Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
16-57655609-C-T c.-184C>T 5_prime_UTR_premature_start_codon_gain GPR56 2 17386 1.15035E-4 8693 0 6.37024E-5
16-57655623-C-T c.-170C>T 5_prime_UTR_premature_start_codon_gain GPR56 2 19352 1.03348E-4 9676 0 NA
16-57655657-C-T c.-136C>T 5_prime_UTR_premature_start_codon_gain GPR56 1 22040 4.5372E-5 11020 0 3.18492E-5
16-57655700-C-T c.-93C>T 5_prime_UTR_premature_start_codon_gain GPR56 2 23614 8.46955E-5 11807 0 NA
16-57655754-TG-T c.-38delG splice_region GPR56 1 24152 4.14044E-5 12076 0 NA
16-57662191-C-T c.-307C>T 5_prime_UTR_premature_start_codon_gain GPR56 1 23826 4.1971E-5 11913 0 3.18634E-5
16-57662192-G-A c.-306G>A 5_prime_UTR_premature_start_codon_gain GPR56 1 23820 4.19815E-5 11910 0 2.23044E-4
16-57662221-T-C c.-134T>C 5_prime_UTR_premature_start_codon_gain GPR56 2 23242 8.60511E-5 11621 0 6.37592E-5
16-57662278-C-T c.-77C>T 5_prime_UTR_premature_start_codon_gain GPR56 33 22714 0.00145285 11357 0 0.0032182
16-57662318-G-A c.-37G>A splice_region GPR56 1 24574 4.06934E-5 12287 0 1.91144E-4
16-57662349-C-T c.-401C>T 5_prime_UTR_premature_start_codon_gain GPR56 1 25198 3.96857E-5 12599 0 NA
16-57662389-C-G c.-361C>G 5_prime_UTR_premature_start_codon_gain GPR56 1 25952 3.85327E-5 12976 0 NA
16-57662405-C-G c.-345C>G 5_prime_UTR_premature_start_codon_gain GPR56 1 25964 3.85149E-5 12982 0 NA
16-57662447-C-T c.-412C>T 5_prime_UTR_premature_start_codon_gain GPR56 197 26888 0.00732669 13444 2 0.0100663
16-57662486-A-T c.-373A>T 5_prime_UTR_premature_start_codon_gain GPR56 2 27114 7.37626E-5 13557 0 NA
16-57662504-G-T c.-355G>T 5_prime_UTR_premature_start_codon_gain GPR56 1377 27146 0.0507257 13573 40 0.0488815
16-57662526-C-T c.-333C>T 5_prime_UTR_premature_start_codon_gain GPR56 3 27194 1.10318E-4 13597 0 NA
16-57662541-C-T c.-318C>T 5_prime_UTR_premature_start_codon_gain GPR56 2 27194 7.35456E-5 13597 0 NA
16-57662544-A-T c.-319-5A>T splice_region GPR56 1 27198 3.67674E-5 13599 0 NA
16-57662567-C-T c.-292C>T 5_prime_UTR_premature_start_codon_gain GPR56 2 27214 7.34916E-5 13607 0 3.18471E-5
16-57662678-C-T c.-181C>T 5_prime_UTR_premature_start_codon_gain GPR56 1 27020 3.70096E-5 13510 0 NA
16-57662691-G-A c.-168G>A 5_prime_UTR_premature_start_codon_gain GPR56 15 27068 5.5416E-4 13534 0 5.09716E-4
16-57662716-T-TGGTG c.-36+2_-36+3insGGTG splice_region GPR56 1 27132 3.68568E-5 13566 0 NA
16-57662719-C-T c.-36+5C>T splice_region GPR56 1 27132 3.68568E-5 13566 0 NA
16-57662743-G-A c.-154+3G>A splice_region GPR56 68 27134 0.00250608 13567 0 0.00543303
16-57662754-TAGTGTGAGTGTGAGAGTGTGAGTGTGTGAGCGTGAGTGTGTGAG-T c.-104_-94+33delAGTGTGAGTGTGAGAGTGTGAGTGTGTGAGCGTGAGTGTGTGAG splice_donor GPR56 5 27136 1.84257E-4 13568 1 4.16233E-4
16-57662754-TAGTGTGAGTGTGAG-T c.-104_-94+3delAGTGTGAGTGTGAG splice_donor GPR56 3 27138 1.10546E-4 13569 0 NA
16-57662754-TAGTGTG-T c.-154+1_-154+6delGAGTGT splice_donor GPR56 2 27138 7.36974E-5 13569 0 NA
16-57662763-TGTGAGA-T c.-95_-94+4delGTGAGA splice_donor GPR56 1 27142 3.68433E-5 13571 0 NA
16-57662766-G-A c.-94+1G>A splice_donor GPR56 2 27138 7.36974E-5 13569 0 NA
16-57662767-A-T c.-94+2A>T splice_donor GPR56 2587 25828 0.100163 12914 198 0.133494
16-57662767-AGAGT-A c.-94+3_-94+6delGAGT splice_region GPR56 1 27140 3.6846E-5 13570 0 NA
16-57662769-AGT-A c.-94+5_-94+6delGT splice_region GPR56 2 27132 7.37137E-5 13566 0 3.92696E-4
16-57662771-TGTGAGTGTGTGAGC-T c.-94+7_-94+20delGTGAGTGTGTGAGC splice_region GPR56 18 27126 6.6357E-4 13563 0 NA
16-57665056-G-A c.-281G>A 5_prime_UTR_premature_start_codon_gain GPR56 1 24342 4.10813E-5 12171 0 3.18735E-5
16-57665132-T-C c.-201T>C 5_prime_UTR_premature_start_codon_gain GPR56 1 24376 4.1024E-5 12188 0 3.19877E-5
16-57665135-G-A c.-198G>A 5_prime_UTR_premature_start_codon_gain GPR56 6 24382 2.46083E-4 12191 0 NA
16-57665182-AA-GC c.-36+3_-36+4delAAinsGC splice_region GPR56 7132 24316 0.293305 12158 784 NA
16-57665182-A-G c.-36+3A>G splice_region GPR56 2864 24350 0.117618 12175 1320 0.395705
16-57665183-A-C c.-36+4A>C splice_region GPR56 2864 24350 0.117618 12175 1320 0.395698
16-57673228-C-T c.-508C>T 5_prime_UTR_premature_start_codon_gain GPR56 6 27762 2.16123E-4 13881 0 1.59378E-4
16-57673236-C-T c.-500C>T 5_prime_UTR_premature_start_codon_gain GPR56 3 27832 1.0779E-4 13916 1 NA
16-57673304-C-T c.-432C>T 5_prime_UTR_premature_start_codon_gain GPR56 2 28058 7.12809E-5 14029 0 NA
16-57673342-C-T c.-758C>T 5_prime_UTR_premature_start_codon_gain GPR56 4 27800 1.43885E-4 13900 0 3.18512E-5
16-57673372-A-G c.-728A>G 5_prime_UTR_premature_start_codon_gain GPR56 1 27420 3.64697E-5 13710 0 1.59347E-4
16-57673492-C-T c.-244C>T 5_prime_UTR_premature_start_codon_gain GPR56 415 26646 0.0155746 13323 23 0.0142839
16-57673540-C-G c.-196C>G 5_prime_UTR_premature_start_codon_gain GPR56 2 25618 7.80701E-5 12809 0 NA
16-57673583-G-A c.-154+1G>A splice_donor GPR56 1 24618 4.06207E-5 12309 0 NA
16-57673994-G-A c.-214G>A 5_prime_UTR_premature_start_codon_gain GPR56 4 11882 3.36644E-4 5941 0 0.00171985
16-57675494-T-A c.-157-5T>A splice_region GPR56 1 24152 4.14044E-5 12076 0 1.97122E-4
16-57675495-TG-T c.-153-7delG splice_region GPR56 1 24136 4.14319E-5 12068 0 NA
16-57675496-GAG-TTT c.-157-3_-157-1delGAGinsTTT splice_acceptor GPR56 1 24092 4.15076E-5 12046 0 NA
16-57675508-C-T c.-148C>T 5_prime_UTR_premature_start_codon_gain GPR56 4 23934 1.67126E-4 11967 0 NA
16-57675537-G-C c.-119G>C 5_prime_UTR_premature_start_codon_gain GPR56 3 23440 1.27986E-4 11720 0 3.24149E-5
16-57675570-C-T c.-86C>T 5_prime_UTR_premature_start_codon_gain GPR56 14 22230 6.2978E-4 11115 0 0.00163913
16-57675622-T-C c.-36+2T>C splice_donor GPR56 1 16014 6.24454E-5 8007 0 NA
16-57677099-C-T c.-91C>T 5_prime_UTR_premature_start_codon_gain GPR56 32 146 0.219178 73 2 0.252695
16-57677161-G-T c.-36+7G>T splice_region GPR56 2 1324 0.00151057 662 0 3.18573E-5
16-57679992-C-T c.-275C>T 5_prime_UTR_premature_start_codon_gain GPR56 8 3296 0.00242718 1648 0 0.00497989
16-57680064-C-T c.-36+3C>T splice_region GPR56 2 11450 1.74672E-4 5725 0 6.37511E-5
16-57680108-T-G c.-159T>G 5_prime_UTR_premature_start_codon_gain GPR56 1 16914 5.91226E-5 8457 0 NA
16-57680140-G-A c.-127G>A 5_prime_UTR_premature_start_codon_gain GPR56 2 21024 9.51294E-5 10512 0 NA
16-57680171-C-T c.-96C>T 5_prime_UTR_premature_start_codon_gain GPR56 2 23380 8.55432E-5 11690 0 2.8765E-4
16-57680187-G-A c.-80G>A 5_prime_UTR_premature_start_codon_gain GPR56 1 23758 4.20911E-5 11879 0 3.1957E-5
16-57680198-C-T c.-69C>T 5_prime_UTR_premature_start_codon_gain GPR56 1 23918 4.18095E-5 11959 0 NA
16-57680206-C-T c.-61C>T 5_prime_UTR_premature_start_codon_gain GPR56 1 23962 4.17327E-5 11981 0 3.21978E-5
16-57680924-G-T c.-36G>T 5_prime_UTR_premature_start_codon_gain GPR56 3 24194 1.23998E-4 12097 0 2.90641E-4
16-57680930-G-A c.-36+6G>A splice_region GPR56 1 24170 4.13736E-5 12085 0 NA
16-57681399-C-T c.-44C>T 5_prime_UTR_premature_start_codon_gain GPR56 5 24208 2.06543E-4 12104 0 NA
16-57681408-G-C c.-36+1G>C splice_donor GPR56 3 24198 1.23977E-4 12099 0 3.18674E-5
16-57681822-C-T c.-120-6C>T splice_region GPR56 2 19870 1.00654E-4 9935 0 NA
16-57681911-A-T c.-37A>T 5_prime_UTR_premature_start_codon_gain GPR56 23 8306 0.00276908 4153 0 7.01039E-4
16-57681914-T-TGGTGACTTCCAAGAGTGACTCCGTCGGAGGAAAATGACTCCC c.-36+2_-36+3insGGTGACTTCCAAGAGTGACTCCGTCGGAGGAAAATGACTCCC splice_region GPR56 1 7964 1.25565E-4 3982 0 NA
16-57681914-T-TGGTGACTTC c.-36+2_-36+3insGGTGACTTC splice_region GPR56 1 7970 1.25471E-4 3985 0 NA
16-57683834-C-T c.-36+2C>T splice_donor GPR56 1 12792 7.81739E-5 6396 0 3.19673E-5
16-57684099-T-C c.-93-8T>C splice_region GPR56 1 77828 1.28488E-5 38914 0 NA
16-57684157-T-A c.-35-8T>A splice_region GPR56 1 82040 1.21892E-5 41020 0 NA
16-57684158-C-T c.-35-7C>T splice_region GPR56 1 82076 1.21838E-5 41038 0 NA
16-57684181-G-A c.-19G>A 5_prime_UTR_premature_start_codon_gain GPR56 1 82660 1.20978E-5 41330 0 NA
16-57684188-C-T c.-12C>T 5_prime_UTR_premature_start_codon_gain GPR56 40 82828 4.82928E-4 41414 0 6.05365E-4
16-57684191-C-T c.-9C>T 5_prime_UTR_premature_start_codon_gain GPR56 2 82910 2.41225E-5 41455 0 3.18593E-5
16-57684210-A-G p.Gln4Arg missense GPR56 2 83140 2.40558E-5 41570 0 NA
16-57684213-C-T p.Ser5Leu missense GPR56 32 83134 3.84921E-4 41567 0 4.14197E-4
16-57684214-G-A p.Ser5Ser synonymous GPR56 1 83136 1.20285E-5 41568 0 5.03525E-4
16-57684225-C-T p.Thr9Met missense GPR56 7 83166 8.4169E-5 41583 0 2.94281E-4
16-57684226-G-A p.Thr9Thr synonymous GPR56 1 83156 1.20256E-5 41578 0 3.18654E-5
16-57684232-G-C p.Leu11Leu synonymous GPR56 2 83166 2.40483E-5 41583 0 NA
16-57684240-T-C p.Leu14Pro missense GPR56 1 83170 1.20236E-5 41585 0 7.95349E-6
16-57684247-G-T p.Leu16Leu synonymous GPR56 2 83146 2.40541E-5 41573 0 NA
16-57684250-C-T p.Leu17Leu synonymous GPR56 7 83148 8.41872E-5 41574 0 2.38614E-5
16-57684267-G-A p.Arg23Lys missense+splice_region GPR56 1 83062 1.20392E-5 41531 0 NA
16-57684274-C-G c.68+7C>G splice_region GPR56 1 83022 1.2045E-5 41511 0 NA
16-57685068-C-G c.65-3C>G splice_region GPR56 1 81220 1.23122E-5 40610 0 NA
16-57685071-C-A p.Ala22Asp missense+splice_region GPR56 4 81248 4.9232E-5 40624 0 2.01452E-5
16-57685081-G-A p.Thr25Thr synonymous GPR56 1 81374 1.22889E-5 40687 0 2.40454E-5
16-57685082-G-A p.Gly26Arg missense GPR56 7 81394 8.60014E-5 40697 0 1.27494E-4
16-57685091-C-A p.Leu29Met missense GPR56 1 81534 1.22648E-5 40767 0 NA
16-57685093-G-T c.65-4G>T splice_region GPR56 1 81538 1.22642E-5 40769 0 NA
16-57685098-C-T p.Pro31Leu missense GPR56 2 81676 2.4487E-5 40838 0 NA
16-57685113-T-G p.Cys24Gly missense+splice_region GPR56 9 81938 1.09839E-4 40969 0 0.0025
16-57685119-C-T p.Arg26Trp missense GPR56 8 82102 9.74398E-5 41051 0 5.97081E-5
16-57685120-G-A p.Gly25Ser missense GPR56 2 82144 2.43475E-5 41072 0 1.65739E-5
16-57685134-G-A p.Gly31Arg missense GPR56 3 82548 3.63425E-5 41274 0 9.56328E-5
16-57685142-T-G p.Phe32Cys missense GPR56 1 82816 1.2075E-5 41408 0 3.97681E-6
16-57685144-C-T p.Arg33Cys missense GPR56 1 82844 1.20709E-5 41422 0 0.00149806
16-57685145-G-A p.Arg33His missense GPR56 4 82836 4.82882E-5 41418 0 0.00100705
16-57685152-C-A p.Cys35* stop_gained GPR56 1 82968 1.20528E-5 41484 0 NA
16-57685160-G-A p.Gly24Arg missense+splice_region GPR56 2 83110 2.40645E-5 41555 0 0.00100705
16-57685170-A-G p.His27Arg missense GPR56 1 83174 1.2023E-5 41587 0 8.23737E-6
16-57685179-C-T p.Gln46* stop_gained GPR56 18 83224 2.16284E-4 41612 0 9.87953E-4
16-57685187-A-G p.His47Arg missense GPR56 1 83296 1.20054E-5 41648 0 5.03525E-4
16-57685192-A-G p.Lys49Glu missense GPR56 2 83320 2.40038E-5 41660 0 NA
16-57685201-C-T p.Pro52Ser missense GPR56 3 83332 3.60006E-5 41666 0 1.27421E-4
16-57685209-G-A p.Cys40Tyr missense GPR56 1 83354 1.1997E-5 41677 0 3.18695E-5
16-57685210-C-T p.Arg55Cys missense GPR56 4 83354 4.79881E-5 41677 0 8.23669E-6
16-57685211-G-A p.Arg55His missense GPR56 1 83354 1.1997E-5 41677 0 7.95311E-6
16-57685215-C-G p.Ile56Met missense+splice_region GPR56 1 83364 1.19956E-5 41682 0 NA
16-57685221-C-T p.Arg60* stop_gained GPR56 74 83366 8.87652E-4 41683 0 0.00197477
16-57685230-C-T p.Arg63* stop_gained GPR56 1 83368 1.1995E-5 41684 0 2.47105E-5
16-57685231-G-A p.Glu62Lys missense GPR56 1 83364 1.19956E-5 41682 0 6.3743E-5
16-57685238-C-T p.Ala64Val missense GPR56 1 83356 1.19967E-5 41678 0 5.03525E-4
16-57685261-C-T p.Pro72Ser missense GPR56 25 83364 2.9989E-4 41682 0 6.08379E-4
16-57685269-C-T p.Pro60Leu missense GPR56 1 83366 1.19953E-5 41683 0 2.38582E-5
16-57685282-C-T p.Arg79* stop_gained GPR56 1 83358 1.19964E-5 41679 0 7.95298E-6
16-57685283-G-A p.Arg79Gln missense GPR56 176 83350 0.00211158 41675 1 0.00430155
16-57685290-C-T p.Ser67Phe missense GPR56 35 83354 4.19896E-4 41677 0 9.23273E-4
16-57685296-C-T p.Thr69Ile missense GPR56 7 83354 8.39792E-5 41677 0 1.27364E-4
16-57685298-C-A p.Pro84His missense+splice_region GPR56 1 83354 1.1997E-5 41677 0 NA
16-57685302-G-A p.Gly71Glu missense GPR56 3 83354 3.59911E-5 41677 0 3.18512E-5
16-57685315-T-C p.Phe90Leu missense GPR56 1 83348 1.19979E-5 41674 0 6.36821E-5
16-57685316-T-C p.Phe90Ser missense GPR56 1 83346 1.19982E-5 41673 0 NA
16-57685328-G-A p.Trp94* stop_gained GPR56 1 83340 1.1999E-5 41670 0 NA
16-57685334-G-A p.Arg96Gln missense GPR56 4 83340 4.79962E-5 41670 0 0.00151057
16-57685337-A-G p.His97Arg missense GPR56 2 83338 2.39987E-5 41669 0 3.18532E-5
16-57685346-G-A p.Arg100Lys missense+splice_region GPR56 1 83326 1.20011E-5 41663 0 NA
16-57685355-T-C p.Leu103Pro missense GPR56 2 83326 2.40021E-5 41663 0 NA
16-57685369-C-T p.Arg108Cys missense GPR56 2 83308 2.40073E-5 41654 0 3.57916E-5
16-57685370-G-A p.Arg108His missense GPR56 4 83306 4.80158E-5 41653 0 3.18552E-5
16-57685388-A-G p.Asp114Gly missense GPR56 4 83272 4.80354E-5 41636 0 5.03525E-4
16-57685398-T-C p.Ser117Ser synonymous GPR56 1 83246 1.20126E-5 41623 0 NA
16-57685435-G-A p.Ala130Thr missense GPR56 1 83078 1.20369E-5 41539 0 NA
16-57685440-G-C p.Gln131His missense+splice_region GPR56 1 83042 1.20421E-5 41521 0 3.18492E-5
16-57685444-C-G p.Pro133Ala missense GPR56 1 82986 1.20502E-5 41493 0 3.97886E-6
16-57685444-C-A p.Pro133Thr missense GPR56 2 82986 2.41005E-5 41493 0 NA
16-57685448-C-T p.Pro134Leu missense GPR56 20 82954 2.41097E-4 41477 0 6.60481E-4
16-57685449-G-A p.Pro134Pro synonymous GPR56 8 82878 9.65274E-5 41439 0 0.00151057
16-57685459-A-C p.Thr138Pro missense GPR56 3 82764 3.62476E-5 41382 0 1.65134E-4
16-57685464-T-C p.Ser144Ser splice_region+synonymous GPR56 1 82686 1.20939E-5 41343 0 NA
16-57685468-A-G p.Thr141Ala missense GPR56 1 82482 1.21239E-5 41241 0 3.97981E-6
16-57685471-T-G p.Ser142Ala missense GPR56 1 82482 1.21239E-5 41241 0 8.26487E-6
16-57685474-T-TG p.Trp144fs frameshift GPR56 1 82416 1.21336E-5 41208 0 NA
16-57685476-G-A p.Trp143* stop_gained GPR56 1 82330 1.21462E-5 41165 0 1.65399E-5
16-57685481-G-A p.Ser145Asn missense GPR56 2 82154 2.43445E-5 41077 0 NA
16-57685492-A-G p.Ile149Val missense GPR56 1 81880 1.2213E-5 40940 0 3.1841E-5
16-57685494-C-T p.Ile149Ile synonymous GPR56 3 81822 3.6665E-5 40911 0 3.1837E-5
16-57685502-C-A p.Pro152His missense GPR56 1 81444 1.22784E-5 40722 0 NA
16-57685505-G-A p.Ser153Asn missense+splice_region GPR56 1 81310 1.22986E-5 40655 0 NA
16-57685509-C-T c.-64C>T 5_prime_UTR_premature_start_codon_gain GPR56 3 81220 3.69367E-5 40610 0 1.27364E-4
16-57685509-C-G p.Ala154Ala splice_region+synonymous GPR56 3 81220 3.69367E-5 40610 0 3.36865E-5
16-57685510-G-A p.Ala155Thr missense GPR56 1 81162 1.2321E-5 40581 0 2.53135E-5
16-57685523-TCTC-T p.???160fs frameshift GPR56 2 80742 2.47703E-5 40371 0 8.67288E-6
16-57685534-A-C p.Ser163Arg missense+splice_region GPR56 7 80262 8.72144E-5 40131 0 3.6355E-5
16-57685711-A-T n.216-7A>T splice_region GPR56 2 36476 5.48306E-5 18238 0 NA
16-57685711-A-G n.216-7A>G splice_region GPR56 1 36476 2.74153E-5 18238 0 NA
16-57687112-C-T c.488-3C>T splice_region GPR56 6 81858 7.32977E-5 40929 0 4.51586E-5
16-57687121-C-A p.Pro165His missense GPR56 1 81952 1.22023E-5 40976 0 3.18796E-5
16-57687122-C-A p.Pro165Pro synonymous GPR56 1 81970 1.21996E-5 40985 0 8.5703E-6
16-57687127-C-T p.Thr167Met missense+splice_region GPR56 2 81944 2.44069E-5 40972 0 8.56208E-6
16-57687131-C-T c.-22C>T 5_prime_UTR_premature_start_codon_gain GPR56 186 82042 0.00226713 41021 2 0.0050373
16-57687133-C-T p.Ala169Val missense GPR56 1 82158 1.21717E-5 41079 0 NA
16-57687145-C-T p.Ser173Leu missense GPR56 3 82410 3.64033E-5 41205 0 NA
16-57687150-G-C p.Asp175His missense GPR56 2 82498 2.4243E-5 41249 0 8.50948E-6
16-57687155-G-A p.Met1? start_lost GPR56 1 82568 1.21112E-5 41284 0 1.7003E-5
16-57687158-C-T p.Cys125Cys splice_region+synonymous GPR56 1 82532 1.21165E-5 41266 0 3.19122E-5
16-57687167-A-G p.Lys180Lys synonymous GPR56 1 82690 1.20934E-5 41345 0 1.20366E-5
16-57687170-G-T p.Arg181Ser missense GPR56 1 82690 1.20934E-5 41345 0 NA
16-57687176-C-T p.Leu183Leu synonymous GPR56 1 82696 1.20925E-5 41348 0 4.01432E-6
16-57687224-G-A p.Arg199Arg splice_region+synonymous GPR56 1 82124 1.21767E-5 41062 0 NA
16-57687225-C-T p.Pro200Ser missense GPR56 1 82204 1.21649E-5 41102 0 1.64719E-5
16-57687226-C-T p.Pro200Leu missense GPR56 1 82196 1.2166E-5 41098 0 8.23093E-6
16-57687229-C-T p.Ser201Leu missense GPR56 3 82022 3.65756E-5 41011 0 5.04032E-4
16-57687230-G-A p.Ser201Ser synonymous GPR56 1 82010 1.21936E-5 41005 0 3.18878E-5
16-57687230-G-T p.Ser201Ser synonymous GPR56 1 82010 1.21936E-5 41005 0 NA
16-57687232-C-T p.Ala202Val missense GPR56 2 81946 2.44063E-5 40973 0 9.09686E-6
16-57687234-G-A p.Ala203Thr missense GPR56 2 81718 2.44744E-5 40859 0 4.20656E-6
16-57687239-C-T p.Pro204Pro synonymous GPR56 93 82108 0.00113265 41054 0 8.8429E-4
16-57687240-G-A p.Ala205Thr missense GPR56 4 81876 4.88544E-5 40938 0 9.56389E-5
16-57687247-A-G p.Gln207Arg missense+splice_region GPR56 1 82034 1.21901E-5 41017 0 3.18654E-5
16-57687890-C-T c.111-8C>T splice_region GPR56 2 82824 2.41476E-5 41412 0 1.59217E-5
16-57687893-G-A c.111-5G>A splice_region GPR56 16 82838 1.93148E-4 41419 0 6.25E-4
16-57687894-C-T c.111-4C>T splice_region GPR56 1 82860 1.20685E-5 41430 0 NA
16-57687910-C-T p.Ser41Ser synonymous GPR56 2 82940 2.41138E-5 41470 0 2.4775E-5
16-57687913-G-A p.Leu42Leu synonymous GPR56 1 82986 1.20502E-5 41493 0 1.0733E-4
16-57687918-C-T p.Ser44Leu missense GPR56 89 83006 0.00107221 41503 0 0.00337687
16-57687918-C-G p.Ser44Trp missense GPR56 7 83010 8.43272E-5 41505 0 6.25391E-4
16-57687930-C-T p.Ser48Phe missense GPR56 1 83044 1.20418E-5 41522 0 NA
16-57687931-T-C p.Ser48Ser synonymous GPR56 1 83048 1.20412E-5 41524 0 NA
16-57687934-G-A p.Val49Val synonymous GPR56 1 83042 1.20421E-5 41521 0 1.65049E-5
16-57687941-A-G p.Met52Val missense GPR56 1 83038 1.20427E-5 41519 0 3.97747E-6
16-57687950-A-G p.Met55Val missense GPR56 1 83030 1.20438E-5 41515 0 3.97763E-6
16-57687962-G-A p.Glu59Lys missense GPR56 3 82996 3.61463E-5 41498 0 0.00375
16-57687971-C-T p.Arg62Trp missense GPR56 1 82936 1.20575E-5 41468 0 1.59195E-5
16-57687972-G-A p.Arg62Gln missense GPR56 2 82948 2.41115E-5 41474 0 0.00151057
16-57687979-C-T p.Asn64Asn synonymous GPR56 4 82896 4.82532E-5 41448 0 1.27429E-4
16-57687979-C-A p.Asn64Lys missense GPR56 2 82896 2.41266E-5 41448 0 NA
16-57687980-G-A p.Ala65Thr missense GPR56 1 82876 1.20662E-5 41438 0 6.25E-4
16-57687984-C-T p.Thr66Met missense GPR56 2 82850 2.414E-5 41425 0 8.27746E-6
16-57687985-G-A p.Thr66Thr synonymous GPR56 6 82854 7.24165E-5 41427 0 4.13935E-5
16-57687988-G-A p.Val67Val synonymous GPR56 13 82834 1.5694E-4 41417 0 3.82166E-4
16-57688003-C-T p.Pro72Pro synonymous GPR56 5 82666 6.04844E-5 41333 0 4.38631E-5
16-57688003-C-A p.Pro72Pro synonymous GPR56 2 82668 2.41932E-5 41334 0 NA
16-57688009-C-T p.Ala74Ala synonymous GPR56 2 82586 2.42172E-5 41293 0 2.49929E-5
16-57688010-G-A p.Gly75Ser missense GPR56 1 82586 1.21086E-5 41293 0 1.19726E-5
16-57688020-A-C p.Asp78Ala missense GPR56 1 82458 1.21274E-5 41229 0 NA
16-57688034-T-G p.Ser83Ala missense GPR56 2 82252 2.43155E-5 41126 0 9.56999E-5
16-57688037-C-T p.Arg84Trp missense GPR56 6 82236 7.29607E-5 41118 0 2.54923E-4
16-57688038-G-A p.Arg84Gln missense GPR56 2 82244 2.43179E-5 41122 0 7.23688E-5
16-57688042-G-A p.Gln85Gln synonymous GPR56 2 82148 2.43463E-5 41074 0 3.4046E-5
16-57689321-G-A p.Ser90Asn missense GPR56 3 83006 3.6142E-5 41503 0 3.99096E-6
16-57689322-C-T p.Ser90Ser synonymous GPR56 2 82994 2.40981E-5 41497 0 4.18046E-5
16-57689323-G-A p.Glu91Lys missense GPR56 4 83008 4.81881E-5 41504 0 1.67135E-5
16-57689329-A-G p.Met93Val missense GPR56 3 82990 3.61489E-5 41495 0 8.34502E-6
16-57689337-C-T p.Tyr95Tyr synonymous GPR56 2 83000 2.40964E-5 41500 0 8.33667E-6
16-57689339-C-T p.Ser96Leu missense GPR56 1 83006 1.20473E-5 41503 0 3.98606E-6
16-57689343-G-C p.Val97Val synonymous GPR56 4 83020 4.81812E-5 41510 0 9.1627E-5
16-57689353-C-T p.Arg101* stop_gained GPR56 1 83030 1.20438E-5 41515 0 1.19513E-5
16-57689354-G-A p.Arg101Gln missense GPR56 4 83016 4.81835E-5 41508 0 6.37471E-5
16-57689372-C-T p.Thr107Met missense GPR56 3 83022 3.6135E-5 41511 0 2.27019E-4
16-57689373-G-A p.Thr107Thr synonymous GPR56 6 83022 7.227E-5 41511 0 8.30385E-5
16-57689377-G-A p.Gly109Ser missense GPR56 1 83020 1.20453E-5 41510 0 NA
16-57689380-C-T p.Arg110Trp missense GPR56 3 82982 3.61524E-5 41491 0 7.96737E-5
16-57689381-G-A p.Arg110Gln missense GPR56 2 83002 2.40958E-5 41501 0 0.00100705
16-57689385-C-G p.Ser111Arg missense GPR56 45610 82068 0.555759 41034 13475 0.618833
16-57689385-CG-GC p.SerGly111ArgArg missense GPR56 112 82990 0.00134956 41495 0 NA
16-57689385-C-A p.Ser111Arg missense GPR56 7 82990 8.43475E-5 41495 0 6.39059E-5
16-57689385-C-T p.Ser111Ser synonymous GPR56 1 82990 1.20496E-5 41495 0 1.91718E-4
16-57689385-CG-GT p.SerGly111ArgTrp missense GPR56 1 82990 1.20496E-5 41495 0 NA
16-57689386-G-C p.Gly112Arg missense GPR56 153 83020 0.00184293 41510 1 0.00426487
16-57689386-G-T p.Gly112Trp missense GPR56 1 83026 1.20444E-5 41513 0 NA
16-57689415-G-A p.Val121Val synonymous GPR56 1 82912 1.2061E-5 41456 0 3.98127E-6
16-57689431-G-A p.Ala127Thr missense GPR56 2 82734 2.41739E-5 41367 0 NA
16-57689450-G-A c.390+8G>A splice_region GPR56 1 82316 1.21483E-5 41158 0 8.32487E-6
16-57689450-G-T c.390+8G>T splice_region GPR56 1 82316 1.21483E-5 41158 0 NA
16-57689793-G-C p.Lys132Asn missense GPR56 3 83296 3.60161E-5 41648 0 NA
16-57689805-A-C p.Gln136His missense GPR56 18088 83104 0.217655 41552 2135 0.206363
16-57689808-C-T p.Val137Val synonymous GPR56 1 83294 1.20057E-5 41647 0 NA
16-57689815-G-A p.Glu140Lys missense GPR56 2 83296 2.40108E-5 41648 0 3.97624E-6
16-57689820-G-A p.Lys139Lys splice_region+synonymous GPR56 1 83296 1.20054E-5 41648 0 8.23723E-6
16-57689823-C-G c.417+3C>G splice_region GPR56 1 83294 1.20057E-5 41647 0 8.23723E-6
16-57689823-C-T c.417+3C>T splice_region GPR56 2 83294 2.40113E-5 41647 0 1.19288E-5
16-57689824-T-C c.417+4T>C splice_region GPR56 4 83298 4.80204E-5 41649 0 1.98813E-5
16-57689827-G-A p.Gly144Arg missense GPR56 2 83294 2.40113E-5 41647 0 NA
16-57689839-C-T p.Gln148* stop_gained GPR56 1 83270 1.20091E-5 41635 0 NA
16-57689864-C-T p.Thr156Met missense GPR56 9 83206 1.08165E-4 41603 0 1.89478E-4
16-57689865-G-A p.Thr156Thr synonymous GPR56 1 83208 1.20181E-5 41604 0 3.29527E-5
16-57689872-G-A p.Val159Met missense GPR56 15 83180 1.80332E-4 41590 0 1.94896E-4
16-57689874-G-A p.Val159Val synonymous GPR56 1 83172 1.20233E-5 41586 0 8.239E-6
16-57689883-T-C p.Thr162Thr synonymous GPR56 60795 81370 0.747143 40685 22971 0.787241
16-57689892-C-T p.His165His synonymous GPR56 2 83104 2.40662E-5 41552 0 NA
16-57689904-G-A p.Pro169Pro splice_region+synonymous GPR56 1 83032 1.20435E-5 41516 0 3.1839E-5
16-57689912-G-A c.507+8G>A splice_region GPR56 247 82948 0.00297777 41474 2 0.00202849
16-57690155-A-G p.Gln175Gln synonymous GPR56 1 82502 1.21209E-5 41251 0 7.95267E-6
16-57690163-T-C p.Phe178Ser missense GPR56 2 82388 2.42754E-5 41194 0 NA
16-57690175-A-G p.Asp182Gly missense GPR56 1 82132 1.21755E-5 41066 0 NA
16-57690177-C-T p.Pro183Ser missense GPR56 2 82090 2.43635E-5 41045 0 7.95342E-6
16-57690419-T-A c.554-7T>A splice_region GPR56 1 82828 1.20732E-5 41414 0 NA
16-57690435-C-T p.Pro188Leu missense GPR56 4 82970 4.82102E-5 41485 0 6.25E-4
16-57690435-C-G p.Pro188Arg missense GPR56 1 82970 1.20525E-5 41485 0 3.97643E-6
16-57690436-G-A p.Pro188Pro synonymous GPR56 1 82986 1.20502E-5 41493 0 2.4719E-5
16-57690439-G-A p.Gly189Gly synonymous GPR56 6 83006 7.22839E-5 41503 0 1.98817E-5
16-57690439-G-T p.Gly189Gly synonymous GPR56 1 83006 1.20473E-5 41503 0 1.64788E-5
16-57690441-A-G p.His190Arg missense GPR56 1 83022 1.2045E-5 41511 0 2.78343E-5
16-57690465-C-G p.Thr198Ser missense GPR56 1 83124 1.20302E-5 41562 0 8.23818E-6
16-57690467-G-A p.Val199Ile missense GPR56 1 83132 1.20291E-5 41566 0 4.94291E-5
16-57690471-G-A p.Arg200Lys missense GPR56 1 83158 1.20253E-5 41579 0 NA
16-57690486-C-T p.Thr205Ile missense GPR56 1 83144 1.20273E-5 41572 0 3.18654E-5
16-57690503-C-T p.His211Tyr missense GPR56 1 83132 1.20291E-5 41566 0 8.23805E-6
16-57690508-G-A p.Leu212Leu synonymous GPR56 2 83124 2.40604E-5 41562 0 6.37186E-5
16-57690510-C-A p.Thr213Asn missense GPR56 1 83110 1.20322E-5 41555 0 NA
16-57691276-T-TG c.658-9_658-8insG splice_region GPR56 1 82850 1.207E-5 41425 0 NA
16-57691284-G-T c.658-1G>T splice_acceptor GPR56 1 82952 1.20552E-5 41476 0 NA
16-57691294-G-A p.Val223Met missense GPR56 1 83016 1.20459E-5 41508 0 3.18492E-5
16-57691305-C-T p.Asp226Asp synonymous GPR56 2 83062 2.40784E-5 41531 0 3.13128E-4
16-57691306-G-A p.Ala227Thr missense GPR56 2 83062 2.40784E-5 41531 0 8.24049E-6
16-57691308-C-T p.Ala227Ala synonymous GPR56 1 83088 1.20354E-5 41544 0 NA
16-57691310-T-C p.Val228Ala missense GPR56 8 83124 9.62418E-5 41562 0 9.55597E-5
16-57691317-G-A p.Lys230Lys synonymous GPR56 5 83130 6.01468E-5 41565 0 5.76787E-5
16-57691324-C-T p.Leu233Leu synonymous GPR56 1 83130 1.20294E-5 41565 0 NA
16-57691331-TC-T p.Leu236fs frameshift GPR56 1 83164 1.20244E-5 41582 0 NA
16-57691341-C-T p.Tyr238Tyr synonymous GPR56 2 83168 2.40477E-5 41584 0 6.59174E-5
16-57691342-G-A p.Val239Met missense GPR56 3 83166 3.60724E-5 41583 0 3.18593E-5
16-57691353-C-T p.Val242Val synonymous GPR56 1 83168 1.20239E-5 41584 0 1.31837E-4
16-57691354-G-A p.Val243Ile missense GPR56 6 83160 7.21501E-5 41580 0 5.03525E-4
16-57691355-T-C p.Val243Ala missense GPR56 1 83176 1.20227E-5 41588 0 3.9769E-6
16-57691356-C-G p.Val243Val synonymous GPR56 1 83178 1.20224E-5 41589 0 1.07121E-4
16-57691357-T-C p.Ser244Pro missense GPR56 1 83164 1.20244E-5 41582 0 NA
16-57691363-C-T p.Leu246Leu synonymous GPR56 2 83166 2.40483E-5 41583 0 NA
16-57691385-C-T p.Ala253Val missense GPR56 1 83044 1.20418E-5 41522 0 NA
16-57691386-C-T p.Ala253Ala synonymous GPR56 8 83026 9.63554E-5 41513 0 3.29647E-5
16-57691387-G-A p.Ala254Thr missense GPR56 53 83010 6.38477E-4 41505 0 0.00100705
16-57691393-C-T p.Leu256Phe missense GPR56 2 82960 2.4108E-5 41480 0 NA
16-57691409-G-A c.776+6G>A splice_region GPR56 2586 82628 0.0312969 41314 125 0.0498917
16-57693317-C-A p.Pro263Thr missense GPR56 1 76514 1.30695E-5 38257 0 8.0859E-6
16-57693318-C-T p.Pro263Leu missense GPR56 3 76780 3.90727E-5 38390 0 4.20112E-5
16-57693319-G-A c.1287-6G>A splice_region GPR56 31 76950 4.02859E-4 38475 0 0.003125
16-57693319-G-T c.1287-6G>T splice_region GPR56 2 76952 2.59902E-5 38476 0 NA
16-57693337-G-A p.Arg269Arg synonymous GPR56 3 78828 3.80575E-5 39414 0 1.91412E-4
16-57693338-G-T p.Asp270Tyr missense GPR56 1 78880 1.26775E-5 39440 0 NA
16-57693353-G-A p.Val275Met missense GPR56 1 79656 1.2554E-5 39828 0 8.31656E-6
16-57693361-G-T p.Met277Ile missense GPR56 1 79878 1.25191E-5 39939 0 NA
16-57693364-C-A p.Asn278Lys missense GPR56 1 79944 1.25088E-5 39972 0 NA
16-57693365-C-T p.Leu279Leu synonymous GPR56 2 79908 2.50288E-5 39954 0 NA
16-57693367-G-C p.Leu279Leu synonymous GPR56 1 79896 1.25163E-5 39948 0 8.30592E-6
16-57693376-C-T p.Ala282Ala synonymous GPR56 623 79898 0.00779744 39949 20 0.0154994
16-57693377-G-A p.Val283Ile missense GPR56 3 80074 3.74653E-5 40037 0 6.25E-4
16-57693392-A-G p.Thr288Ala missense GPR56 4 80362 4.97748E-5 40181 0 4.9743E-5
16-57693393-C-T p.Thr288Met missense GPR56 2 80340 2.48942E-5 40170 0 8.2905E-6
16-57693394-G-A p.Thr288Thr synonymous GPR56 15 80470 1.86405E-4 40235 0 0.00151057
16-57693409-C-T p.Ser293Ser synonymous GPR56 8 80602 9.92531E-5 40301 0 6.25E-4
16-57693415-G-A p.Pro295Pro synonymous GPR56 6 81776 7.33712E-5 40888 0 3.31093E-5
16-57693426-CA-C p.Gly300fs frameshift GPR56 1 82066 1.21853E-5 41033 0 NA
16-57693442-C-T p.Gly304Gly synonymous GPR56 1 82228 1.21613E-5 41114 0 NA
16-57693446-C-T p.Arg306* stop_gained GPR56 2 82262 2.43126E-5 41131 0 4.80211E-5
16-57693453-G-C p.Ser308Thr missense GPR56 6 82602 7.26375E-5 41301 0 3.58169E-5
16-57693453-G-T p.Ser308Ile missense GPR56 1 82602 1.21062E-5 41301 0 NA
16-57693470-T-C p.Phe314Leu missense GPR56 2 82812 2.41511E-5 41406 0 1.65164E-5
16-57693481-C-T p.Leu317Leu synonymous GPR56 2 82936 2.4115E-5 41468 0 3.97776E-6
16-57693498-T-C p.Met323Thr missense GPR56 2284 82838 0.0275719 41419 40 0.0330868
16-57693498-TG-CA p.Met323Thr missense GPR56 2 82950 2.41109E-5 41475 0 NA
16-57693500-G-A p.Gly324Ser missense GPR56 9 82952 1.08496E-4 41476 0 3.58046E-5
16-57693505-C-T p.Leu325Leu synonymous GPR56 2 82922 2.41191E-5 41461 0 3.97848E-6
16-57693525-G-A p.Arg332Gln missense GPR56 1 82784 1.20796E-5 41392 0 1.65303E-5
16-57693528-T-C p.Leu333Pro missense GPR56 2 82742 2.41715E-5 41371 0 NA
16-57693530-G-A p.Val334Met missense GPR56 3 82702 3.62748E-5 41351 0 1.19443E-5
16-57693549-C-G p.Thr340Ser missense GPR56 11 82410 1.33479E-4 41205 0 3.18695E-5
16-57693550-C-G p.Thr340Thr synonymous GPR56 1 82418 1.21333E-5 41209 0 NA
16-57693552-A-G p.Tyr341Cys missense GPR56 6 82334 7.28739E-5 41167 0 7.97849E-6
16-57693558-C-T p.Pro343Leu missense GPR56 2 82134 2.43505E-5 41067 0 NA
16-57693575-C-T p.Leu349Leu synonymous GPR56 1 81400 1.2285E-5 40700 0 8.33764E-6
16-57693580-C-T p.Ser350Ser synonymous GPR56 2 81140 2.46488E-5 40570 0 1.60653E-5
16-57693581-G-A p.Ala351Thr missense GPR56 1 81056 1.23371E-5 40528 0 8.36218E-6
16-57693588-G-C p.Gly353Ala missense GPR56 1 81030 1.23411E-5 40515 0 1.67602E-5
16-57693594-G-GT c.1063+1_1063+2insT splice_donor GPR56 1 80978 1.2349E-5 40489 0 9.56755E-5
16-57693600-G-C c.1063+7G>C splice_region GPR56 2 80822 2.47457E-5 40411 0 3.38576E-5
16-57694691-T-C p.Phe359Leu missense GPR56 1 82864 1.2068E-5 41432 0 2.54907E-4
16-57694696-G-GACCTT p.Val361fs frameshift GPR56 1 82900 1.20627E-5 41450 0 NA
16-57694702-G-A p.Thr362Thr synonymous GPR56 1 82922 1.20595E-5 41461 0 8.89664E-6
16-57694718-G-A p.Asp368Asn missense GPR56 1 83006 1.20473E-5 41503 0 NA
16-57694721-G-A p.Val369Met missense GPR56 3 83018 3.61367E-5 41509 0 1.9916E-5
16-57694736-C-T p.Pro374Ser missense GPR56 1 83016 1.20459E-5 41508 0 3.98251E-6
16-57694747-G-A p.Leu377Leu synonymous GPR56 1 82986 1.20502E-5 41493 0 3.18552E-5
16-57694768-G-A p.Glu384Glu synonymous GPR56 1 82792 1.20785E-5 41396 0 5.04032E-4
16-57694769-G-A p.Gly385Ser missense GPR56 1 82778 1.20805E-5 41389 0 NA
16-57694770-G-A p.Gly385Asp missense GPR56 1 82772 1.20814E-5 41386 0 NA
16-57694771-C-T p.Gly385Gly synonymous GPR56 10 82734 1.20869E-4 41367 0 3.75886E-4
16-57694772-G-A p.Val386Ile missense GPR56 2 82720 2.41779E-5 41360 0 1.79247E-5
16-57694780-C-T p.Tyr388Tyr synonymous GPR56 2 82552 2.42272E-5 41276 0 NA
16-57694786-C-G p.Ser390Ser splice_region+synonymous GPR56 1 82378 1.21392E-5 41189 0 NA
16-57695603-C-T c.1173-6C>T splice_region GPR56 1 69854 1.43156E-5 34927 0 NA
16-57695604-C-T c.1173-5C>T splice_region GPR56 13558 67896 0.199688 33948 1090 0.2784
16-57695604-C-G c.1173-5C>G splice_region GPR56 1 69990 1.42878E-5 34995 0 NA
16-57695605-G-C c.1173-4G>C splice_region GPR56 1 70134 1.42584E-5 35067 0 6.36943E-5
16-57695609-G-T p.Met391Ile missense+splice_region GPR56 5 71386 7.00417E-5 35693 0 1.84682E-5
16-57695619-C-T p.Arg395Trp missense GPR56 4 74196 5.39113E-5 37098 0 1.27421E-4
16-57695620-G-A p.Arg395Gln missense GPR56 2 74188 2.69585E-5 37094 0 1.14499E-4
16-57695625-T-G p.Ser397Ala missense GPR56 2 75868 2.63616E-5 37934 0 4.01523E-6
16-57695670-T-G p.Phe412Val missense GPR56 1 81792 1.22261E-5 40896 0 NA
16-57695682-A-T p.Met416Leu missense GPR56 1 82432 1.21312E-5 41216 0 8.25273E-6
16-57695683-T-C p.Met416Thr missense GPR56 8 82470 9.7005E-5 41235 0 3.18654E-5
16-57695688-A-T p.Met418Leu missense GPR56 4 82662 4.83898E-5 41331 0 8.25001E-5
16-57695712-A-G p.Ile426Val missense GPR56 1 83042 1.20421E-5 41521 0 NA
16-57695718-C-T p.Arg428Trp missense GPR56 3 83110 3.60967E-5 41555 0 5.03525E-4
16-57695719-G-A p.Arg428Gln missense GPR56 1 83112 1.2032E-5 41556 0 2.47198E-5
16-57695724-C-T p.Arg430Cys missense GPR56 9 83134 1.08259E-4 41567 0 9.06349E-5
16-57695725-G-A p.Arg430His missense GPR56 3 83148 3.60802E-5 41574 0 5.03525E-4
16-57695726-C-G p.Arg430Arg synonymous GPR56 1 83158 1.20253E-5 41579 0 1.19295E-5
16-57695730-C-A p.His432Asn missense GPR56 1 83184 1.20215E-5 41592 0 8.23886E-6
16-57695731-A-G p.His432Arg missense GPR56 1 83200 1.20192E-5 41600 0 6.37024E-5
16-57695738-A-G p.Gln434Gln synonymous GPR56 1 83230 1.20149E-5 41615 0 NA
16-57695754-C-T p.Leu440Leu synonymous GPR56 86 83262 0.00103288 41631 1 0.00251762
16-57695756-G-A p.Leu440Leu synonymous GPR56 1 83266 1.20097E-5 41633 0 NA
16-57695760-C-G p.Leu442Val missense GPR56 31 83270 3.72283E-4 41635 0 6.25E-4
16-57695765-G-A p.Leu443Leu synonymous GPR56 2 83276 2.40165E-5 41638 0 0.0025
16-57695772-A-G p.Ser446Gly missense GPR56 1 83280 1.20077E-5 41640 0 1.19296E-5
16-57695786-C-T p.Gly450Gly synonymous GPR56 4 83270 4.80365E-5 41635 0 2.22413E-4
16-57695798-C-A p.Ala454Ala synonymous GPR56 1 83284 1.20071E-5 41642 0 NA
16-57695801-G-T p.Leu455Phe missense GPR56 1 83288 1.20065E-5 41644 0 3.1839E-5
16-57695802-A-T p.Ile456Phe missense GPR56 1 83282 1.20074E-5 41641 0 NA
16-57695827-C-T p.Thr464Ile missense GPR56 1 83270 1.20091E-5 41635 0 1.1932E-5
16-57695828-C-G p.Thr464Thr synonymous GPR56 1 83268 1.20094E-5 41634 0 NA
16-57695834-G-C p.Gln466His missense GPR56 1 83252 1.20117E-5 41626 0 NA
16-57695840-C-T p.Val468Val synonymous GPR56 3 83240 3.60404E-5 41620 0 3.18329E-5
16-57695841-G-A p.Val469Ile missense GPR56 4 83234 4.80573E-5 41617 0 3.1837E-5
16-57695864-C-T p.Ile476Ile synonymous GPR56 1 83086 1.20357E-5 41543 0 NA
16-57695866-C-T p.Thr477Ile missense GPR56 1 83058 1.20398E-5 41529 0 8.23845E-6
16-57695875-A-G p.Gln480Arg missense+splice_region GPR56 1 82926 1.20589E-5 41463 0 3.18634E-5
16-57697360-G-A c.1442-4G>A splice_region GPR56 1 81066 1.23356E-5 40533 0 6.25782E-4
16-57697364-G-C p.Gly481Ala missense+splice_region GPR56 1 81342 1.22938E-5 40671 0 8.44709E-6
16-57697369-C-T p.Leu483Phe missense GPR56 1 81530 1.22654E-5 40765 0 NA
16-57697375-T-C p.Phe485Leu missense GPR56 1 81716 1.22375E-5 40858 0 NA
16-57697388-G-A p.Trp489* stop_gained GPR56 1 82042 1.21889E-5 41021 0 NA
16-57697396-C-T p.Arg492Trp missense GPR56 8 82000 9.7561E-5 41000 0 0.00125
16-57697399-C-T p.Leu493Leu synonymous GPR56 1 82066 1.21853E-5 41033 0 NA
16-57697400-T-C p.Leu493Pro missense GPR56 2 82080 2.43665E-5 41040 0 3.18756E-5
16-57697405-G-T p.Ala495Ser missense GPR56 1 82084 1.21826E-5 41042 0 NA
16-57697408-C-T p.Arg496Trp missense GPR56 2 82160 2.43427E-5 41080 0 6.37592E-5
16-57697408-C-A p.Arg496Arg synonymous GPR56 2 82160 2.43427E-5 41080 0 3.18796E-5
16-57697409-G-A p.Arg496Gln missense GPR56 2 82076 2.43677E-5 41038 0 1.59439E-4
16-57697412-G-A p.Gly497Asp missense GPR56 2 82218 2.43256E-5 41109 0 2.49567E-5
16-57697413-T-C p.Gly497Gly synonymous GPR56 45 82014 5.48687E-4 41007 1 6.69985E-4
16-57697413-T-G p.Gly497Gly synonymous GPR56 1 82018 1.21924E-5 41009 0 1.20177E-5
16-57697419-C-T p.Pro499Pro synonymous GPR56 1 82376 1.21395E-5 41188 0 6.37267E-5
16-57697421-C-T p.Ser500Phe missense GPR56 5 82412 6.06708E-5 41206 0 1.27453E-4
16-57697425-T-C p.Pro501Pro synonymous GPR56 1 82444 1.21294E-5 41222 0 NA
16-57697433-G-A p.Ser504Asn missense GPR56 2 82608 2.42107E-5 41304 0 1.99214E-5
16-57697440-A-G p.Ser506Ser synonymous GPR56 1 82642 1.21004E-5 41321 0 NA
16-57697446-C-T p.Ser508Ser synonymous GPR56 1 82612 1.21048E-5 41306 0 1.16158E-4
16-57697446-C-A p.Ser508Arg missense GPR56 1 82612 1.21048E-5 41306 0 NA
16-57697447-G-A p.Ala509Thr missense GPR56 3 82584 3.63266E-5 41292 0 1.2751E-4
16-57697466-C-T p.Ser515Leu missense GPR56 3 82572 3.63319E-5 41286 0 0.00151057
16-57697467-G-A p.Ser515Ser synonymous GPR56 2 82564 2.42236E-5 41282 0 1.2363E-4
16-57697478-C-T p.Ser519Leu missense GPR56 6 82420 7.27979E-5 41210 0 3.20028E-5
16-57697485-C-A p.Ser521Arg missense GPR56 1 82386 1.2138E-5 41193 0 2.49867E-5
16-57697487-G-A p.Arg522His missense GPR56 6 82364 7.28474E-5 41182 0 5.03525E-4