p.Arg1294Arg synonymous LPHN1 3 81630 3.67512E-5 40815 0 2.05158E-5
19-14262243-C-G p.Val1289Val synonymous LPHN1 1 82124 1.21767E-5 41062 0 NA
19-14262246-C-T p.Leu1288Leu synonymous LPHN1 4 82206 4.86583E-5 41103 0 6.37959E-5
19-14262247-AG-CC p.Leu1288Gly missense LPHN1 1 82228 1.21613E-5 41114 0 NA
19-14262255-G-A p.Ile1285Ile synonymous LPHN1 12 82402 1.45628E-4 41201 0 4.14779E-4
19-14262276-C-T p.Ala1278Ala synonymous LPHN1 2 82656 2.41967E-5 41328 0 6.37796E-5
19-14262277-G-A p.Ala1278Val missense LPHN1 1 82682 1.20945E-5 41341 0 1.21979E-5
19-14262279-C-T p.Ala1277Ala synonymous LPHN1 5 82710 6.04522E-5 41355 0 1.78741E-4
19-14262279-C-A p.Ala1277Ala synonymous LPHN1 10 82710 1.20904E-4 41355 0 5.90914E-4
19-14262280-G-A p.Ala1277Val missense LPHN1 2 82722 2.41774E-5 41361 0 2.03689E-5
19-14262282-A-G p.Asp1276Asp synonymous LPHN1 7 82748 8.45942E-5 41374 0 NA
19-14262284-C-T p.Asp1276Asn missense LPHN1 2 82752 2.41686E-5 41376 0 3.4901E-5
19-14262285-G-A p.Ala1275Ala synonymous LPHN1 48 82756 5.80018E-4 41378 0 0.00251762
19-14262292-TTCCGGCCTCGGGGCG-T p.Pro1268_Asn1273delinsHis disruptive_inframe_deletion LPHN1 2 82670 2.41926E-5 41335 0 NA
19-14262299-C-T p.Gly1271Ser missense LPHN1 7 82720 8.46228E-5 41360 0 7.8235E-5
19-14262301-C-T p.Arg1270Gln missense LPHN1 1 82690 1.20934E-5 41345 0 3.19142E-5
19-14262301-CGGG-C p.Pro1269del disruptive_inframe_deletion LPHN1 2 82690 2.41867E-5 41345 0 NA
19-14262306-C-T p.Pro1268Pro synonymous LPHN1 1 82650 1.20992E-5 41325 0 3.19203E-5
19-14262307-G-A p.Pro1268Leu missense LPHN1 1 82640 1.21007E-5 41320 0 4.49754E-5
19-14262308-G-A p.Pro1268Ser missense LPHN1 1 82628 1.21024E-5 41314 0 1.73178E-5
19-14262315-G-A p.Gly1265Gly synonymous LPHN1 1 82658 1.2098E-5 41329 0 NA
19-14262326-C-T p.Gly1262Arg missense LPHN1 2 82694 2.41856E-5 41347 0 4.0941E-5
19-14262327-G-A p.Pro1261Pro synonymous LPHN1 3 82612 3.63143E-5 41306 0 1.6372E-5
19-14262327-G-T p.Pro1261Pro synonymous LPHN1 6 82612 7.26287E-5 41306 0 NA
19-14262339-C-T p.Gly1257Gly synonymous LPHN1 2 82764 2.41651E-5 41382 0 NA
19-14262346-C-T p.Arg1255Gln missense LPHN1 3 82734 3.62608E-5 41367 0 6.37959E-5
19-14262348-C-A p.Leu1254Phe missense LPHN1 1 82734 1.20869E-5 41367 0 8.60422E-6
19-14262364-T-C p.Asn1249Ser missense LPHN1 1 82704 1.20913E-5 41352 0 4.0819E-6
19-14262375-G-A p.Asn1245Asn synonymous LPHN1 4 82494 4.84884E-5 41247 0 6.25E-4
19-14262384-C-A p.Leu1242Leu synonymous LPHN1 1 82362 1.21415E-5 41181 0 1.24087E-5
19-14262385-A-C p.Leu1242Arg missense LPHN1 1 82356 1.21424E-5 41178 0 NA
19-14262419-A-G p.Leu1231Leu synonymous LPHN1 1 81544 1.22633E-5 40772 0 8.97843E-6
19-14262420-G-A p.Pro1230Pro synonymous LPHN1 1 81570 1.22594E-5 40785 0 4.34949E-6
19-14262423-G-A p.His1229His synonymous LPHN1 1 81516 1.22675E-5 40758 0 NA
19-14262431-C-A c.3683-4G>T splice_region LPHN1 2 81216 2.46257E-5 40608 0 NA
19-14262946-G-A p.Pro127Pro splice_region+synonymous LPHN1 3 83270 3.60274E-5 41635 0 8.24131E-6
19-14262951-C-T p.Glu1226Lys missense LPHN1 1 83276 1.20083E-5 41638 0 NA
19-14262962-C-T p.Gly1222Glu missense+splice_region LPHN1 1 83296 1.20054E-5 41648 0 3.9775E-6
19-14262972-GCAGC-G p.Trp117fs frameshift LPHN1 1 83296 1.20054E-5 41648 0 NA
19-14262991-G-A p.Phe112Phe synonymous LPHN1 1 83302 1.20045E-5 41651 0 NA
19-14262995-AG-A p.Leu111fs frameshift LPHN1 1 83304 1.20042E-5 41652 0 NA
19-14262996-G-C p.Leu111Val missense LPHN1 1 83302 1.20045E-5 41651 0 7.95583E-6
19-14263011-G-A p.Arg106* stop_gained LPHN1 1 83290 1.20062E-5 41645 0 3.30126E-5
19-14263034-TCTGGGGCACAGAACATCCCATGCAGAGGTCCCTTGGGACACAAACCCTCCATTTCCCAACCTGGGATGTTTCCCCCGTGCTCTCAC-T c.292+1_293-1delGTGAGAGCACGGGGGAAACATCCCAGGTTGGGAAATGGAGGGTTTGTGTCCCAAGGGACCTCTGCATGGGATGTTCTGTGCCCCAG splice_acceptor LPHN1 6 83268 7.20565E-5 41634 0 NA
19-14263116-C-T c.3664+5G>A splice_region LPHN1 2 82808 2.41523E-5 41404 0 2.07362E-5
19-14263128-G-A p.Asn1219Asn synonymous LPHN1 1 82794 1.20782E-5 41397 0 4.18298E-6
19-14263129-T-C p.Asn1219Ser missense LPHN1 1 82780 1.20802E-5 41390 0 3.34222E-5
19-14263143-C-T p.Ser1214Ser synonymous LPHN1 4 82646 4.83992E-5 41323 0 2.93469E-5
19-14263154-T-C p.Asn1211Asp missense LPHN1 1 82840 1.20715E-5 41420 0 NA
19-14263168-T-C p.Glu1206Gly missense LPHN1 1 82888 1.20645E-5 41444 0 NA
19-14263170-G-A p.Ala1205Ala synonymous LPHN1 3 82888 3.61934E-5 41444 0 3.18979E-5
19-14263172-C-T p.Ala1205Thr missense LPHN1 3 82890 3.61925E-5 41445 0 4.13227E-6
19-14263173-G-A p.Ile1204Ile synonymous LPHN1 2 82924 2.41185E-5 41462 0 2.59471E-5
19-14263179-G-C p.Thr1202Thr synonymous LPHN1 34 82982 4.09727E-4 41491 0 0.008125
19-14263184-T-C p.Asn1201Asp missense LPHN1 3 82966 3.61594E-5 41483 0 1.64147E-4
19-14263188-G-C p.Pro1199Pro synonymous LPHN1 1 82976 1.20517E-5 41488 0 3.18817E-5
19-14263204-C-T p.Arg1194His missense LPHN1 2 83010 2.40935E-5 41505 0 1.72613E-5
19-14263205-G-A p.Arg1194Cys missense LPHN1 30 83006 3.6142E-4 41503 0 2.17284E-4
19-14263208-G-T p.Pro1193Thr missense LPHN1 1 83032 1.20435E-5 41516 0 NA
19-14263217-C-T p.Val1190Met missense LPHN1 1 83038 1.20427E-5 41519 0 2.58371E-5
19-14263217-C-G p.Val1190Leu missense LPHN1 1 83038 1.20427E-5 41519 0 NA
19-14263218-G-C p.Pro1189Pro synonymous LPHN1 1 83074 1.20375E-5 41537 0 5.72878E-5
19-14263218-G-A p.Pro1189Pro synonymous LPHN1 2 83074 2.40749E-5 41537 0 6.25E-4
19-14263221-G-A p.Asn1188Asn synonymous LPHN1 1 83068 1.20383E-5 41534 0 NA
19-14263226-TCAG-T p.Leu1186del conservative_inframe_deletion LPHN1 2 83072 2.40755E-5 41536 0 NA
19-14263226-T-C p.Thr1187Ala missense LPHN1 1 83072 1.20378E-5 41536 0 2.45329E-5
19-14263245-G-A p.Thr1180Thr synonymous LPHN1 1 83110 1.20322E-5 41555 0 NA
19-14263247-TACCTGGCCAAAGGATCAGAGGTCACAAGGCAGCCGGGAGCCTCCAGAGACTGAAGCCAGAGGCAGAAGGATGCCTTCTC-T p.Gly1179fs frameshift LPHN1 8 83102 9.62672E-5 41551 1 NA
19-14263324-C-T c.3535+5G>A splice_region LPHN1 3 83028 3.61324E-5 41514 0 7.9666E-6
19-14263326-C-T c.3535+3G>A splice_region LPHN1 5 83028 6.02206E-5 41514 0 3.18674E-5
19-14263331-C-T p.Arg1178Gln missense+splice_region LPHN1 1 83012 1.20465E-5 41506 0 1.27494E-4
19-14263336-C-T p.Leu1176Leu synonymous LPHN1 1 83008 1.2047E-5 41504 0 5.03525E-4
19-14263339-G-T p.Thr1175Thr synonymous LPHN1 2 83046 2.4083E-5 41523 0 NA
19-14263346-G-T p.Thr1173Asn missense LPHN1 3 83052 3.61219E-5 41526 0 3.18695E-5
19-14263363-C-T p.Ala1167Ala synonymous LPHN1 33 83202 3.96625E-4 41601 0 0.00117909
19-14263364-G-A p.Ala1167Val missense LPHN1 2 83206 2.40367E-5 41603 0 1.19422E-5
19-14263382-G-A p.Thr1161Met missense LPHN1 1 83240 1.20135E-5 41620 0 NA
19-14263396-A-G p.Thr1156Thr synonymous LPHN1 3 83236 3.60421E-5 41618 0 6.25E-4
19-14263402-A-G p.Asn1154Asn synonymous LPHN1 2 83214 2.40344E-5 41607 0 NA
19-14263421-C-T p.Arg1148Gln missense LPHN1 1 83174 1.2023E-5 41587 0 3.18776E-5
19-14263430-G-A c.3439-5C>T splice_region LPHN1 4 83174 4.8092E-5 41587 0 3.18715E-5
19-14263588-C-T c.3438+8G>A splice_region LPHN1 2 83332 2.40004E-5 41666 0 NA
19-14263590-C-T c.3438+6G>A splice_region LPHN1 1 83334 1.19999E-5 41667 0 3.18573E-5
19-14263591-G-C c.3438+5C>G splice_region LPHN1 9 83332 1.08002E-4 41666 0 2.78931E-5
19-14263611-G-A p.Tyr1141Tyr synonymous LPHN1 1 83358 1.19964E-5 41679 0 NA
19-14263615-C-T p.Arg1140His missense LPHN1 1 83350 1.19976E-5 41675 0 8.24661E-6
19-14263616-G-C p.Arg1140Gly missense LPHN1 2 83352 2.39946E-5 41676 0 8.24525E-6
19-14263630-A-G p.Met1135Thr missense LPHN1 3 83336 3.59988E-5 41668 0 7.95475E-6
19-14263632-G-A p.Ala1134Ala synonymous LPHN1 5 83344 5.99923E-5 41672 0 2.23058E-4
19-14263633-G-C p.Ala1134Gly missense LPHN1 2 83346 2.39964E-5 41673 0 1.59337E-4
19-14263652-C-T p.Gly1128Arg missense LPHN1 1 83306 1.20039E-5 41653 0 3.97725E-6
19-14263653-G-A p.His1127His synonymous LPHN1 1 83302 1.20045E-5 41651 0 1.64777E-5
19-14263661-C-T p.Gly1125Ser missense LPHN1 2 83290 2.40125E-5 41645 0 NA
19-14263665-G-A p.Pro1123Pro synonymous LPHN1 2 83272 2.40177E-5 41636 0 8.23913E-6
19-14263687-T-G p.Tyr1116Ser missense LPHN1 1 83208 1.20181E-5 41604 0 NA
19-14263696-C-T p.Arg1113His missense LPHN1 1 83110 1.20322E-5 41555 0 5.03525E-4
19-14263707-G-A p.Ser1109Ser synonymous LPHN1 1 83018 1.20456E-5 41509 0 NA
19-14263724-C-CCTTCTT c.3310-1_3310insAAGAAG splice_acceptor LPHN1 1 82570 1.21109E-5 41285 0 NA
19-14263727-G-A c.3310-3C>T splice_region LPHN1 1 82484 1.21236E-5 41242 0 NA
19-14263732-G-A c.3310-8C>T splice_region LPHN1 9 82296 1.09361E-4 41148 0 5.99228E-5
19-14266163-G-A c.3309+8C>T splice_region LPHN1 3 82906 3.61856E-5 41453 1 6.38447E-5
19-14266165-C-T c.3309+6G>A splice_region LPHN1 4 83012 4.81858E-5 41506 0 NA
19-14266197-C-T p.Val1095Ile missense LPHN1 3 83248 3.60369E-5 41624 0 5.96654E-5
19-14266198-G-A p.Phe1094Phe synonymous LPHN1 5 83262 6.00514E-5 41631 0 1.64829E-5
19-14266207-G-C p.Val1091Val synonymous LPHN1 4 83286 4.80273E-5 41643 0 1.59297E-4
19-14266222-G-A p.Asn1086Asn synonymous LPHN1 2 83288 2.40131E-5 41644 0 6.37146E-5
19-14266228-G-A p.Thr1084Thr synonymous LPHN1 3 83284 3.60213E-5 41642 0 7.95418E-6
19-14266252-C-T p.Val1076Val synonymous LPHN1 2 83236 2.40281E-5 41618 0 8.24429E-6
19-14266255-C-T p.Ser1075Ser synonymous LPHN1 1 83236 1.2014E-5 41618 0 3.57972E-5
19-14266269-T-C p.Ile1071Val missense LPHN1 1 83166 1.20241E-5 41583 0 3.97769E-6
19-14266273-G-A p.Leu1069Leu synonymous LPHN1 2 83164 2.40489E-5 41582 0 1.19338E-5
19-14266276-G-A p.Leu1068Leu synonymous LPHN1 71 83142 8.53961E-4 41571 0 0.00216643
19-14266282-G-A p.Phe1066Phe synonymous LPHN1 4 83070 4.81522E-5 41535 0 1.5916E-5
19-14266285-A-C p.Ala1065Ala synonymous LPHN1 2 83060 2.4079E-5 41530 0 3.9789E-6
19-14266298-C-G p.Gly1061Ala missense LPHN1 2 82898 2.4126E-5 41449 0 3.98013E-6
19-14266312-C-T p.Leu1056Leu synonymous LPHN1 2545 82724 0.030765 41362 121 0.0597629
19-14266315-C-T p.Ala1055Ala synonymous LPHN1 4 82676 4.83816E-5 41338 0 2.49008E-5
19-14266316-G-A p.Ala1055Val missense LPHN1 2 82648 2.4199E-5 41324 0 6.37308E-5
19-14266317-C-T p.Ala1055Thr missense LPHN1 6 82622 7.26199E-5 41311 0 9.56084E-5
19-14266318-G-A p.Ile1054Ile synonymous LPHN1 3 82604 3.63179E-5 41302 0 2.39265E-5
19-14266327-C-G p.Leu1051Leu synonymous LPHN1 1 82460 1.21271E-5 41230 0 NA
19-14266330-C-T p.Ala1050Ala synonymous LPHN1 3 82300 3.6452E-5 41150 0 3.18674E-5
19-14266342-G-A c.3141-3C>T splice_region LPHN1 1 82082 1.21829E-5 41041 0 1.20129E-5
19-14266346-G-T c.3141-7C>A splice_region LPHN1 1 81956 1.22017E-5 40978 0 NA
19-14266936-G-A p.Arg1042Arg synonymous LPHN1 1 79318 1.26075E-5 39659 0 8.17715E-6
19-14266937-C-A p.Arg1042Leu missense LPHN1 2 79302 2.522E-5 39651 0 NA
19-14266937-C-T p.Arg1042His missense LPHN1 1 79302 1.261E-5 39651 0 4.09035E-6
19-14266948-G-A p.Pro1038Pro synonymous LPHN1 2 79678 2.5101E-5 39839 0 7.48139E-5
19-14266970-C-T p.Arg1031Gln missense LPHN1 1 80256 1.24601E-5 40128 0 1.21607E-5
19-14266996-G-A p.Leu1022Leu synonymous LPHN1 1 80276 1.2457E-5 40138 0 NA
19-14266999-G-A p.Phe1021Phe synonymous LPHN1 2 80134 2.49582E-5 40067 0 1.22215E-5
19-14267015-T-TG c.3049-3_3049-2insC splice_region LPHN1 3 79432 3.77682E-5 39716 0 3.19816E-5
19-14267470-C-T p.Val1016Val splice_region+synonymous LPHN1 1 81212 1.23135E-5 40606 0 NA
19-14267472-C-T p.Val1016Met missense+splice_region LPHN1 7 81312 8.60882E-5 40656 0 1.33017E-4
19-14267474-A-G p.Ile1015Thr missense LPHN1 1 81542 1.22636E-5 40771 0 NA
19-14267478-C-T p.Val1014Ile missense LPHN1 1 81736 1.22345E-5 40868 0 1.21346E-5
19-14267479-G-A p.Phe1013Phe synonymous LPHN1 8 81826 9.77684E-5 40913 0 5.42982E-5
19-14267482-G-C p.Ser1012Ser synonymous LPHN1 1 81942 1.22038E-5 40971 0 8.08754E-6
19-14267494-G-A p.Ile1008Ile synonymous LPHN1 1 82098 1.21806E-5 41049 0 5.32277E-5
19-14267496-T-A p.Ile1008Phe missense LPHN1 1 82136 1.21749E-5 41068 0 5.04032E-4
19-14267540-T-C c.2982-4A>G splice_region LPHN1 4 81816 4.88902E-5 40908 0 3.48691E-5
19-14267729-A-G c.2981+8T>C splice_region LPHN1 1 82208 1.21643E-5 41104 0 NA
19-14267743-T-C p.Glu992Gly missense LPHN1 2 82354 2.42854E-5 41177 0 NA
19-14267745-G-A p.Thr991Thr synonymous LPHN1 1 82370 1.21403E-5 41185 0 3.67762E-5
19-14267751-G-A p.Tyr989Tyr synonymous LPHN1 6 82428 7.27908E-5 41214 0 4.53284E-5
19-14267755-C-A p.Ser988Ile missense LPHN1 1 82496 1.21218E-5 41248 0 NA
19-14267758-C-T p.Arg987His missense LPHN1 1 82476 1.21247E-5 41238 0 2.67442E-5
19-14267766-A-G p.Ile984Ile synonymous LPHN1 1 82560 1.21124E-5 41280 0 NA
19-14267767-A-G p.Ile984Thr missense LPHN1 1 82568 1.21112E-5 41284 0 NA
19-14267772-A-G p.Ala982Ala synonymous LPHN1 2 82590 2.4216E-5 41295 0 9.59141E-5
19-14267775-C-T p.Ala981Ala synonymous LPHN1 56 82550 6.78377E-4 41275 0 0.00218685
19-14267776-G-A p.Ala981Val missense LPHN1 1 82520 1.21183E-5 41260 0 NA
19-14267777-C-T p.Ala981Thr missense LPHN1 1 82524 1.21177E-5 41262 0 3.19775E-5
19-14267778-G-A p.Ile980Ile synonymous LPHN1 1 82542 1.2115E-5 41271 0 3.19632E-5
19-14267780-T-C p.Ile980Val missense LPHN1 90 82578 0.00108988 41289 0 9.1866E-4
19-14267791-AG-A p.Leu976fs frameshift LPHN1 1 82644 1.21001E-5 41322 0 NA
19-14267793-G-A p.Ala975Ala synonymous LPHN1 4 82628 4.84097E-5 41314 0 5.04032E-4
19-14267813-C-T p.Gly969Ser missense LPHN1 1 82736 1.20866E-5 41368 0 9.57916E-5
19-14267830-G-A p.Thr963Ile missense LPHN1 1 82876 1.20662E-5 41438 0 NA
19-14267833-C-T p.Arg962His missense LPHN1 1 82890 1.20642E-5 41445 0 6.38978E-5
19-14267839-T-C p.Tyr960Cys missense LPHN1 1 82958 1.20543E-5 41479 0 NA
19-14267847-C-G p.Glu957Asp missense LPHN1 1 82972 1.20523E-5 41486 0 NA
19-14267868-C-A p.Leu950Leu synonymous LPHN1 1 83026 1.20444E-5 41513 0 NA
19-14267877-G-A p.His947His synonymous LPHN1 3 82998 3.61454E-5 41499 0 1.66892E-5
19-14267882-C-T p.Val946Met missense LPHN1 1 82984 1.20505E-5 41492 0 3.18898E-5
19-14267901-G-A p.Ser939Ser synonymous LPHN1 1 83038 1.20427E-5 41519 0 NA
19-14267902-G-C p.Ser939Cys missense LPHN1 1 83028 1.20441E-5 41514 0 8.31518E-6
19-14267904-G-A p.Phe938Phe synonymous LPHN1 2 83042 2.40842E-5 41521 0 3.18837E-5
19-14267916-G-A p.Phe934Phe synonymous LPHN1 1 83054 1.20404E-5 41527 0 NA
19-14267937-G-A p.Ala927Ala synonymous LPHN1 6 82976 7.23101E-5 41488 0 6.38407E-5
19-14267940-G-A p.Phe926Phe synonymous LPHN1 1 82996 1.20488E-5 41498 0 2.39198E-5
19-14267945-T-C p.Ile925Val missense LPHN1 4 83006 4.81893E-5 41503 0 1.27787E-4
19-14267950-C-T p.Cys923Tyr missense LPHN1 1 82974 1.2052E-5 41487 0 NA
19-14267957-TCTGCGGGGAGCACTGAGGGTGAGGGGCTGCTGCCTGGACAGGTGTCCCCCTTCTTCTCCCGGCCCCCAGGCGCTGGCCGTCACCTGCCCTAGAGTCCCAGCCCAC-T c.2760+1_2761-1del splice_acceptor LPHN1 4 82980 4.82044E-5 41490 0 NA
19-14267961-C-T c.2761-4G>A splice_region LPHN1 10 82954 1.20549E-4 41477 0 9.57916E-5
19-14267962-G-A c.2761-5C>T splice_region LPHN1 14 82966 1.68744E-4 41483 0 3.98612E-4
19-14268057-G-C c.2760+6C>G splice_region LPHN1 1 83162 1.20247E-5 41581 0 NA
19-14268080-C-T p.Asp915Asn missense LPHN1 2 83220 2.40327E-5 41610 0 1.64813E-5
19-14268096-G-A p.Leu909Leu synonymous LPHN1 20 83268 2.40188E-4 41634 0 9.54791E-5
19-14268098-G-A p.Leu909Phe missense LPHN1 1 83254 1.20114E-5 41627 0 8.23913E-6
19-14268105-A-G p.Ala906Ala synonymous LPHN1 1 83276 1.20083E-5 41638 0 3.97785E-6
19-14268117-G-A p.Asn902Asn synonymous LPHN1 1 83282 1.20074E-5 41641 0 4.94324E-5
19-14268132-C-A p.Lys897Asn missense LPHN1 2 83286 2.40136E-5 41643 0 NA
19-14268145-T-C p.Asn893Ser missense LPHN1 1 83266 1.20097E-5 41633 0 6.37918E-5
19-14268149-G-A p.Arg892Cys missense LPHN1 1 83262 1.20103E-5 41631 0 1.64766E-5
19-14268152-C-T p.Asp891Asn missense LPHN1 2 83248 2.40246E-5 41624 0 2.47158E-5
19-14268195-G-A p.Ala876Ala synonymous LPHN1 1 83236 1.2014E-5 41618 0 3.18817E-5
19-14268197-C-T p.Ala876Thr missense LPHN1 1 83232 1.20146E-5 41616 0 NA
19-14268207-C-G p.Leu872Leu synonymous LPHN1 10 83234 1.20143E-4 41617 0 1.9887E-5
19-14268213-G-A p.Ile870Ile synonymous LPHN1 2 83210 2.40356E-5 41605 0 3.29717E-5
19-14268220-A-G p.Ile868Thr missense LPHN1 1 83192 1.20204E-5 41596 0 1.64878E-5
19-14268248-G-A p.Leu859Leu synonymous LPHN1 1 83122 1.20305E-5 41561 0 NA
19-14268249-C-T p.Leu858Leu synonymous LPHN1 1 83112 1.2032E-5 41556 0 NA
19-14268255-G-A p.Asn856Asn synonymous LPHN1 1 83062 1.20392E-5 41531 0 1.27486E-4
19-14268262-C-T p.Arg854His missense LPHN1 1 82972 1.20523E-5 41486 0 3.30972E-5
19-14268267-C-T p.Gln852Gln synonymous LPHN1 1 82932 1.20581E-5 41466 0 8.27828E-6
19-14268701-C-T p.Arg848His missense LPHN1 1 82570 1.21109E-5 41285 0 2.49397E-5
19-14268721-G-A p.Phe841Phe synonymous LPHN1 3 82824 3.62214E-5 41412 0 3.98086E-5
19-14268733-G-A p.His837His synonymous LPHN1 1 82918 1.20601E-5 41459 0 NA
19-14268748-C-T p.Thr832Thr synonymous LPHN1 1 82982 1.20508E-5 41491 0 2.47398E-5
19-14268749-G-A p.Thr832Met missense LPHN1 3 82990 3.61489E-5 41495 0 2.90404E-4
19-14268752-G-A p.Thr831Ile missense LPHN1 1 82990 1.20496E-5 41495 0 NA
19-14268764-T-C p.Asn827Ser missense LPHN1 2 83022 2.409E-5 41511 0 8.24307E-6
19-14268779-C-A p.Arg822Leu missense LPHN1 1 83050 1.20409E-5 41525 0 3.97731E-6
19-14268799-G-A p.Tyr815Tyr synonymous LPHN1 8695 82864 0.104931 41432 542 0.126121
19-14268805-C-T p.Leu813Leu synonymous LPHN1 1 83132 1.20291E-5 41566 0 NA
19-14268815-C-T p.Arg810His missense LPHN1 1 83120 1.20308E-5 41560 0 1.98864E-5
19-14268832-G-A p.Phe804Phe synonymous LPHN1 1 83118 1.20311E-5 41559 0 NA
19-14268848-T-C p.Asn799Ser missense LPHN1 1 83064 1.20389E-5 41532 0 NA
19-14268853-G-A p.His797His synonymous LPHN1 2 83046 2.4083E-5 41523 0 9.55779E-5
19-14268866-TGTTGTGTGGTGGCA-T c.2380-16_2380-3delTGCCACCACACAAC splice_region LPHN1 1 82982 1.20508E-5 41491 0 NA
19-14268870-G-A c.2380-6C>T splice_region LPHN1 1 82944 1.20563E-5 41472 0 NA
19-14269142-C-T c.2379+8G>A splice_region LPHN1 1 81840 1.2219E-5 40920 0 3.18756E-5
19-14269144-G-A c.2379+6C>T splice_region LPHN1 2 81878 2.44266E-5 40939 0 1.99968E-5
19-14269164-C-T p.Val789Met missense LPHN1 1 82280 1.21536E-5 41140 0 3.18796E-5
19-14269165-G-A p.Thr788Thr synonymous LPHN1 2 82310 2.42984E-5 41155 0 4.15069E-5
19-14269173-T-C p.Ile786Val missense LPHN1 1 82500 1.21212E-5 41250 0 NA
19-14269174-G-A p.Val785Val synonymous LPHN1 3 82530 3.63504E-5 41265 0 0.00101112
19-14269184-A-G p.Met782Thr missense LPHN1 3 82738 3.6259E-5 41369 0 3.18837E-5
19-14269194-C-T p.Val779Ile missense LPHN1 1 82800 1.20773E-5 41400 0 3.18857E-5
19-14269195-G-A p.Arg778Arg synonymous LPHN1 1795 82734 0.021696 41367 46 0.0402655
19-14269201-G-A p.Ser776Ser synonymous LPHN1 1 82912 1.2061E-5 41456 0 8.28253E-6
19-14269205-T-C p.Glu775Gly missense LPHN1 1 82930 1.20584E-5 41465 0 NA
19-14269224-C-T p.Ala769Thr missense LPHN1 1 82934 1.20578E-5 41467 0 NA
19-14269225-G-A p.Ile768Ile synonymous LPHN1 7 82962 8.4376E-5 41481 0 9.55962E-5
19-14269228-G-T p.Val767Val synonymous LPHN1 1 82976 1.20517E-5 41488 0 NA
19-14269234-T-G p.Ser765Ser synonymous LPHN1 2 83014 2.40923E-5 41507 0 NA
19-14269248-G-C p.Leu761Val missense LPHN1 1 83032 1.20435E-5 41516 0 8.28295E-6
19-14269254-C-T p.Ala759Thr missense LPHN1 8 82988 9.63995E-5 41494 0 1.91241E-4
19-14269254-C-A p.Ala759Ser missense LPHN1 1 82988 1.20499E-5 41494 0 NA
19-14269255-G-A p.Gly758Gly synonymous LPHN1 2 83006 2.40946E-5 41503 0 3.18857E-5
19-14269262-G-A p.Pro756Leu missense LPHN1 1 83044 1.20418E-5 41522 0 NA
19-14269266-C-T p.Gly755Ser missense LPHN1 2 83028 2.40883E-5 41514 0 NA
19-14269270-C-T p.Pro753Pro synonymous LPHN1 2 83024 2.40894E-5 41512 0 3.31669E-5
19-14269270-C-A p.Pro753Pro synonymous LPHN1 2 83024 2.40894E-5 41512 0 NA
19-14269270-C-G p.Pro753Pro synonymous LPHN1 1 83024 1.20447E-5 41512 0 7.9666E-6
19-14269272-G-C p.Pro753Ala missense LPHN1 4 82994 4.81963E-5 41497 0 2.38949E-5
19-14269275-C-G p.Gly752Arg missense LPHN1 3 83026 3.61333E-5 41513 0 4.38034E-5
19-14269279-T-G p.Glu750Asp missense LPHN1 2673 82994 0.0322071 41497 133 0.0629226
19-14269281-C-T p.Glu750Lys missense LPHN1 1 83078 1.20369E-5 41539 0 1.65703E-5
19-14269282-G-A p.Gly749Gly synonymous LPHN1 1 83056 1.20401E-5 41528 0 4.14326E-5
19-14269284-C-T p.Gly749Ser missense LPHN1 2 83100 2.40674E-5 41550 0 4.9701E-5
19-14269285-G-A p.Ala748Ala synonymous LPHN1 56 83092 6.73952E-4 41546 0 0.00257162
19-14269286-G-T p.Ala748Asp missense LPHN1 2 83104 2.40662E-5 41552 0 5.97162E-5
19-14269289-A-C p.Leu747Arg missense LPHN1 2 83114 2.40633E-5 41557 0 NA
19-14269300-G-A p.Ala743Ala synonymous LPHN1 2 83146 2.40541E-5 41573 0 3.18593E-5
19-14269306-C-A p.Glu741Asp missense LPHN1 1 83146 1.2027E-5 41573 0 NA
19-14269315-C-T p.Leu738Leu synonymous LPHN1 1 83146 1.2027E-5 41573 0 3.31389E-5
19-14269316-A-G p.Leu738Pro missense LPHN1 2 83148 2.40535E-5 41574 0 NA
19-14269329-G-C p.Leu734Val missense LPHN1 1 83118 1.20311E-5 41559 0 5.03525E-4
19-14269342-G-A p.Ile729Ile synonymous LPHN1 5 83068 6.01917E-5 41534 0 0.00100705
19-14269894-A-C c.2164+8T>G splice_region LPHN1 1 82368 1.21406E-5 41184 0 NA
19-14269936-C-T p.Leu710Leu synonymous LPHN1 1 82780 1.20802E-5 41390 0 NA
19-14269939-C-G p.Gln709His missense LPHN1 1 82782 1.20799E-5 41391 0 NA
19-14269946-G-T p.Ser707Tyr missense LPHN1 1 82828 1.20732E-5 41414 0 NA
19-14269957-C-T p.Pro703Pro synonymous LPHN1 16 82848 1.93125E-4 41424 0 0.00100705
19-14269958-G-A p.Pro703Leu missense LPHN1 1 82838 1.20718E-5 41419 0 3.18735E-5
19-14269975-G-A p.Phe697Phe synonymous LPHN1 2 82810 2.41517E-5 41405 0 NA
19-14269990-C-T p.Val692Val synonymous LPHN1 3 82762 3.62485E-5 41381 0 3.29804E-5
19-14269998-C-T p.Gly690Ser missense LPHN1 2 82744 2.41709E-5 41372 0 NA
19-14270001-C-CT p.Glu689fs frameshift LPHN1 1 82744 1.20855E-5 41372 0 NA
19-14270002-T-C p.Thr688Thr synonymous LPHN1 2 82730 2.4175E-5 41365 0 NA
19-14270010-G-A p.Leu686Leu synonymous LPHN1 1 82724 1.20884E-5 41362 0 NA
19-14270019-C-T p.Val683Ile missense LPHN1 1 82700 1.20919E-5 41350 0 NA
19-14270022-C-G p.Glu682Gln missense LPHN1 2 82692 2.41861E-5 41346 0 8.25655E-6
19-14270217-G-A p.Asn678Asn synonymous LPHN1 3 82464 3.63795E-5 41232 0 2.43297E-5
19-14270262-G-A p.Ala663Ala synonymous LPHN1 1 82444 1.21294E-5 41222 0 6.37267E-5
19-14270277-G-A p.Gly658Gly synonymous LPHN1 6 82254 7.29448E-5 41127 0 9.18473E-5
19-14270286-C-T p.Leu655Leu synonymous LPHN1 1 82332 1.21459E-5 41166 0 NA
19-14270289-G-A p.Val654Val synonymous LPHN1 1 82314 1.21486E-5 41157 0 8.33583E-5
19-14270295-G-A p.Leu652Leu synonymous LPHN1 6 82284 7.29182E-5 41142 0 9.56938E-5
19-14270310-C-T p.Thr647Thr synonymous LPHN1 29 82136 3.53073E-4 41068 0 9.006E-4
19-14270311-G-A p.Thr647Met missense LPHN1 4 82168 4.86808E-5 41084 0 5.03525E-4
19-14270326-G-A p.Thr642Met missense LPHN1 1 82130 1.21758E-5 41065 0 3.99658E-6
19-14270349-C-T p.Glu634Glu synonymous LPHN1 1 82174 1.21693E-5 41087 0 NA
19-14270365-C-T p.Arg629Gln missense LPHN1 1 82148 1.21732E-5 41074 0 3.1904E-5
19-14270393-C-T p.Val620Met missense LPHN1 1 82346 1.21439E-5 41173 0 3.18918E-5
19-14270394-G-A p.Ala619Ala splice_region+synonymous LPHN1 3 82324 3.64414E-5 41162 0 3.19E-5
19-14270395-G-T p.Ala619Asp missense+splice_region LPHN1 1 82310 1.21492E-5 41155 0 NA
19-14270402-C-T c.1855-6G>A splice_region LPHN1 10 82442 1.21297E-4 41221 0 6.696E-4
19-14270543-T-G c.1854+4A>C splice_region LPHN1 1 83184 1.20215E-5 41592 0 3.97801E-6
19-14270564-A-T p.Cys613Ser missense LPHN1 2 83196 2.40396E-5 41598 0 NA
19-14270575-C-T p.Arg609Gln missense LPHN1 1 83206 1.20184E-5 41603 0 NA
19-14270588-A-G c.1816-3T>C splice_region LPHN1 6 83160 7.21501E-5 41580 0 9.56328E-5
19-14270589-G-A c.1816-4C>T splice_region LPHN1 1 83154 1.20259E-5 41577 0 NA
19-14270941-C-T p.Gly600Ser missense LPHN1 2 81878 2.44266E-5 40939 0 5.23972E-5
19-14270942-G-A p.Ala599Ala synonymous LPHN1 4 81928 4.88234E-5 40964 0 NA
19-14270956-C-T p.Glu595Lys missense LPHN1 1 82100 1.21803E-5 41050 0 NA
19-14270957-G-A p.Ile594Ile synonymous LPHN1 3 82118 3.65328E-5 41059 1 2.81326E-5
19-14270959-T-C p.Ile594Val missense LPHN1 1 82128 1.21761E-5 41064 0 NA
19-14270964-C-T p.Arg592Gln missense LPHN1 1 82158 1.21717E-5 41079 0 1.68427E-5
19-14270965-G-A p.Arg592Trp missense LPHN1 1 82140 1.21743E-5 41070 0 4.01307E-6
19-14271019-C-G p.Val574Leu missense LPHN1 1 82360 1.21418E-5 41180 0 NA
19-14271019-C-T p.Val574Met missense LPHN1 1 82360 1.21418E-5 41180 0 NA
19-14271027-G-A p.Ser571Phe missense LPHN1 2 82340 2.42895E-5 41170 0 3.19142E-5
19-14271031-C-T p.Val570Ile missense LPHN1 2 82218 2.43256E-5 41109 0 NA
19-14271032-G-A p.Asp569Asp synonymous LPHN1 3 82184 3.65035E-5 41092 0 4.00163E-5
19-14271033-T-TC p.Asp569fs frameshift LPHN1 1 82070 1.21847E-5 41035 0 NA
19-14271034-C-A p.Asp569Tyr missense LPHN1 1 82158 1.21717E-5 41079 0 NA
19-14271036-C-G p.Gly568Ala missense LPHN1 1 82148 1.21732E-5 41074 0 NA
19-14271038-C-T p.Ala567Ala synonymous LPHN1 1 82094 1.21812E-5 41047 0 3.33145E-5
19-14271038-C-G p.Ala567Ala synonymous LPHN1 2 82094 2.43623E-5 41047 0 3.19203E-5
19-14271039-G-A p.Ala567Val missense LPHN1 5 82062 6.09295E-5 41031 0 1.68094E-4
19-14271040-C-T p.Ala567Thr missense LPHN1 10 82034 1.21901E-4 41017 0 2.55428E-4
19-14271040-C-A p.Ala567Ser missense LPHN1 1 82034 1.21901E-5 41017 0 NA
19-14271041-G-A p.Tyr566Tyr synonymous LPHN1 2 82024 2.43831E-5 41012 0 9.57671E-5
19-14271047-G-A p.Ser564Ser synonymous LPHN1 17 81868 2.07651E-4 40934 0 5.04032E-4
19-14271050-G-C p.Gly563Gly synonymous LPHN1 1 81718 1.22372E-5 40859 0 4.01085E-6
19-14271050-G-A p.Gly563Gly synonymous LPHN1 1 81718 1.22372E-5 40859 0 NA
19-14271051-C-G p.Gly563Ala missense LPHN1 1 81618 1.22522E-5 40809 0 NA
19-14271054-C-T p.Arg562Gln missense LPHN1 5 81524 6.13316E-5 40762 0 5.04032E-4
19-14271063-C-G p.Arg559Pro missense LPHN1 1 81350 1.22926E-5 40675 0 NA
19-14271063-C-T p.Arg559Gln missense LPHN1 2 81350 2.45851E-5 40675 0 8.37493E-6
19-14271074-G-A p.Ser555Ser synonymous LPHN1 6 80886 7.41785E-5 40443 0 2.43043E-5
19-14271075-C-T p.Ser555Asn missense LPHN1 1 80890 1.23625E-5 40445 0 NA
19-14271089-C-T p.Ala550Ala synonymous LPHN1 1 80650 1.23993E-5 40325 0 1.21969E-5
19-14271090-G-A p.Ala550Val missense LPHN1 1 80618 1.24042E-5 40309 0 3.19305E-5
19-14271092-G-A p.Asn549Asn synonymous LPHN1 5 80662 6.19871E-5 40331 0 9.57243E-5
19-14271095-C-G p.Glu548Asp missense LPHN1 7 80680 8.67625E-5 40340 0 3.19061E-5
19-14271098-C-A p.Gly547Gly synonymous LPHN1 1 80676 1.23953E-5 40338 0 NA
19-14271100-CA-GG p.SerGly546SerArg missense LPHN1 1 80654 1.23986E-5 40327 0 NA
19-14271101-A-G p.Ser546Ser synonymous LPHN1 78 80552 9.68319E-4 40276 0 9.93644E-4
19-14271413-C-A p.Ala541Ser missense LPHN1 1 80968 1.23506E-5 40484 0 7.94686E-5
19-14271427-C-G p.Trp536Ser missense LPHN1 1 81354 1.2292E-5 40677 0 4.10051E-6
19-14271453-A-G p.Pro527Pro synonymous LPHN1 2 81882 2.44254E-5 40941 0 3.66066E-5
19-14271460-C-T p.Arg525Gln missense LPHN1 3 81846 3.66542E-5 40923 0 3.18878E-5
19-14271461-G-A p.Arg525Trp missense LPHN1 1 81916 1.22076E-5 40958 0 1.21103E-5
19-14271479-A-G p.Leu519Leu synonymous LPHN1 2 81884 2.44248E-5 40942 0 1.81722E-5
19-14271501-G-A p.Ala511Ala synonymous LPHN1 3 81512 3.68044E-5 40756 0 NA
19-14271504-A-G p.Ile510Ile synonymous LPHN1 1 81392 1.22862E-5 40696 0 NA
19-14271505-A-G p.Ile510Thr missense LPHN1 3 81382 3.68632E-5 40691 0 5.68397E-5
19-14272114-CTG-C c.1525+8_1525+9delCA splice_region LPHN1 2 43748 4.57164E-5 21874 0 1.01326E-5
19-14272126-C-T p.Arg508Gln missense+splice_region LPHN1 1 43932 2.27625E-5 21966 0 3.19285E-5
19-14272129-G-A p.Thr507Ile missense LPHN1 1 44066 2.26932E-5 22033 0 NA
19-14272131-C-T p.Gly73Glu missense LPHN1 19 44146 4.3039E-4 22073 0 3.49169E-4
19-14272134-C-T p.Arg72Lys missense LPHN1 1 44254 2.25968E-5 22127 0 2.02179E-5
19-14272157-G-C p.Leu498Val missense LPHN1 1 43496 2.29906E-5 21748 0 1.18353E-4
19-14272176-C-T p.Arg58Gln missense LPHN1 9 43060 2.09011E-4 21530 0 3.22685E-4
19-14272190-G-T p.Arg487Arg synonymous LPHN1 1 45362 2.20449E-5 22681 0 NA
19-14272203-G-T p.Pro49His missense LPHN1 1 46376 2.15629E-5 23188 0 NA
19-14272209-G-A p.Ala47Val missense LPHN1 177 46432 0.00381203 23216 1 0.00826473
19-14272215-G-A p.Ser45Phe missense LPHN1 1 46934 2.13065E-5 23467 0 1.34481E-5
19-14272229-C-T p.Val474Met missense LPHN1 7 47162 1.48425E-4 23581 0 1.27787E-4
19-14272232-G-A p.His473Tyr missense LPHN1 1 47352 2.11184E-5 23676 0 NA
19-14272233-T-C p.Tyr39Cys missense LPHN1 50 47296 0.00105717 23648 0 0.00326337
19-14272240-G-A p.Arg37* stop_gained LPHN1 1 47246 2.11658E-5 23623 0 2.05516E-5
19-14272241-G-A p.Pro470Ser missense LPHN1 1 47370 2.11104E-5 23685 0 NA
19-14272243-G-A p.Ala469Val missense LPHN1 1 47336 2.11256E-5 23668 0 4.49115E-5
19-14272252-C-T p.Arg466Gln missense LPHN1 11 47336 2.32381E-4 23668 0 3.74191E-4
19-14272255-C-T p.Arg465Gln missense LPHN1 3 47540 6.31048E-5 23770 0 9.63948E-5
19-14272256-G-A p.Arg465Trp missense LPHN1 5 47662 1.04905E-4 23831 0 9.47634E-6
19-14272256-G-C p.Arg465Gly missense LPHN1 2 47662 4.19622E-5 23831 0 2.87952E-5
19-14272261-C-T p.Ser463Asn missense LPHN1 2 47692 4.19358E-5 23846 0 6.01866E-5
19-14272271-G-A p.Pro460Ser missense LPHN1 1 48042 2.08151E-5 24021 0 NA
19-14272292-C-G p.Asp453His missense LPHN1 1 47744 2.0945E-5 23872 0 NA
19-14272295-G-A p.Pro452Ser missense LPHN1 1 47622 2.09987E-5 23811 0 2.70764E-4
19-14272301-G-A p.Leu450Leu synonymous LPHN1 4 47474 8.42566E-5 23737 0 1.35126E-4
19-14272305-G-A p.Thr15Ile missense LPHN1 1 47160 2.12044E-5 23580 0 7.63631E-5
19-14272306-T-C p.Asn448Ser missense LPHN1 1 47054 2.12522E-5 23527 0 NA
19-14272313-C-T p.Ala446Thr missense LPHN1 3 46802 6.40998E-5 23401 0 0.00154004
19-14272326-C-T p.Arg8His missense LPHN1 1 46120 2.16826E-5 23060 0 1.27845E-4
19-14272327-G-A p.Thr441Met missense LPHN1 1 46500 2.15054E-5 23250 0 3.16156E-5
19-14272339-G-A p.Ala437Val missense LPHN1 3 46304 6.47892E-5 23152 0 2.67094E-4
19-14272342-C-T p.Arg436Gln missense LPHN1 2 46074 4.34084E-5 23037 0 5.14403E-4
19-14272343-G-A p.Arg436Trp missense LPHN1 2 46384 4.31183E-5 23192 0 5.79341E-5
19-14272345-C-T p.Arg435His missense LPHN1 5 45878 1.08985E-4 22939 0 0.00154639
19-14272351-G-A p.Pro433Leu missense LPHN1 1 46442 2.15322E-5 23221 0 5.13875E-4
19-14272356-G-A p.Thr431Thr synonymous LPHN1 3 46318 6.47696E-5 23159 0 6.38162E-5
19-14272364-C-T p.Ala429Thr missense LPHN1 1 45904 2.17846E-5 22952 0 6.25782E-4
19-14272365-G-A p.Pro428Pro synonymous LPHN1 1 46374 2.15638E-5 23187 0 7.11069E-5
19-14272368-C-T p.Ser427Ser synonymous LPHN1 1 45698 2.18828E-5 22849 0 2.33765E-5
19-14272369-G-A p.Ser427Leu missense LPHN1 2 46316 4.31816E-5 23158 0 2.87103E-5
19-14272376-T-A p.Thr425Ser missense LPHN1 10 46070 2.17061E-4 23035 0 0.00102836
19-14272382-T-G p.Thr423Pro missense LPHN1 2 45970 4.35066E-5 22985 0 2.14197E-5
19-14272383-G-C p.Leu422Leu synonymous LPHN1 1 46164 2.16619E-5 23082 0 2.12134E-5
19-14272390-G-A p.Thr420Met missense LPHN1 1 45576 2.19414E-5 22788 0 NA
19-14272399-G-A p.Ala417Val missense LPHN1 1 45486 2.19848E-5 22743 0 NA
19-14272401-TGTG-T p.Thr416del disruptive_inframe_deletion LPHN1 3 45452 6.60037E-5 22726 0 2.06834E-5
19-14272411-G-A p.Thr413Met missense LPHN1 1 44986 2.22291E-5 22493 0 1.07361E-5
19-14272418-G-A p.Leu411Phe missense LPHN1 1 45102 2.2172E-5 22551 0 NA
19-14272420-G-C p.Pro410Arg missense LPHN1 1 44752 2.23454E-5 22376 0 3.19366E-5
19-14272422-T-G p.Pro409Pro synonymous LPHN1 1 44172 2.26388E-5 22086 0 NA
19-14272426-G-C p.Ser408Cys missense LPHN1 1 44676 2.23834E-5 22338 0 NA
19-14272427-A-C p.Ser408Ala missense LPHN1 4 44250 9.03955E-5 22125 0 3.20082E-5
19-14272442-G-A c.1211-4C>T splice_region LPHN1 6 44616 1.34481E-4 22308 0 6.25E-4
19-14273410-G-A c.1210+8C>T splice_region LPHN1 1 80256 1.24601E-5 40128 0 7.17824E-5
19-14273415-C-T c.1210+3G>A splice_region LPHN1 10 80710 1.239E-4 40355 0 9.55414E-5
19-14273423-C-G p.Ser402Thr missense LPHN1 1 81046 1.23387E-5 40523 0 NA
19-14273424-T-C p.Ser402Gly missense LPHN1 1 81070 1.2335E-5 40535 0 3.18593E-5
19-14273425-G-A p.Pro401Pro synonymous LPHN1 2 81110 2.46579E-5 40555 0 4.44466E-5
19-14273431-G-A p.Pro399Pro synonymous LPHN1 1 81262 1.23059E-5 40631 0 4.30775E-5
19-14273434-C-T p.Pro398Pro synonymous LPHN1 1 81366 1.22901E-5 40683 0 2.40983E-5
19-14273434-C-A p.Pro398Pro synonymous LPHN1 1 81366 1.22901E-5 40683 0 1.71677E-5
19-14273435-G-A p.Pro398Leu missense LPHN1 3 81464 3.68261E-5 40732 0 3.41256E-5
19-14273437-C-T p.Gly397Gly synonymous LPHN1 1 81520 1.22669E-5 40760 0 8.50152E-6
19-14273439-C-T p.Gly397Arg missense LPHN1 3 81676 3.67305E-5 40838 0 5.07666E-5
19-14273440-G-A p.Phe396Phe synonymous LPHN1 1 81710 1.22384E-5 40855 0 2.52955E-5
19-14273456-C-T p.Arg391His missense LPHN1 1 82274 1.21545E-5 41137 0 1.99144E-5
19-14273457-G-A p.Arg391Cys missense LPHN1 1 82324 1.21471E-5 41162 0 3.18695E-5
19-14273463-C-A p.Val389Leu missense LPHN1 1 82546 1.21145E-5 41273 0 NA
19-14273471-T-C p.Asn386Ser missense LPHN1 1 82798 1.20776E-5 41399 0 7.95653E-6
19-14273481-C-T p.Val383Ile missense LPHN1 1 82920 1.20598E-5 41460 0 7.95501E-6
19-14273482-G-A p.Tyr382Tyr synonymous LPHN1 1 82950 1.20555E-5 41475 0 6.25E-4
19-14273496-C-T p.Asp378Asn missense LPHN1 2 83060 2.4079E-5 41530 0 3.18776E-5
19-14273497-G-A p.Arg377Arg synonymous LPHN1 2 83072 2.40755E-5 41536 0 5.03525E-4
19-14273498-C-T p.Arg377His missense LPHN1 1 83088 1.20354E-5 41544 0 3.97716E-6
19-14273502-G-A p.Pro376Ser missense LPHN1 1 83138 1.20282E-5 41569 0 NA
19-14273514-C-T p.Val372Ile missense LPHN1 2 83174 2.4046E-5 41587 0 3.57916E-5
19-14273515-G-A p.Ser371Ser synonymous LPHN1 4 83178 4.80896E-5 41589 0 6.36943E-5
19-14273539-G-A p.Pro363Pro synonymous LPHN1 3 83200 3.60577E-5 41600 0 NA
19-14273550-G-A p.Leu360Phe missense LPHN1 1 83192 1.20204E-5 41596 0 1.64853E-5
19-14273551-G-A p.Ser359Ser synonymous LPHN1 3 83188 3.60629E-5 41594 0 1.19309E-5
19-14273566-G-A p.Arg354Arg synonymous LPHN1 11 83144 1.32301E-4 41572 0 1.59327E-4
19-14273567-C-T p.Arg354His missense LPHN1 83 83142 9.98292E-4 41571 0 0.00138506
19-14273568-G-A p.Arg354Cys missense LPHN1 7 83154 8.41812E-5 41577 0 1.64908E-5
19-14273587-G-A p.Ala347Ala synonymous LPHN1 1 83154 1.20259E-5 41577 0 NA
19-14273590-A-G p.Tyr346Tyr synonymous LPHN1 1 83156 1.20256E-5 41578 0 NA
19-14273598-C-T p.Val344Met missense LPHN1 4 83064 4.81556E-5 41532 0 2.64083E-4
19-14273600-C-T p.Arg343His missense LPHN1 2 83040 2.40848E-5 41520 0 4.12671E-5
19-14273601-G-A p.Arg343Cys missense LPHN1 1 83060 1.20395E-5 41530 0 3.18253E-5
19-14273612-G-A p.Ala339Val missense LPHN1 8 82996 9.63902E-5 41498 0 1.27592E-4
19-14273616-C-T p.Glu338Lys missense LPHN1 1 83010 1.20467E-5 41505 0 3.97899E-6
19-14273629-C-T p.Val333Val synonymous LPHN1 1 83056 1.20401E-5 41528 0 NA
19-14273632-G-A p.Tyr332Tyr synonymous LPHN1 5 83038 6.02134E-5 41519 0 6.25E-4
19-14273641-A-G p.Arg329Arg synonymous LPHN1 13227 82848 0.159654 41424 1367 0.21388
19-14273642-C-T p.Arg329His missense LPHN1 3 83000 3.61446E-5 41500 0 6.37552E-5
19-14273649-C-T p.Val327Ile missense LPHN1 46 82974 5.54391E-4 41487 0 7.16755E-4
19-14273650-G-A p.Tyr326Tyr synonymous LPHN1 3 82962 3.61611E-5 41481 0 3.18756E-5
19-14273667-C-T p.Val321Met missense LPHN1 1 82920 1.20598E-5 41460 0 3.98378E-6
19-14273676-C-T p.Ala318Thr missense LPHN1 7 82856 8.44839E-5 41428 0 1.4169E-4
19-14273685-C-T p.Ala315Thr missense LPHN1 1 82872 1.20668E-5 41436 0 3.18817E-5
19-14273685-C-G p.Ala315Pro missense LPHN1 1 82872 1.20668E-5 41436 0 NA
19-14273686-C-T p.Ser314Ser synonymous LPHN1 22 82868 2.65482E-4 41434 0 0.00100705
19-14273690-C-T p.Arg313His missense LPHN1 1 82822 1.20741E-5 41411 0 NA
19-14273692-C-T p.Lys312Lys synonymous LPHN1 1 82840 1.20715E-5 41420 0 3.18634E-5
19-14273698-G-A p.Tyr310Tyr synonymous LPHN1 35 82828 4.22562E-4 41414 0 2.11739E-4
19-14273703-C-G p.Gly309Arg missense LPHN1 1 82832 1.20726E-5 41416 0 8.38111E-6
19-14273704-C-T p.Thr308Thr synonymous LPHN1 1 82846 1.20706E-5 41423 0 1.27445E-4
19-14273705-G-A p.Thr308Met missense LPHN1 1 82856 1.20691E-5 41428 0 3.99722E-6
19-14273713-C-T p.Thr305Thr synonymous LPHN1 4 82866 4.82707E-5 41433 0 1.6792E-5
19-14273714-G-A p.Thr305Met missense LPHN1 7 82852 8.4488E-5 41426 0 2.79987E-5
19-14273719-C-T p.Glu303Glu synonymous LPHN1 2 82878 2.41319E-5 41439 0 NA
19-14273743-C-T p.Leu295Leu synonymous LPHN1 1 82900 1.20627E-5 41450 0 4.40472E-5
19-14273745-G-A p.Leu295Leu synonymous LPHN1 1 82882 1.20653E-5 41441 0 NA
19-14273763-G-A p.Arg289Trp missense LPHN1 2 82884 2.41301E-5 41442 0 3.99978E-6
19-14273767-G-A p.Asn287Asn synonymous LPHN1 1 82902 1.20624E-5 41451 0 5.59248E-5
19-14273780-G-C p.Thr283Ser missense LPHN1 33 82904 3.98051E-4 41452 0 3.18492E-4
19-14273785-G-A p.Tyr281Tyr synonymous LPHN1 2 82920 2.41196E-5 41460 0 1.27389E-4
19-14273788-G-A p.Ile280Ile synonymous LPHN1 6 82922 7.23572E-5 41461 0 1.59195E-4
19-14273803-G-A p.Asn275Asn synonymous LPHN1 6 82910 7.23676E-5 41455 0 4.17355E-5
19-14273808-C-T p.Glu274Lys missense LPHN1 1 82894 1.20636E-5 41447 0 7.96857E-6
19-14273812-C-T p.Val272Val synonymous LPHN1 1 82934 1.20578E-5 41467 0 NA
19-14273815-C-T p.Ala271Ala synonymous LPHN1 2 82918 2.41202E-5 41459 0 1.1949E-5
19-14273820-G-A p.Leu270Leu synonymous LPHN1 1 82962 1.20537E-5 41481 0 1.66306E-5
19-14273830-G-A p.Thr266Thr synonymous LPHN1 1 82992 1.20494E-5 41496 0 NA
19-14273839-G-A p.Gly263Gly synonymous LPHN1 3 82970 3.61576E-5 41485 0 3.1841E-5
19-14273847-G-A p.Arg261Cys missense LPHN1 3 82982 3.61524E-5 41491 0 6.3678E-5
19-14273854-C-T p.Ser258Ser synonymous LPHN1 3 82966 3.61594E-5 41483 0 3.31329E-5
19-14273858-G-A p.Thr257Ile missense LPHN1 1 83004 1.20476E-5 41502 0 NA
19-14273860-G-C p.Asp256Glu missense LPHN1 1 83008 1.2047E-5 41504 0 1.65505E-5
19-14273872-G-GATGCCTGGAAGTGAGTC p.Asn253fs frameshift LPHN1 2 83004 2.40952E-5 41502 1 NA
19-14273874-C-T p.Ala252Thr missense LPHN1 1 82978 1.20514E-5 41489 0 7.96185E-6
19-14273875-G-C p.Thr251Thr synonymous LPHN1 1 82986 1.20502E-5 41493 0 3.18431E-5
19-14273875-G-A p.Thr251Thr synonymous LPHN1 1 82986 1.20502E-5 41493 0 1.99013E-5
19-14273876-G-A p.Thr251Ile missense LPHN1 1 82982 1.20508E-5 41491 0 3.98007E-6
19-14273887-C-T p.Thr247Thr synonymous LPHN1 23 82950 2.77275E-4 41475 0 2.54712E-4
19-14273888-G-A p.Thr247Met missense LPHN1 5 82946 6.02802E-5 41473 0 6.36862E-5
19-14273896-G-A p.Ser244Ser synonymous LPHN1 2 82914 2.41214E-5 41457 0 4.13032E-5
19-14273908-C-T p.Thr240Thr synonymous LPHN1 2 82924 2.41185E-5 41462 0 1.9897E-4
19-14273917-G-A p.Asp237Asp synonymous LPHN1 1 82948 1.20557E-5 41474 0 8.25723E-6
19-14273928-C-T p.Val234Ile missense LPHN1 2 82930 2.41167E-5 41465 0 3.58189E-5
19-14273936-C-T p.Arg231His missense LPHN1 2 82852 2.41394E-5 41426 0 3.98019E-6
19-14273937-G-A p.Arg231Cys missense LPHN1 2 82846 2.41412E-5 41423 0 2.47741E-5
19-14273938-C-T p.Thr230Thr synonymous LPHN1 10 82828 1.20732E-4 41414 0 0.00151057
19-14273961-C-T p.Val223Ile missense LPHN1 1 82800 1.20773E-5 41400 0 8.25982E-6
19-14273962-G-A p.Ala222Ala synonymous LPHN1 1 82794 1.20782E-5 41397 0 1.19432E-5
19-14273966-C-T p.Gly221Asp missense LPHN1 1 82822 1.20741E-5 41411 0 NA
19-14273971-G-A p.Tyr219Tyr synonymous LPHN1 1 82824 1.20738E-5 41412 0 4.77722E-5
19-14273997-C-T p.Val211Met missense LPHN1 1 82892 1.20639E-5 41446 0 9.55536E-5
19-14273999-C-T p.Arg210His missense LPHN1 1 82856 1.20691E-5 41428 0 6.37024E-5
19-14274000-G-A p.Arg210Cys missense LPHN1 2 82888 2.41289E-5 41444 0 3.30677E-5
19-14274028-G-A p.Arg200Arg synonymous LPHN1 1 82620 1.21036E-5 41310 0 NA
19-14274030-G-A p.Arg200Cys missense LPHN1 1 82564 1.21118E-5 41282 0 NA
19-14274031-G-T p.Ala199Ala synonymous LPHN1 2 82528 2.42342E-5 41264 0 NA
19-14274032-G-A p.Ala199Val missense LPHN1 1 82126 1.21764E-5 41063 0 3.99767E-6
19-14274039-C-T p.Val197Met missense LPHN1 3 81984 3.65925E-5 40992 0 8.30758E-6
19-14274040-G-A p.Tyr196Tyr synonymous LPHN1 5 81988 6.09845E-5 40994 0 1.91065E-4
19-14274052-C-A p.Ser192Ser synonymous LPHN1 1 82134 1.21752E-5 41067 0 NA
19-14274076-C-T p.Thr184Thr synonymous LPHN1 6 82206 7.29874E-5 41103 0 5.00885E-5
19-14274079-G-A p.Arg183Arg synonymous LPHN1 1 82198 1.21657E-5 41099 0 NA
19-14274080-C-T p.Arg183His missense LPHN1 1 82156 1.2172E-5 41078 0 2.39567E-5
19-14274081-G-A p.Arg183Cys missense LPHN1 1 82248 1.21584E-5 41124 0 3.18613E-5
19-14274102-C-A p.Val176Leu missense LPHN1 1 82084 1.21826E-5 41042 0 NA
19-14274103-G-A p.Tyr175Tyr synonymous LPHN1 1 82094 1.21812E-5 41047 0 3.18735E-5
19-14274106-G-A p.Ile174Ile synonymous LPHN1 1 82100 1.21803E-5 41050 0 4.00654E-6
19-14274108-T-C p.Ile174Val missense LPHN1 1 82024 1.21916E-5 41012 0 NA
19-14274111-G-C p.Arg173Gly missense LPHN1 1 81936 1.22046E-5 40968 0 8.78225E-6
19-14274118-C-T p.Ala170Ala synonymous LPHN1 1 82156 1.2172E-5 41078 0 9.09753E-6
19-14274119-G-A p.Ala170Val missense LPHN1 2 82134 2.43505E-5 41067 0 1.82688E-5
19-14274127-C-T p.Pro167Pro synonymous LPHN1 3 82090 3.65453E-5 41045 0 4.84066E-5
19-14274150-A-G p.Ser160Pro missense LPHN1 1 81470 1.22745E-5 40735 0 NA
19-14274156-G-A p.His158Tyr missense LPHN1 1 81228 1.2311E-5 40614 0 NA
19-14274163-C-T p.Glu155Glu synonymous LPHN1 2 80916 2.4717E-5 40458 0 5.10009E-4
19-14274165-C-T p.Glu155Lys missense LPHN1 3 80750 3.71517E-5 40375 0 1.47384E-5
19-14274166-G-A p.His154His synonymous LPHN1 4 80776 4.95197E-5 40388 0 9.56145E-5
19-14274178-G-A p.Pro150Pro synonymous LPHN1 2 80168 2.49476E-5 40084 0 NA
19-14274195-G-C p.Gln145Glu missense LPHN1 1 79446 1.25872E-5 39723 0 3.19366E-5
19-14274198-G-A p.Leu144Leu synonymous LPHN1 1 79242 1.26196E-5 39621 0 NA
19-14274214-G-A p.Phe138Phe synonymous LPHN1 3 77844 3.85386E-5 38922 0 1.48931E-4
19-14274221-G-GCGACCATCCCC c.410-4_410-3insGGGGATGGTCG splice_region LPHN1 1 77344 1.29293E-5 38672 0 NA
19-14274224-C-T c.410-6G>A splice_region LPHN1 1 76966 1.29928E-5 38483 0 NA
19-14277820-G-A c.409+8C>T splice_region LPHN1 2 83292 2.40119E-5 41646 0 8.24008E-6
19-14277821-C-T c.409+7G>A splice_region LPHN1 2 83284 2.40142E-5 41642 0 3.21626E-5
19-14277822-G-A c.409+6C>T splice_region LPHN1 1 83292 1.2006E-5 41646 0 NA
19-14277837-C-T p.Glu134Lys missense LPHN1 1 83302 1.20045E-5 41651 0 NA
19-14277844-T-C c.395-2A>G splice_acceptor LPHN1 1 83280 1.20077E-5 41640 0 NA
19-14281302-G-A n.422C>T splice_region LPHN1 1 20418 4.89764E-5 10209 0 6.37959E-5
19-14281519-C-T p.Glu123Glu synonymous LPHN1 1 81940 1.22041E-5 40970 0 NA
19-14281524-G-A p.Leu122Leu synonymous LPHN1 1 81978 1.21984E-5 40989 0 NA
19-14281537-C-T p.Gly117Gly synonymous LPHN1 2 81964 2.4401E-5 40982 0 9.56755E-5
19-14281546-G-A p.Pro114Pro synonymous LPHN1 10 81854 1.22169E-4 40927 0 5.03525E-4
19-14281548-G-A p.Pro114Ser missense LPHN1 1 81794 1.22258E-5 40897 0 NA
19-14281558-G-A p.Ala110Ala synonymous LPHN1 2 81584 2.45146E-5 40792 0 5.3951E-5
19-14281564-C-T p.Ser108Ser synonymous LPHN1 727 81196 0.00895364 40598 6 0.023125
19-14281565-G-A p.Ser108Leu missense LPHN1 1 81262 1.23059E-5 40631 0 1.81805E-5
19-14281567-G-A p.Gly107Gly synonymous LPHN1 3 81138 3.6974E-5 40569 0 3.19489E-5
19-14281569-C-T p.Gly107Ser missense LPHN1 2 80914 2.47176E-5 40457 0 1.82532E-5
19-14281571-G-T p.Ala106Asp missense LPHN1 1 80800 1.23762E-5 40400 0 NA
19-14281573-G-A p.Val105Val synonymous LPHN1 3 80670 3.71885E-5 40335 0 NA
19-14281582-G-A p.Cys102Cys synonymous LPHN1 161 80204 0.00200738 40102 1 0.00505051
19-14281592-C-T p.Arg99His missense LPHN1 2 79476 2.51648E-5 39738 0 9.89374E-6
19-14288363-G-A p.Ala88Ala synonymous LPHN1 1 83032 1.20435E-5 41516 0 NA
19-14288365-C-T p.Ala88Thr missense LPHN1 5 83026 6.02221E-5 41513 0 6.76267E-5
19-14288366-G-A p.Asp87Asp synonymous LPHN1 3 83062 3.61176E-5 41531 0 8.25587E-6
19-14288369-C-T p.Pro86Pro synonymous LPHN1 692 83078 0.00832952 41539 3 0.0128744
19-14288370-G-A p.Pro86Leu missense LPHN1 4 83104 4.81325E-5 41552 0 6.37105E-5
19-14288411-A-G p.Asp72Asp synonymous LPHN1 1 83176 1.20227E-5 41588 0 NA
19-14288414-G-A p.Cys71Cys synonymous LPHN1 1 83170 1.20236E-5 41585 0 2.38637E-5
19-14288423-G-A p.Asp68Asp synonymous LPHN1 1 83174 1.2023E-5 41587 0 NA
19-14288426-G-A p.Asp67Asp synonymous LPHN1 18 83148 2.16481E-4 41574 0 6.25E-4
19-14288429-C-T p.Thr66Thr synonymous LPHN1 15 83116 1.80471E-4 41558 0 5.77997E-5
19-14288433-C-T p.Arg65His missense LPHN1 1 83128 1.20296E-5 41564 0 NA
19-14288438-G-A p.Tyr63Tyr synonymous LPHN1 1 83122 1.20305E-5 41561 0 3.30316E-5
19-14288458-T-C p.Met57Val missense LPHN1 1 83006 1.20473E-5 41503 0 8.27198E-6
19-14288461-T-C p.Ile56Val missense LPHN1 48 82988 5.78397E-4 41494 0 0.00207086
19-14288464-C-T p.Val55Ile missense LPHN1 2 82930 2.41167E-5 41465 0 3.18593E-5
19-14288465-G-A p.Asp54Asp synonymous LPHN1 2 82920 2.41196E-5 41460 0 9.10521E-5
19-14288468-G-A p.Ser53Ser synonymous LPHN1 4 82850 4.828E-5 41425 0 1.6561E-5
19-14288474-G-A p.Pro51Pro synonymous LPHN1 7 82772 8.45697E-5 41386 0 1.59357E-4
19-14288476-G-C p.Pro51Ala missense LPHN1 1 82758 1.20834E-5 41379 0 NA
19-14288478-C-G p.Cys50Ser missense LPHN1 1 82704 1.20913E-5 41352 0 NA
19-14288489-G-A p.Ile46Ile synonymous LPHN1 2 82382 2.42771E-5 41191 0 1.27405E-4
19-14288501-T-C p.Glu42Glu synonymous LPHN1 1 81862 1.22157E-5 40931 0 NA
19-14288507-C-T p.Ala40Ala synonymous LPHN1 1 81416 1.22826E-5 40708 0 0.001875
19-14288520-C-T p.Arg36His missense LPHN1 1 79838 1.25254E-5 39919 0 1.68364E-5
19-14288531-G-A p.Phe32Phe synonymous LPHN1 4 78220 5.11378E-5 39110 0 1.70285E-5
19-14288534-C-T p.Pro31Pro synonymous LPHN1 1 77454 1.29109E-5 38727 0 1.71818E-5
19-14288535-G-A p.Pro31Leu missense LPHN1 1 77344 1.29293E-5 38672 0 1.21606E-5
19-14288537-G-A p.Leu30Leu synonymous LPHN1 6 76948 7.79747E-5 38474 0 8.59757E-6
19-14288540-C-G p.Gly29Gly synonymous LPHN1 2 76128 2.62715E-5 38064 0 NA
19-14288543-G-A p.Ala28Ala synonymous LPHN1 21 75018 2.79933E-4 37509 0 7.00771E-4
19-14288556-C-A p.Gly24Val missense+splice_region LPHN1 2 71240 2.80741E-5 35620 0 NA
19-14288557-C-CT c.71-2_71-1insA splice_acceptor LPHN1 3 71156 4.21609E-5 35578 0 NA
19-14288562-G-C c.71-6C>G splice_region LPHN1 1 69398 1.44096E-5 34699 0 NA
19-14288563-G-C c.71-7C>G splice_region LPHN1 4 69046 5.79324E-5 34523 0 0.00125945
19-14294355-C-T p.Ser20Ser synonymous LPHN1 6 81146 7.39408E-5 40573 0 3.21802E-4
19-14294360-T-C p.Thr19Ala missense LPHN1 1 81118 1.23277E-5 40559 0 NA
19-14294369-C-T p.Val16Ile missense LPHN1 1 81224 1.23116E-5 40612 0 0.00101317
19-14294370-G-A p.Ala15Ala synonymous LPHN1 1 81226 1.23113E-5 40613 0 9.99241E-6
19-14294373-G-A p.Thr14Thr synonymous LPHN1 198 81224 0.0024377 40612 1 0.00494229
19-14294386-T-G p.Asn10Thr missense LPHN1 1 81292 1.23013E-5 40646 0 NA
19-14294393-G-A p.Leu8Phe missense LPHN1 1 81326 1.22962E-5 40663 0 4.98211E-6
19-14294399-C-T p.Ala6Thr missense LPHN1 2 81302 2.45996E-5 40651 0 0.00305188
19-14294400-G-A p.Ala5Ala synonymous LPHN1 5 81310 6.14931E-5 40655 0 4.96947E-4
19-14294407-C-T p.Arg3His missense LPHN1 1 81278 1.23035E-5 40639 0 6.37714E-5
19-14294408-G-A p.Arg3Cys missense LPHN1 8 81298 9.84034E-5 40649 0 1.59429E-4
19-14294431-G-A c.-17C>T 5_prime_UTR_premature_start_codon_gain LPHN1 3 81192 3.69495E-5 40596 0 3.19101E-5
19-14294437-G-A c.-23C>T 5_prime_UTR_premature_start_codon_gain LPHN1 5 81142 6.16204E-5 40571 0 9.00009E-5
19-14294458-G-A c.-44C>T 5_prime_UTR_premature_start_codon_gain LPHN1 12 80672 1.4875E-4 40336 0 6.25E-4
19-14294474-C-T c.-60G>A 5_prime_UTR_premature_start_codon_gain LPHN1 1 79818 1.25285E-5 39909 0 3.19142E-5
19-14294493-C-T c.-79G>A 5_prime_UTR_premature_start_codon_gain LPHN1 1 78080 1.28074E-5 39040 0 6.38121E-5
19-14294494-G-A c.-80C>T 5_prime_UTR_premature_start_codon_gain LPHN1 1 77900 1.2837E-5 38950 0 0.00125313
19-14294505-C-T c.-91G>A 5_prime_UTR_premature_start_codon_gain LPHN1 3 76542 3.91942E-5 38271 0 3.1904E-5
19-14294512-G-GTCCAGCGCCTCTCT c.-95-4_-95-3insAGAGAGGCGCTGGA splice_region LPHN1 2 75870 2.63609E-5 37935 0 NA