Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
3-100328510-A-G c.-191A>G 5_prime_UTR_premature_start_codon_gain GPR128 1 59142 1.69085E-5 29571 0 NA
3-100328518-C-G c.-183C>G 5_prime_UTR_premature_start_codon_gain GPR128 9 61060 1.47396E-4 30530 0 3.1839E-5
3-100328623-C-T c.-78C>T 5_prime_UTR_premature_start_codon_gain GPR128 918 82044 0.0111891 41022 5 0.0108675
3-100328641-C-G c.-60C>G 5_prime_UTR_premature_start_codon_gain GPR128 2 82914 2.41214E-5 41457 0 6.37471E-5
3-100328658-A-G c.-43A>G 5_prime_UTR_premature_start_codon_gain GPR128 8 83244 9.6103E-5 41622 0 9.55718E-5
3-100328677-G-C c.-24G>C 5_prime_UTR_premature_start_codon_gain GPR128 1 83362 1.19959E-5 41681 0 NA
3-100328690-T-A c.-11T>A 5_prime_UTR_premature_start_codon_gain GPR128 2 83398 2.39814E-5 41699 0 NA
3-100328702-T-C p.Met1? start_lost GPR128 1 83396 1.1991E-5 41698 0 NA
3-100328706-T-C p.Ala2Ala synonymous GPR128 8 83398 9.59256E-5 41699 0 3.50229E-4
3-100328713-C-T p.Arg5Cys missense GPR128 3 83404 3.59695E-5 41702 0 1.59195E-4
3-100328714-G-A p.Arg5His missense GPR128 3 83408 3.59678E-5 41704 0 2.38753E-5
3-100328717-C-G p.Ala6Gly missense GPR128 1 83408 1.19893E-5 41704 0 NA
3-100328725-C-A p.Leu9Ile missense GPR128 1 83410 1.1989E-5 41705 0 5.76787E-5
3-100328725-C-T p.Leu9Phe missense GPR128 1 83410 1.1989E-5 41705 0 NA
3-100328733-G-C p.Val11Val synonymous GPR128 424 83412 0.0050832 41706 13 0.011271
3-100328737-G-T p.Val13Leu missense GPR128 1 83408 1.19893E-5 41704 0 NA
3-100328738-T-C p.Val13Ala missense GPR128 1 83406 1.19895E-5 41703 0 NA
3-100328745-C-T p.Val15Val synonymous GPR128 1 83408 1.19893E-5 41704 0 3.18129E-5
3-100328746-G-A p.Val16Met missense GPR128 5 83408 5.99463E-5 41704 0 3.18431E-5
3-100328750-G-A p.Cys17Tyr missense GPR128 1 83414 1.19884E-5 41707 0 8.23723E-6
3-100328757-A-G p.Leu19Leu synonymous GPR128 1 83408 1.19893E-5 41704 0 3.18471E-5
3-100328764-G-T p.Gly22Cys missense GPR128 62 83412 7.43298E-4 41706 0 5.03525E-4
3-100328767-A-T p.Ile23Phe missense GPR128 1 83414 1.19884E-5 41707 0 6.25E-4
3-100328790-G-A p.Trp30* stop_gained GPR128 3 83406 3.59686E-5 41703 0 3.18471E-5
3-100328793-G-A p.Arg31Arg synonymous GPR128 1 83400 1.19904E-5 41700 0 4.94283E-5
3-100328793-G-C p.Arg31Ser missense GPR128 1 83400 1.19904E-5 41700 0 NA
3-100348439-T-C c.116-3T>C splice_region GPR128 6 83122 7.21831E-5 41561 0 9.19594E-5
3-100348443-A-G p.Gly39Gly splice_region+synonymous GPR128 2 83144 2.40547E-5 41572 0 7.98104E-6
3-100348444-A-G p.Lys40Glu missense+splice_region GPR128 2 83158 2.40506E-5 41579 0 NA
3-100348448-C-G p.Ser41Cys missense GPR128 1 83174 1.2023E-5 41587 0 NA
3-100348450-A-G p.Thr42Ala missense GPR128 1 83182 1.20218E-5 41591 0 3.18512E-5
3-100348455-C-T p.Ser43Ser synonymous GPR128 1 83208 1.20181E-5 41604 0 8.28185E-6
3-100348463-G-C p.Ser46Thr missense GPR128 1 83230 1.20149E-5 41615 0 3.18674E-5
3-100348469-C-T p.Pro48Leu missense GPR128 1 83240 1.20135E-5 41620 0 1.65183E-5
3-100348471-A-G p.Thr49Ala missense GPR128 6 83242 7.2079E-5 41621 0 6.37105E-5
3-100348491-T-G p.Gly55Gly synonymous GPR128 2 83248 2.40246E-5 41624 0 8.2526E-6
3-100348496-C-A p.Thr57Asn missense GPR128 3 83250 3.6036E-5 41625 0 3.18512E-5
3-100348496-C-T p.Thr57Ile missense GPR128 1 83250 1.2012E-5 41625 0 1.19454E-5
3-100348502-A-G p.Glu59Gly missense GPR128 1 83266 1.20097E-5 41633 0 NA
3-100348511-G-A p.Arg62Lys missense GPR128 1 83278 1.2008E-5 41639 0 8.25396E-6
3-100348513-T-A p.Cys63Ser missense GPR128 1 83282 1.20074E-5 41641 0 NA
3-100348516-A-G p.Ile64Val missense GPR128 1 83278 1.2008E-5 41639 0 1.59215E-4
3-100348530-G-A p.Glu68Glu synonymous GPR128 1 83272 1.20088E-5 41636 0 3.1835E-5
3-100348536-AG-A p.Gly71fs frameshift GPR128 1 83274 1.20085E-5 41637 0 1.19446E-5
3-100348537-G-A p.Gly71Arg missense GPR128 4 83272 4.80354E-5 41636 0 3.18492E-5
3-100348538-G-T p.Gly71Val missense GPR128 1 83266 1.20097E-5 41633 0 7.96483E-6
3-100348545-A-G p.Arg73Arg synonymous GPR128 1 83256 1.20111E-5 41628 0 8.2791E-6
3-100348545-A-AAATATTCTT p.Arg73_Cys74insAsnIleLeu conservative_inframe_insertion GPR128 1 83252 1.20117E-5 41626 0 NA
3-100348551-A-T p.Thr75Thr synonymous GPR128 1 83238 1.20137E-5 41619 0 8.29421E-6
3-100349543-T-C c.230-6T>C splice_region GPR128 1 75574 1.32321E-5 37787 0 NA
3-100349548-G-A c.230-1G>A splice_acceptor GPR128 1 75772 1.31975E-5 37886 0 1.02636E-5
3-100349565-T-C p.Asn82Asn synonymous GPR128 4 76946 5.19845E-5 38473 0 6.37511E-5
3-100349567-G-T p.Ser83Ile missense GPR128 1 77042 1.29799E-5 38521 0 NA
3-100349571-C-T p.Thr84Thr synonymous GPR128 1 77880 1.28403E-5 38940 0 NA
3-100349594-G-T p.Arg92Ile missense GPR128 1 78730 1.27016E-5 39365 0 NA
3-100349598-C-T p.Ile93Ile synonymous GPR128 3 78982 3.79833E-5 39491 0 5.51864E-6
3-100349602-G-C p.Val95Leu missense GPR128 1 79042 1.26515E-5 39521 0 NA
3-100349610-A-G p.Arg97Arg synonymous GPR128 10 79554 1.25701E-4 39777 0 6.25E-4
3-100349619-A-G p.Pro100Pro synonymous GPR128 1 79166 1.26317E-5 39583 0 4.51024E-5
3-100349626-C-A p.Gln103Lys missense GPR128 3 78928 3.80093E-5 39464 0 NA
3-100349634-T-G p.Cys105Trp missense GPR128 2 79224 2.52449E-5 39612 0 8.42943E-6
3-100349636-G-T p.Gly106Val missense GPR128 5 79290 6.30597E-5 39645 0 8.94114E-5
3-100349637-C-T p.Gly106Gly synonymous GPR128 1 79342 1.26037E-5 39671 0 2.53263E-5
3-100349641-GA-AT p.Asp108Ile missense GPR128 1 79334 1.26049E-5 39667 0 NA
3-100352104-T-C c.335-5T>C splice_region GPR128 1 76690 1.30395E-5 38345 0 9.01811E-6
3-100352109-C-T p.Ala112Val missense+splice_region GPR128 28 76770 3.64726E-4 38385 0 6.27272E-4
3-100352110-G-A p.Ala112Ala splice_region+synonymous GPR128 16 77120 2.07469E-4 38560 1 6.08043E-4
3-100352111-G-A p.Gly113Ser missense+splice_region GPR128 1 77258 1.29436E-5 38629 0 NA
3-100352130-G-A p.Arg119Gln missense GPR128 3 78928 3.80093E-5 39464 0 9.57426E-5
3-100352130-G-T p.Arg119Leu missense GPR128 1 78928 1.26698E-5 39464 0 3.19142E-5
3-100352131-G-T p.Arg119Arg synonymous GPR128 1 79158 1.2633E-5 39579 0 NA
3-100352141-C-A p.Leu123Ile missense GPR128 1 79998 1.25003E-5 39999 0 NA
3-100352151-A-G p.Tyr126Cys missense GPR128 63 81658 7.7151E-4 40829 0 0.0015614
3-100352160-T-G p.Ile129Arg missense GPR128 1 81820 1.2222E-5 40910 0 3.18878E-5
3-100352173-AG-A p.Val134fs frameshift GPR128 1 81822 1.22217E-5 40911 0 NA
3-100352193-A-G p.Asn140Ser missense GPR128 1 81532 1.22651E-5 40766 0 2.97609E-5
3-100352217-A-G p.Lys148Arg missense GPR128 1 80962 1.23515E-5 40481 0 4.373E-6
3-100352223-T-C c.447+2T>C splice_donor GPR128 6 80814 7.42446E-5 40407 0 9.55475E-5
3-100352229-A-G c.447+8A>G splice_region GPR128 1 80684 1.2394E-5 40342 0 3.18451E-5
3-100354450-C-A c.-261C>A 5_prime_UTR_premature_start_codon_gain GPR128 1 81980 1.21981E-5 40990 0 NA
3-100354454-A-T c.-257A>T 5_prime_UTR_premature_start_codon_gain GPR128 2 82088 2.43641E-5 41044 0 6.3678E-5
3-100354517-A-G c.448-4A>G splice_region GPR128 1 83072 1.20378E-5 41536 0 8.26897E-6
3-100354521-G-A p.Val150Ile missense+splice_region GPR128 1 83106 1.20328E-5 41553 0 NA
3-100354524-A-G p.Lys151Glu missense GPR128 24698 82652 0.298819 41326 3980 0.273414
3-100354533-A-T p.Thr154Ser missense GPR128 1 83154 1.20259E-5 41577 0 3.18532E-5
3-100354564-T-A p.Val164Asp missense GPR128 1 83118 1.20311E-5 41559 0 3.98111E-6
3-100354567-A-G p.Gln165Arg missense GPR128 1 83110 1.20322E-5 41555 0 NA
3-100354568-G-C p.Gln165His missense GPR128 1 83108 1.20325E-5 41554 0 8.24511E-6
3-100354585-C-T p.Ala171Val missense GPR128 1 83092 1.20349E-5 41546 0 NA
3-100354592-A-G p.Lys173Lys synonymous GPR128 1 83100 1.20337E-5 41550 0 3.9808E-6
3-100354596-A-G p.Thr175Ala missense GPR128 3 83092 3.61046E-5 41546 0 3.29908E-5
3-100354602-G-A p.Glu177Lys missense GPR128 1 83090 1.20351E-5 41545 0 NA
3-100354608-A-G p.Ile179Val missense GPR128 3 83088 3.61063E-5 41544 0 NA
3-100354609-TC-T p.Thr180fs frameshift GPR128 2 83088 2.40709E-5 41544 0 NA
3-100354612-C-T p.Thr180Ile missense GPR128 1 83088 1.20354E-5 41544 0 3.98134E-6
3-100354621-C-T p.Thr183Met missense GPR128 16 83036 1.92688E-4 41518 0 0.00100705
3-100354622-G-A p.Thr183Thr synonymous GPR128 1 83016 1.20459E-5 41508 0 0.00125
3-100354626-G-A p.Val185Met missense GPR128 1 83004 1.20476E-5 41502 0 5.77605E-5
3-100354656-A-G p.Asn195Asp missense GPR128 1 82780 1.20802E-5 41390 0 2.80836E-5
3-100354663-C-T p.Ser197Leu missense GPR128 1 82708 1.20907E-5 41354 0 NA
3-100354675-A-T c.597+5A>T splice_region GPR128 1 82572 1.21106E-5 41286 0 NA
3-100356148-A-C p.Ala200Ala splice_region+synonymous GPR128 1 82570 1.21109E-5 41285 0 3.98676E-6
3-100356161-A-T p.Ile205Leu missense GPR128 1 82674 1.20957E-5 41337 0 NA
3-100356168-C-G p.Thr207Arg missense GPR128 1 82738 1.20863E-5 41369 0 3.29902E-5
3-100356168-C-A p.Thr207Lys missense GPR128 1 82738 1.20863E-5 41369 0 3.98378E-6
3-100356217-T-G p.Leu11Arg missense GPR128 1 82810 1.20758E-5 41405 0 3.98302E-6
3-100356219-C-T p.Ala224Val missense GPR128 1 82818 1.20747E-5 41409 0 NA
3-100356223-T-A p.Leu13Gln missense GPR128 1 82796 1.20779E-5 41398 0 3.98327E-6
3-100356227-A-G p.Asn227Asp missense GPR128 2 82796 2.41558E-5 41398 0 NA
3-100356230-G-T p.Asp228Tyr missense GPR128 2 82784 2.41593E-5 41392 0 1.59236E-4
3-100356230-G-C p.Asp228His missense GPR128 2 82784 2.41593E-5 41392 0 8.24674E-6
3-100356232-T-C p.Met16Thr missense GPR128 1 82786 1.20793E-5 41393 0 NA
3-100356237-C-G p.Ala230Gly missense GPR128 2 82744 2.41709E-5 41372 0 NA
3-100356242-A-G p.Thr232Ala missense GPR128 2 82722 2.41774E-5 41361 0 7.97207E-6
3-100356245-A-G p.Thr233Ala missense+splice_region GPR128 1 82710 1.20904E-5 41355 0 3.98804E-6
3-100356246-C-T p.Thr233Met missense+splice_region GPR128 1 82688 1.20937E-5 41344 0 6.36943E-5
3-100356361-T-TCCTCTGGAATGTAGATAAGAGCTGTGACTTTCCACTTGACCTTTAGTTACTAGATG n.504_559dupCCTCTGGAATGTAGATAAGAGCTGTGACTTTCCACTTGACCTTTAGTTACTAGATG splice_region GPR128 8 72262 1.10708E-4 36131 0 3.50341E-4
3-100356417-G-GCCTCTGGAATGTAGATAAGAGCTGTGACTTTCCACTTGACCTTTA n.559_560insCCTCTGGAATGTAGATAAGAGCTGTGACTTTCCACTTGACCTTTA splice_region GPR128 1 56084 1.78304E-5 28042 0 NA
3-100362108-A-G c.699-2A>G splice_acceptor GPR128 1 82640 1.21007E-5 41320 0 4.17341E-5
3-100362111-C-T p.Leu234Phe missense+splice_region GPR128 1 82680 1.20948E-5 41340 0 NA
3-100362114-A-G p.Ile235Val missense GPR128 33 82736 3.98859E-4 41368 0 2.86551E-4
3-100362115-T-C p.Ile235Thr missense GPR128 6 82742 7.25146E-5 41371 0 1.2734E-4
3-100362120-C-A p.Gln237Lys missense GPR128 3 82760 3.62494E-5 41380 0 3.60461E-5
3-100362128-G-T p.Glu239Asp missense GPR128 1 82828 1.20732E-5 41414 0 5.03525E-4
3-100362140-G-C p.Leu243Phe missense GPR128 3 82962 3.61611E-5 41481 0 7.97054E-6
3-100362144-T-C p.Leu245Leu synonymous GPR128 2 82984 2.4101E-5 41492 0 3.18471E-5
3-100362161-G-A p.Val250Val synonymous GPR128 1 83070 1.2038E-5 41535 0 3.1837E-5
3-100362170-T-C p.Pro253Pro synonymous GPR128 3 83116 3.60941E-5 41558 0 5.7691E-5
3-100362174-A-G p.Ile255Val missense GPR128 1 83114 1.20317E-5 41557 0 3.1835E-5
3-100362177-G-A p.Ala256Thr missense GPR128 1 83114 1.20317E-5 41557 0 8.24076E-6
3-100362190-C-T p.Ala260Val missense GPR128 1 83130 1.20294E-5 41565 0 NA
3-100362196-T-C p.Phe262Ser missense GPR128 1 83142 1.20276E-5 41571 0 NA
3-100362199-C-T p.Ser263Phe missense GPR128 1 83128 1.20296E-5 41564 0 NA
3-100362212-G-A p.Ala267Ala synonymous GPR128 5 83120 6.0154E-5 41560 0 1.99011E-5
3-100362231-C-T p.Arg274Cys missense GPR128 5 83078 6.01844E-5 41539 0 3.18552E-5
3-100362232-G-A p.Arg274His missense GPR128 2 83074 2.40749E-5 41537 0 3.18512E-5
3-100362249-G-A p.Gly280Arg missense+splice_region GPR128 1 83030 1.20438E-5 41515 0 NA
3-100362252-G-A c.838+3G>A splice_region GPR128 1 83012 1.20465E-5 41506 0 NA
3-100362255-C-G c.838+6C>G splice_region GPR128 2 83002 2.40958E-5 41501 0 4.12984E-5
3-100362363-C-T c.839-7C>T splice_region GPR128 5 82890 6.03209E-5 41445 0 8.26392E-5
3-100362366-A-T c.839-4A>T splice_region GPR128 7 82892 8.44472E-5 41446 0 1.27348E-4
3-100362382-C-A p.Ser284Tyr missense GPR128 1 82880 1.20656E-5 41440 0 NA
3-100362400-C-T p.Thr290Ile missense GPR128 1 82850 1.207E-5 41425 0 NA
3-100362404-T-G p.Phe291Leu missense GPR128 1 82810 1.20758E-5 41405 0 NA
3-100362405-A-G p.Ile292Val missense GPR128 1 82812 1.20755E-5 41406 0 7.97105E-6
3-100362413-A-G p.Thr294Thr synonymous GPR128 1 82784 1.20796E-5 41392 0 NA
3-100362415-A-AT p.Val296fs frameshift GPR128 1 82786 1.20793E-5 41393 0 NA
3-100362417-G-T p.Val296Leu missense GPR128 1 82776 1.20808E-5 41388 0 6.25E-4
3-100362425-C-T p.Gly298Gly synonymous GPR128 3 82730 3.62625E-5 41365 0 3.29859E-5
3-100362426-C-G p.Leu299Val missense GPR128 1 82738 1.20863E-5 41369 0 NA
3-100362437-T-G p.Asp302Glu missense GPR128 2 82752 2.41686E-5 41376 0 1.64978E-5
3-100362438-G-A p.Ala303Thr missense GPR128 1 82734 1.20869E-5 41367 0 1.19591E-5
3-100362440-A-C p.Ala303Ala synonymous GPR128 1 82718 1.20893E-5 41359 0 NA
3-100362458-C-T p.Val309Val synonymous GPR128 2 82676 2.41908E-5 41338 0 3.18512E-5
3-100362472-C-T p.Thr314Met missense GPR128 16 82616 1.93667E-4 41308 0 6.25E-4
3-100362473-G-A p.Thr314Thr synonymous GPR128 2 82616 2.42084E-5 41308 0 3.18634E-5
3-100362482-G-C c.946+5G>C splice_region GPR128 1 82582 1.21092E-5 41291 0 4.06461E-6
3-100362483-T-C c.946+6T>C splice_region GPR128 1 82574 1.21103E-5 41287 0 NA
3-100364783-C-T c.947-6C>T splice_region GPR128 3 81974 3.6597E-5 40987 0 1.66196E-5
3-100364796-C-A p.Thr318Thr synonymous GPR128 1 82428 1.21318E-5 41214 0 3.18613E-5
3-100364798-A-T p.Lys319Met missense GPR128 1 82518 1.21186E-5 41259 0 3.31071E-5
3-100364805-C-T p.Cys321Cys synonymous GPR128 2 82646 2.41996E-5 41323 0 NA
3-100364806-G-A p.Gly322Ser missense GPR128 7 82676 8.46679E-5 41338 0 3.18532E-5
3-100364812-G-A p.Val324Ile missense GPR128 1 82798 1.20776E-5 41399 0 NA
3-100364814-A-G p.Val324Val synonymous GPR128 3 82820 3.62231E-5 41410 1 3.98292E-6
3-100364833-C-G p.Leu331Val missense GPR128 24 82984 2.89212E-4 41492 0 4.14382E-4
3-100364833-C-A p.Leu331Ile missense GPR128 1 82984 1.20505E-5 41492 0 NA
3-100364861-A-G p.Lys340Arg missense GPR128 1 83102 1.20334E-5 41551 0 NA
3-100364864-C-T p.Ser341Leu missense GPR128 3 83096 3.61028E-5 41548 0 5.03525E-4
3-100364865-G-A p.Ser341Ser synonymous GPR128 9 83106 1.08295E-4 41553 0 2.54907E-4
3-100364875-C-A p.Gln345Lys missense GPR128 1 83136 1.20285E-5 41568 0 2.38928E-5
3-100364876-A-G p.Gln345Arg missense GPR128 1 83134 1.20288E-5 41567 0 NA
3-100364883-T-C p.Ile347Ile synonymous GPR128 4 83148 4.8107E-5 41574 0 1.27366E-4
3-100364888-C-T p.Ser349Leu missense GPR128 1 83158 1.20253E-5 41579 0 NA
3-100364896-A-G p.Thr352Ala missense GPR128 29 83160 3.48725E-4 41580 0 6.68832E-4
3-100364914-G-A p.Asp358Asn missense GPR128 441 83134 0.00530469 41567 1 0.00491311
3-100364926-T-G p.Ser362Ala missense GPR128 3 83182 3.60655E-5 41591 0 NA
3-100364947-C-T p.Pro369Ser missense GPR128 1 83168 1.20239E-5 41584 0 6.59968E-5
3-100365407-T-G c.1111-6T>G splice_region GPR128 1 83220 1.20163E-5 41610 0 NA
3-100365417-A-C p.Asn372Thr missense GPR128 1 83290 1.20062E-5 41645 0 NA
3-100365420-A-G p.Gln373Arg missense GPR128 9 83294 1.08051E-4 41647 0 2.54777E-4
3-100365445-T-C p.Tyr381Tyr synonymous GPR128 2 83332 2.40004E-5 41666 0 8.24321E-6
3-100365454-C-G p.Val384Val synonymous GPR128 2 83358 2.39929E-5 41679 0 2.38654E-5
3-100365468-C-T p.Ser389Leu missense GPR128 1 83354 1.1997E-5 41677 0 7.95526E-6
3-100365470-G-A p.Ala390Thr missense GPR128 1 83346 1.19982E-5 41673 0 3.97753E-6
3-100365471-C-T p.Ala390Val missense GPR128 5 83344 5.99923E-5 41672 0 0.00375
3-100365472-G-A p.Ala390Ala synonymous GPR128 112 83340 0.00134389 41670 1 0.0025481
3-100365476-G-T p.Asp392Tyr missense GPR128 8 83338 9.59946E-5 41669 0 6.25E-4
3-100365476-G-C p.Asp392His missense GPR128 2 83338 2.39987E-5 41669 0 8.239E-6
3-100365482-G-C p.Asp394His missense GPR128 1 83340 1.1999E-5 41670 0 NA
3-100365487-A-C p.Thr395Thr synonymous GPR128 2 83332 2.40004E-5 41666 0 NA
3-100365490-T-C p.Tyr396Tyr synonymous GPR128 1 83330 1.20005E-5 41665 0 3.97744E-6
3-100365491-G-A p.Gly397Ser missense GPR128 132 83330 0.00158406 41665 2 0.0013386
3-100365493-C-T p.Gly397Gly synonymous GPR128 1 83336 1.19996E-5 41668 0 NA
3-100365505-C-T p.Asp401Asp synonymous GPR128 2 83304 2.40085E-5 41652 0 6.37064E-5
3-100365510-G-A p.Gly403Asp missense GPR128 6 83308 7.20219E-5 41654 0 1.91095E-4
3-100365526-GCGCTGC-G p.Arg411_Cys412del conservative_inframe_deletion GPR128 3 83252 3.60352E-5 41626 0 NA
3-100365527-C-T p.Arg409Cys missense GPR128 3 83258 3.60326E-5 41629 0 3.18291E-5
3-100365528-G-A p.Arg409His missense GPR128 56 83238 6.7277E-4 41619 1 8.92231E-4
3-100365528-G-C p.Arg409Pro missense GPR128 1 83164 1.20244E-5 41582 0 0.0124356
3-100365530-T-C p.Cys410Arg missense GPR128 1 83262 1.20103E-5 41631 0 NA
3-100365533-C-T p.Arg411Cys missense GPR128 33 83258 3.96358E-4 41629 0 6.37389E-4
3-100365541-C-T p.Asn413Asn synonymous GPR128 1 83230 1.20149E-5 41615 0 NA
3-100365550-T-G p.Thr416Thr synonymous GPR128 2 83182 2.40437E-5 41591 0 NA
3-100365552-A-C p.Asn417Thr missense GPR128 1 83176 1.20227E-5 41588 0 1.19444E-5
3-100365552-A-AT p.Ala419fs frameshift GPR128 2 83176 2.40454E-5 41588 0 7.96292E-6
3-100365560-G-T p.Val420Leu missense GPR128 2 83130 2.40587E-5 41565 0 1.99138E-5
3-100365568-G-A p.Met422Ile missense+splice_region GPR128 1 83064 1.20389E-5 41532 0 8.26952E-6
3-100365571-A-G c.1266+3A>G splice_region GPR128 1 83034 1.20433E-5 41517 0 NA
3-100365575-A-G c.1266+7A>G splice_region GPR128 2 82982 2.41016E-5 41491 0 3.18451E-5
3-100368546-A-G p.Lys425Arg missense GPR128 5711 82272 0.0694161 41136 298 0.0961784
3-100368559-A-G p.Gln429Gln synonymous GPR128 9 82818 1.08672E-4 41409 0 1.59276E-4
3-100368578-A-G p.Ile436Val missense GPR128 1 82928 1.20587E-5 41464 0 NA
3-100368588-A-G p.Asn439Ser missense GPR128 3 82938 3.61716E-5 41469 0 6.25E-4
3-100368592-T-C p.Val440Val synonymous GPR128 1 82950 1.20555E-5 41475 0 2.4741E-5
3-100368596-T-A p.Cys442Ser missense GPR128 4 82920 4.82393E-5 41460 0 4.94821E-5
3-100368599-G-A p.Ala443Thr missense GPR128 1 82946 1.2056E-5 41473 0 5.03525E-4
3-100368604-G-C p.Leu444Leu synonymous GPR128 3 82942 3.61699E-5 41471 0 1.64938E-5
3-100368615-G-C p.Gly448Ala missense GPR128 1 82890 1.20642E-5 41445 0 NA
3-100368622-T-C p.Ala450Ala synonymous GPR128 1 82856 1.20691E-5 41428 0 NA
3-100368623-C-G p.Leu451Val missense GPR128 1 82852 1.20697E-5 41426 0 1.20078E-5
3-100368625-C-T p.Leu451Leu synonymous GPR128 1 82858 1.20688E-5 41429 0 4.00372E-6
3-100368628-A-G p.Thr452Thr synonymous GPR128 2 82846 2.41412E-5 41423 0 8.2511E-6
3-100368641-AT-A p.Ile457fs frameshift GPR128 1 82708 1.20907E-5 41354 0 NA
3-100368657-A-G c.1379+6A>G splice_region GPR128 1 82462 1.21268E-5 41231 0 NA
3-100373679-G-A p.Arg460Arg splice_region+synonymous GPR128 29 79082 3.66708E-4 39541 0 5.98029E-4
3-100373700-A-C p.Val467Val synonymous GPR128 1 81046 1.23387E-5 40523 0 NA
3-100373704-T-G p.Trp469Gly missense GPR128 1 81296 1.23007E-5 40648 0 4.18711E-6
3-100373707-G-A p.Val470Ile missense GPR128 2 81474 2.45477E-5 40737 0 3.18654E-5
3-100373717-A-G p.Asn473Ser missense GPR128 1 81968 1.21999E-5 40984 0 NA
3-100373731-A-G p.Met478Val missense GPR128 1 82462 1.21268E-5 41231 0 6.37227E-5
3-100373756-T-C p.Val486Ala missense GPR128 1 82840 1.20715E-5 41420 0 8.28349E-6
3-100373765-T-C p.Ile489Thr missense GPR128 1 82932 1.20581E-5 41466 0 NA
3-100373778-T-A p.Asn493Lys missense GPR128 1 83012 1.20465E-5 41506 0 NA
3-100373794-A-C p.Ser499Arg missense GPR128 3 83158 3.60759E-5 41579 0 2.38709E-5
3-100373800-G-A p.Gly501Ser missense GPR128 2 83174 2.4046E-5 41587 0 8.24457E-6
3-100373806-A-G p.Ile503Val missense GPR128 2 83204 2.40373E-5 41602 0 NA
3-100373814-T-C p.Asn505Asn synonymous GPR128 1 83220 1.20163E-5 41610 0 3.97795E-6
3-100373840-C-G p.Pro514Arg missense GPR128 3 83096 3.61028E-5 41548 0 8.23737E-6
3-100373849-A-C p.Asp517Ala missense GPR128 1 83010 1.20467E-5 41505 0 NA
3-100373853-C-T p.Thr518Thr synonymous GPR128 4 82958 4.82172E-5 41479 0 3.97807E-6
3-100373865-G-A p.Pro522Pro synonymous GPR128 1 82772 1.20814E-5 41386 0 1.64742E-5
3-100373868-T-A p.Asn523Lys missense GPR128 1 82736 1.20866E-5 41368 0 1.19355E-5
3-100373872-A-G p.Met525Val missense GPR128 1 82686 1.20939E-5 41343 0 2.47113E-5
3-100373873-T-C p.Met525Thr missense GPR128 1 82680 1.20948E-5 41340 0 8.23737E-6
3-100373876-G-A p.Cys526Tyr missense GPR128 2 82646 2.41996E-5 41323 0 1.64745E-5
3-100373878-A-C p.Thr527Pro missense GPR128 1 82646 1.20998E-5 41323 0 NA
3-100373886-T-G p.Ile529Met missense GPR128 1 82652 1.20989E-5 41326 0 3.18471E-5
3-100373889-C-G p.Ala530Ala synonymous GPR128 1 82640 1.21007E-5 41320 0 8.23764E-6
3-100373905-T-A p.Phe536Ile missense GPR128 1 82594 1.21074E-5 41297 0 NA
3-100373917-A-G p.Thr540Ala missense GPR128 16 82618 1.93662E-4 41309 0 NA
3-100373921-T-A p.Phe541Tyr missense GPR128 1 82586 1.21086E-5 41293 0 NA
3-100373923-A-C p.Thr542Pro missense GPR128 11 82532 1.33282E-4 41266 0 9.5511E-5
3-100373927-G-GAAAATAA p.Trp543fs frameshift GPR128 1 82510 1.21197E-5 41255 0 NA
3-100373927-G-A p.Trp543* stop_gained GPR128 4 82510 4.8479E-5 41255 0 5.03525E-4
3-100373928-G-GTAAATT p.Trp543_Asn544insTerIle stop_gained GPR128 1 82494 1.21221E-5 41247 0 NA
3-100373931-C-A p.Asn544Lys missense GPR128 1 82462 1.21268E-5 41231 0 8.24266E-6
3-100373931-C-T p.Asn544Asn synonymous GPR128 2 82462 2.42536E-5 41231 0 1.64853E-5
3-100373932-G-A p.Ala545Thr missense GPR128 1 82406 1.2135E-5 41203 0 3.18451E-5
3-100373940-C-T p.Ser547Ser synonymous GPR128 1 82404 1.21353E-5 41202 0 1.6488E-5
3-100373941-G-A p.Ala548Thr missense GPR128 5 82394 6.0684E-5 41197 0 3.18431E-5
3-100373941-G-T p.Ala548Ser missense GPR128 5 82394 6.0684E-5 41197 0 7.99539E-6
3-100373969-G-C p.Arg557Thr missense GPR128 5 82244 6.07947E-5 41122 0 2.22873E-4
3-100373974-A-G p.Met559Val missense GPR128 1 82200 1.21655E-5 41100 0 NA
3-100373989-C-T p.Arg564Trp missense GPR128 1 81684 1.22423E-5 40842 0 3.18451E-5
3-100373990-G-A p.Arg564Gln missense GPR128 5 81546 6.13151E-5 40773 0 8.32653E-6
3-100374006-C-CTTCCCAGG p.Ile570fs frameshift GPR128 1 80814 1.23741E-5 40407 0 NA
3-100374015-A-T p.Leu572Phe missense GPR128 1 80042 1.24934E-5 40021 0 3.18674E-5
3-100374025-G-A p.Gly576Arg missense+splice_region GPR128 1 78990 1.26598E-5 39495 0 NA
3-100374029-A-G c.1726+4A>G splice_region GPR128 2 78600 2.54453E-5 39300 0 NA
3-100374740-T-C c.1727-3T>C splice_region GPR128 43045 80040 0.537794 40020 11982 0.638125
3-100374745-G-T p.Val577Phe missense+splice_region GPR128 1 82244 1.21589E-5 41122 0 4.12609E-5
3-100374763-G-T p.Ala583Ser missense GPR128 1 82534 1.21162E-5 41267 0 3.30071E-5
3-100374767-T-C p.Ile584Thr missense GPR128 2 82550 2.42277E-5 41275 0 9.55292E-5
3-100374769-A-G p.Thr585Ala missense GPR128 2 82582 2.42184E-5 41291 0 1.65038E-5
3-100374775-G-A p.Gly587Arg missense GPR128 1 82560 1.21124E-5 41280 0 NA
3-100374778-G-A p.Val588Ile missense GPR128 1 82536 1.21159E-5 41268 0 3.1841E-5
3-100374792-G-T p.Gln592His missense GPR128 4 82510 4.8479E-5 41255 0 1.19446E-5
3-100374795-T-C p.Asn593Asn synonymous GPR128 1 82480 1.21242E-5 41240 0 3.98184E-6
3-100374807-A-G p.Pro597Pro synonymous GPR128 2 82382 2.42771E-5 41191 0 NA
3-100374810-G-A p.Gln598Gln synonymous GPR128 454 82318 0.0055152 41159 6 0.00901446
3-100374814-G-T p.Glu600* stop_gained GPR128 2 82336 2.42907E-5 41168 0 2.78976E-5
3-100374826-C-T p.Arg604Trp missense GPR128 4 82034 4.87603E-5 41017 0 4.78858E-5
3-100378538-G-C p.Trp610Cys missense GPR128 1 83252 1.20117E-5 41626 0 3.18817E-5
3-100378541-G-T p.Leu611Leu synonymous GPR128 1 83260 1.20106E-5 41630 0 8.2496E-6
3-100378551-G-GA p.Pro616fs frameshift GPR128 52 83284 6.2437E-4 41642 0 4.86863E-4
3-100378556-C-T p.Pro616Pro synonymous GPR128 1 83298 1.20051E-5 41649 0 NA
3-100378558-A-G p.Asn617Ser missense GPR128 2 83312 2.40061E-5 41656 0 NA
3-100378559-T-C p.Asn617Asn synonymous GPR128 1 83312 1.20031E-5 41656 0 3.98004E-6
3-100378576-C-T p.Pro623Leu missense GPR128 2 83324 2.40027E-5 41662 0 3.18837E-5
3-100378577-G-A p.Pro623Pro synonymous GPR128 3 83322 3.60049E-5 41661 0 0.00100705
3-100378578-C-T p.Leu624Leu synonymous GPR128 1 83324 1.20013E-5 41662 0 NA
3-100378585-G-T p.Trp626Leu missense GPR128 7 83328 8.40054E-5 41664 0 3.18817E-5
3-100378585-G-A p.Trp626* stop_gained GPR128 2 83328 2.40015E-5 41664 0 6.37633E-5
3-100378596-G-A p.Val630Ile missense GPR128 2 83332 2.40004E-5 41666 0 7.95564E-6
3-100378596-G-C p.Val630Leu missense GPR128 2 83332 2.40004E-5 41666 0 NA
3-100378600-C-G p.Pro631Arg missense GPR128 2 83328 2.40015E-5 41664 0 NA
3-100378601-T-C p.Pro631Pro synonymous GPR128 3 83330 3.60014E-5 41665 0 2.78405E-5
3-100378601-T-G p.Pro631Pro synonymous GPR128 2 83330 2.4001E-5 41665 0 8.23791E-6
3-100378602-G-A p.Val632Ile missense GPR128 1 83332 1.20002E-5 41666 0 3.9776E-6
3-100378607-C-T p.Thr633Thr synonymous GPR128 3 83320 3.60058E-5 41660 0 7.95431E-6
3-100378607-C-A p.Thr633Thr synonymous GPR128 1 83320 1.20019E-5 41660 0 8.23778E-6
3-100378633-T-G p.Met642Arg missense GPR128 3 83292 3.60179E-5 41646 0 8.23845E-6
3-100378633-T-C p.Met642Thr missense GPR128 2 83292 2.40119E-5 41646 0 NA
3-100378636-T-C p.Phe643Ser missense GPR128 1 83290 1.20062E-5 41645 0 8.23859E-6
3-100378641-A-T p.Thr645Ser missense GPR128 113 83276 0.00135693 41638 2 0.00328109
3-100378648-C-T p.Ser647Leu missense GPR128 4 83262 4.80411E-5 41631 0 6.37105E-5
3-100378654-A-C p.Lys649Thr missense GPR128 1 83260 1.20106E-5 41630 0 NA
3-100378666-A-G p.Lys653Arg missense GPR128 1 83256 1.20111E-5 41628 0 NA
3-100378677-A-T p.Asn657Tyr missense GPR128 1 83226 1.20155E-5 41613 0 NA
3-100378677-A-C p.Asn657His missense GPR128 1 83226 1.20155E-5 41613 0 1.5949E-5
3-100378685-A-G p.Thr659Thr splice_region+synonymous GPR128 2 83212 2.4035E-5 41606 0 9.55171E-5
3-100378687-G-A p.Ser660Asn missense+splice_region GPR128 32 83202 3.84606E-4 41601 0 5.4147E-4
3-100387788-C-T c.1980-5C>T splice_region GPR128 1 82006 1.21942E-5 41003 0 8.74539E-6
3-100387802-AG-A p.Val664fs frameshift GPR128 1 82598 1.21068E-5 41299 0 NA
3-100387811-C-T p.Ser666Ser synonymous GPR128 2 82858 2.41377E-5 41429 0 8.41765E-6
3-100387824-G-C p.Val671Leu missense GPR128 1 83078 1.20369E-5 41539 0 NA
3-100387828-G-A p.Ser672Asn missense GPR128 1 83098 1.2034E-5 41549 0 NA
3-100387829-C-A p.Ser672Arg missense GPR128 2 83098 2.4068E-5 41549 0 NA
3-100387834-T-C p.Leu674Ser missense GPR128 1 83128 1.20296E-5 41564 0 NA
3-100387835-A-G p.Leu674Leu synonymous GPR128 1 83122 1.20305E-5 41561 0 3.18552E-5
3-100387841-T-G p.Val676Val synonymous GPR128 2 83120 2.40616E-5 41560 0 6.36943E-5
3-100387847-T-A p.Val678Val synonymous GPR128 1 83162 1.20247E-5 41581 0 5.29004E-4
3-100387862-C-G p.Thr683Thr synonymous GPR128 2 83144 2.40547E-5 41572 0 NA
3-100387864-G-A p.Trp684* stop_gained GPR128 2 83146 2.40541E-5 41573 0 NA
3-100387865-G-A p.Trp684* stop_gained GPR128 1 83148 1.20267E-5 41574 0 NA
3-100387892-T-C p.Asn693Asn synonymous GPR128 3 83064 3.61167E-5 41532 0 6.3678E-5
3-100387898-T-C p.Asp695Asp synonymous GPR128 27 82998 3.25309E-4 41499 0 7.6438E-4
3-100387906-G-A p.Arg698Lys missense GPR128 2 82996 2.40975E-5 41498 0 8.92004E-4
3-100387910-C-T p.Ile699Ile synonymous GPR128 1 82910 1.20613E-5 41455 0 NA
3-100387911-G-T p.Val700Phe missense GPR128 1 82916 1.20604E-5 41458 0 2.09591E-4
3-100387913-C-T p.Val700Val synonymous GPR128 1 82900 1.20627E-5 41450 0 NA
3-100387918-G-A p.Ser702Asn missense GPR128 1 82880 1.20656E-5 41440 0 1.68466E-5
3-100387925-A-G p.Ile704Met missense GPR128 2 82826 2.4147E-5 41413 0 NA
3-100387926-T-C p.Phe705Leu missense GPR128 56 82854 6.75888E-4 41427 0 6.68705E-4
3-100387954-G-A c.2136+5G>A splice_region GPR128 1 82262 1.21563E-5 41131 0 NA
3-100413605-C-A p.Ile718Ile synonymous GPR128 1 83280 1.20077E-5 41640 0 NA
3-100413607-T-C p.Leu719Pro missense GPR128 1 83298 1.20051E-5 41649 0 8.28267E-6
3-100413625-A-G p.Lys725Arg missense GPR128 1 83352 1.19973E-5 41676 0 8.25982E-6
3-100413630-T-G p.Phe727Val missense GPR128 3 83358 3.59893E-5 41679 0 2.38646E-5
3-100413637-G-C p.Ser729Thr missense GPR128 1 83350 1.19976E-5 41675 0 NA
3-100413642-G-A p.Ala731Thr missense GPR128 245 83358 0.00293913 41679 6 0.0068781
3-100413645-T-G p.Ser732Ala missense GPR128 10 83366 1.19953E-4 41683 0 5.03525E-4
3-100413651-G-A p.Val734Met missense GPR128 49 83380 5.87671E-4 41690 0 0.0025
3-100413667-C-A p.Ser739* stop_gained GPR128 1 83386 1.19924E-5 41693 0 1.64796E-5
3-100413668-G-A p.Ser739Ser synonymous GPR128 8 83386 9.59394E-5 41693 0 2.38591E-5
3-100413672-A-G p.Ile741Val missense GPR128 1 83384 1.19927E-5 41692 0 1.59185E-4
3-100413679-G-A p.Arg743Lys missense GPR128 1 83384 1.19927E-5 41692 0 8.23818E-6
3-100413683-G-T p.Arg744Ser missense GPR128 1 83380 1.19933E-5 41690 0 2.47145E-5
3-100413689-A-G p.Ser746Ser synonymous GPR128 1 83380 1.19933E-5 41690 0 NA
3-100413698-A-C p.Ser749Ser synonymous GPR128 1 83384 1.19927E-5 41692 0 NA
3-100413699-G-A p.Val750Met missense GPR128 1 83382 1.1993E-5 41691 0 NA
3-100413703-C-T p.Thr751Met missense GPR128 1 83380 1.19933E-5 41690 0 1.35199E-4
3-100413704-G-T p.Thr751Thr synonymous GPR128 2 83384 2.39854E-5 41692 0 1.19291E-5
3-100413704-G-A p.Thr751Thr synonymous GPR128 1 83384 1.19927E-5 41692 0 4.94226E-5
3-100413705-C-T p.Arg752Trp missense GPR128 6 83382 7.1958E-5 41691 1 5.76606E-5
3-100413709-C-T p.Pro753Leu missense GPR128 4 83382 4.7972E-5 41691 0 4.11855E-5
3-100413710-G-A p.Pro753Pro synonymous GPR128 1 83384 1.19927E-5 41692 0 3.18613E-5
3-100413711-A-C p.Arg754Arg synonymous GPR128 12 83390 1.43902E-4 41695 0 6.25E-4
3-100413718-G-A p.Arg756His missense GPR128 263 83382 0.00315416 41691 7 0.00614689
3-100413724-A-T p.Lys758Met missense GPR128 1 83384 1.19927E-5 41692 0 NA
3-100413737-C-T p.Phe762Phe synonymous GPR128 1 83382 1.1993E-5 41691 0 3.9764E-6
3-100413754-C-A p.Thr768Asn missense GPR128 99 83372 0.00118745 41686 0 0.00261213
3-100413760-A-G p.His770Arg missense GPR128 98 83372 0.00117545 41686 0 0.0026113
3-100413762-G-A p.Glu771Lys missense GPR128 1 83370 1.19947E-5 41685 0 1.64747E-5
3-100413765-C-T p.Arg772Cys missense GPR128 6 83368 7.19701E-5 41684 0 5.03525E-4
3-100413766-G-A p.Arg772His missense GPR128 4 83366 4.79812E-5 41683 0 7.95323E-6
3-100413808-C-T p.Thr786Ile missense GPR128 2 83280 2.40154E-5 41640 0 5.03525E-4
3-100413808-C-G p.Thr786Arg missense GPR128 1 83280 1.20077E-5 41640 0 NA
3-100414100-G-A c.*255G>A splice_region GPR128 32 16018 0.00199775 8009 0 0.00646579