Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-14492052-T-C c.-284T>C 5_prime_UTR_premature_start_codon_gain CD97 1 52982 1.88743E-5 26491 0 NA
19-14492077-C-T c.-259C>T 5_prime_UTR_premature_start_codon_gain CD97 1 60784 1.64517E-5 30392 0 NA
19-14492108-G-A c.-228G>A 5_prime_UTR_premature_start_codon_gain CD97 2 69378 2.88276E-5 34689 0 NA
19-14492118-A-T c.-218A>T 5_prime_UTR_premature_start_codon_gain CD97 1 69550 1.43781E-5 34775 0 NA
19-14492146-T-C c.-190T>C 5_prime_UTR_premature_start_codon_gain CD97 2 76328 2.62027E-5 38164 0 NA
19-14492243-C-G c.-93C>G 5_prime_UTR_premature_start_codon_gain CD97 1 81304 1.22995E-5 40652 0 NA
19-14492266-A-G c.-70A>G 5_prime_UTR_premature_start_codon_gain CD97 65 81712 7.95477E-4 40856 0 0.00236316
19-14492269-C-T c.-67C>T 5_prime_UTR_premature_start_codon_gain CD97 2 81796 2.44511E-5 40898 0 NA
19-14492313-C-T c.-23C>T 5_prime_UTR_premature_start_codon_gain CD97 23 82390 2.7916E-4 41195 0 1.91498E-4
19-14492344-C-T p.Gly3Gly synonymous CD97 4 82368 4.85625E-5 41184 0 1.85033E-4
19-14492345-CG-C p.Arg4fs frameshift CD97 4 82424 4.85296E-5 41212 0 NA
19-14492346-G-A p.Arg4His missense CD97 4 82400 4.85437E-5 41200 0 8.41241E-6
19-14492348-G-A p.Val5Ile missense CD97 3 82384 3.64148E-5 41192 0 NA
19-14492351-T-G p.Phe6Val missense CD97 3 82438 3.6391E-5 41219 0 NA
19-14492357-G-T p.Ala8Ser missense+splice_region CD97 2 82370 2.42807E-5 41185 0 7.59032E-5
19-14492357-G-GCATTCTGTGTCT c.22_22+1insCATTCTGTGTCT splice_donor CD97 1 82370 1.21403E-5 41185 0 NA
19-14492358-G-GT c.22+1_22+2insT splice_donor CD97 1 82372 1.214E-5 41186 0 3.18776E-5
19-14499266-C-G p.Phe9Leu missense CD97 1 81144 1.23238E-5 40572 0 NA
19-14499286-C-T p.Pro16Leu missense CD97 2 81126 2.4653E-5 40563 0 6.37755E-4
19-14499287-G-A p.Pro16Pro synonymous CD97 3 81048 3.70151E-5 40524 0 5.18171E-5
19-14499301-A-G p.Gln21Arg missense CD97 1 80774 1.23802E-5 40387 0 4.45085E-6
19-14499304-A-G p.Asp22Gly missense CD97 1 80588 1.24088E-5 40294 0 1.70462E-5
19-14499309-A-G p.Arg24Gly missense CD97 2 80386 2.488E-5 40193 0 3.42736E-5
19-14499311-GGGTGAGTCTGCTGGGAAGCAGAAAGCACAGTCCACAGCCAGAGCCTGGGGAGGGTCCTGGACCCCCGCCCAGCCCCCTTCAGCCCAGGGAAAGAGAGGGCTCGCGCACGAGAAACTCAGCGCCCTGCCCCATCTCCCCCAGTGCCCCCTTTTTGTGTATTCCCTTACCCCTCACCTTCTGACCGTGCTCCCTGCTCTTGCA-G p.Gly25fs frameshift CD97 4 80328 4.97958E-5 40164 0 NA
19-14499315-G-A c.73+3G>A splice_region CD97 1 80120 1.24813E-5 40060 0 NA
19-14499511-C-G c.74-3C>G splice_region CD97 1 82482 1.21239E-5 41241 0 1.65055E-5
19-14499522-C-T p.Arg28Trp missense CD97 1 82496 1.21218E-5 41248 0 1.65041E-5
19-14499523-G-A p.Arg28Gln missense CD97 5 82542 6.05752E-5 41271 0 4.37689E-5
19-14499537-A-G p.Asn33Asp missense CD97 52 82634 6.29281E-4 41317 0 0.0147658
19-14499538-ACTC-A p.Ser35del disruptive_inframe_deletion CD97 1 82788 1.2079E-5 41394 0 8.25055E-6
19-14499544-C-T p.Ser35Leu missense CD97 11 82866 1.32744E-4 41433 0 1.59347E-4
19-14499545-G-A p.Ser35Ser synonymous CD97 2 82868 2.41348E-5 41434 0 2.47508E-5
19-14499549-G-A p.Val37Ile missense CD97 2 82920 2.41196E-5 41460 0 3.18878E-5
19-14499553-A-G p.Asn38Ser missense CD97 2 82952 2.41103E-5 41476 0 6.38162E-5
19-14499557-C-T p.Ala39Ala synonymous CD97 1 82962 1.20537E-5 41481 0 8.25096E-6
19-14499560-C-T p.Thr40Thr synonymous CD97 1 82980 1.20511E-5 41490 0 7.95684E-6
19-14499561-G-A p.Ala41Thr missense CD97 219 82964 0.0026397 41482 4 0.00546263
19-14499567-C-T p.Arg43Cys missense CD97 5 83044 6.0209E-5 41522 0 6.25E-4
19-14499613-C-T p.Pro58Leu missense CD97 419 83140 0.00503969 41570 6 0.0104931
19-14499614-G-C p.Pro58Pro synonymous CD97 1669 81342 0.0205183 40671 65 0.028125
19-14499614-GAC-CAT p.ProThr58ProMet missense CD97 2 83154 2.40518E-5 41577 0 NA
19-14499614-G-A p.Pro58Pro synonymous CD97 9 83152 1.08236E-4 41576 0 3.70822E-5
19-14499616-C-T p.Thr59Met missense CD97 1701 81396 0.0208978 40698 69 0.028125
19-14499629-C-T p.Asp63Asp splice_region+synonymous CD97 4 83144 4.81093E-5 41572 0 0.00100705
19-14499635-A-G c.190+5A>G splice_region CD97 2 83136 2.4057E-5 41568 0 NA
19-14499636-G-C c.190+6G>C splice_region CD97 2 83122 2.4061E-5 41561 0 3.98143E-6
19-14501728-T-C c.191-8T>C splice_region CD97 1 83240 1.20135E-5 41620 0 NA
19-14501739-TCAA-T p.Asn66del conservative_inframe_deletion CD97 4 83286 4.80273E-5 41643 0 4.26985E-5
19-14501739-T-C p.Ile65Thr missense CD97 1 83284 1.20071E-5 41642 0 NA
19-14501744-G-A p.Glu67Lys missense CD97 2 83320 2.40038E-5 41660 0 3.18431E-5
19-14501757-C-T p.Pro71Leu missense CD97 6 83346 7.19891E-5 41673 0 8.3102E-5
19-14501758-G-A p.Pro71Pro synonymous CD97 4 83346 4.79927E-5 41673 0 2.49041E-5
19-14501760-C-G p.Ser72Trp missense CD97 1 83346 1.19982E-5 41673 0 NA
19-14501761-G-A p.Ser72Ser synonymous CD97 2 83360 2.39923E-5 41680 0 6.36943E-5
19-14501773-C-T p.Cys76Cys synonymous CD97 4 83382 4.7972E-5 41691 0 1.59236E-4
19-14501780-T-C p.Phe79Leu missense CD97 1 83388 1.19921E-5 41694 0 3.18634E-5
19-14501785-G-A p.Ser80Ser synonymous CD97 1 83394 1.19913E-5 41697 0 3.18532E-5
19-14501787-A-G p.Asp81Gly missense CD97 1 83398 1.19907E-5 41699 0 NA
19-14501801-G-A p.Glu86Lys missense CD97 1 83410 1.1989E-5 41705 0 NA
19-14501808-G-T p.Ser88Ile missense CD97 1 83412 1.19887E-5 41706 0 NA
19-14501812-C-T p.Tyr89Tyr synonymous CD97 1 83408 1.19893E-5 41704 0 3.57878E-5
19-14501813-G-A p.Asp90Asn missense CD97 3 83408 3.59678E-5 41704 0 3.29489E-5
19-14501818-C-T p.Cys91Cys synonymous CD97 3 83410 3.59669E-5 41705 0 2.78348E-5
19-14501821-G-A p.Val92Val synonymous CD97 2 83412 2.39774E-5 41706 0 7.95279E-6
19-14501829-C-T p.Pro95Leu missense CD97 6 83414 7.19304E-5 41707 0 9.88419E-5
19-14501830-G-A p.Pro95Pro synonymous CD97 5 83416 5.99405E-5 41708 0 6.36862E-5
19-14501847-C-T p.Ser101Phe missense CD97 1 83424 1.1987E-5 41712 0 8.23669E-6
19-14501852-G-C p.Ala103Pro missense CD97 25 83424 2.99674E-4 41712 0 3.29468E-5
19-14501853-C-T p.Ala103Val missense CD97 4 83424 4.79478E-5 41712 0 3.18817E-5
19-14501872-G-A p.Glu109Glu synonymous CD97 2 83412 2.39774E-5 41706 0 3.1837E-5
19-14501875-C-T p.Ser110Ser synonymous CD97 1 83408 1.19893E-5 41704 0 2.78365E-5
19-14501876-G-A p.Glu111Lys missense CD97 1 83402 1.19901E-5 41701 0 NA
19-14501881-C-T p.Asn112Asn synonymous CD97 1 83408 1.19893E-5 41704 0 8.239E-6
19-14501891-G-GAT p.Gly116fs frameshift CD97 2 83402 2.39802E-5 41701 0 NA
19-14501894-A-G p.Lys117Glu missense CD97 1 83388 1.19921E-5 41694 0 NA
19-14501908-G-A p.Thr121Thr synonymous CD97 3 83352 3.59919E-5 41676 0 9.95183E-5
19-14501911-C-A p.Ser122Ser synonymous CD97 1 83344 1.19985E-5 41672 0 NA
19-14501931-G-A p.Arg129Lys missense CD97 1 83266 1.20097E-5 41633 0 NA
19-14501935-TGG-T p.Val132fs frameshift CD97 3 83258 3.60326E-5 41629 0 1.99572E-5
19-14501940-T-TGAC p.Val132_Thr133insThr disruptive_inframe_insertion CD97 3 83210 3.60534E-5 41605 0 1.99984E-5
19-14501943-C-A p.Thr133Asn missense CD97 1 83202 1.20189E-5 41601 0 3.40015E-5
19-14501970-A-T p.Glu142Val missense CD97 1 83042 1.20421E-5 41521 0 NA
19-14501978-C-T p.Leu145Phe missense CD97 1 82928 1.20587E-5 41464 0 7.90561E-5
19-14501986-T-C p.Cys147Cys synonymous CD97 1 82734 1.20869E-5 41367 0 NA
19-14501995-T-C p.Ser150Ser synonymous CD97 1 82430 1.21315E-5 41215 0 NA
19-14501998-C-A p.Ala151Ala synonymous CD97 1 82306 1.21498E-5 41153 0 NA
19-14502002-C-T p.Arg153Cys missense CD97 2 82006 2.43885E-5 41003 0 5.52692E-5
19-14502003-G-A p.Arg153His missense CD97 5 81972 6.09964E-5 40986 0 1.65453E-4
19-14502008-A-G p.???155??? splice_region+synonymous CD97 1 81680 1.22429E-5 40840 0 NA
19-14502243-G-C p.Arg129Ser missense CD97 1 5456 1.83284E-4 2728 0 6.20771E-5
19-14502266-A-G p.Asn137Ser missense CD97 3 2634 0.00113895 1317 0 NA
19-14507153-G-T c.347-1G>T splice_acceptor CD97 2 83374 2.39883E-5 41687 0 8.23642E-6
19-14507161-C-T p.Asp118Asp synonymous CD97 25 83364 2.9989E-4 41682 0 0.00125
19-14507162-G-A p.Glu119Lys missense CD97 4 83372 4.79777E-5 41686 0 1.31783E-4
19-14507187-G-C p.Cys127Ser missense CD97 2 83384 2.39854E-5 41692 0 NA
19-14507193-GC-G p.Tyr130fs frameshift CD97 11 83336 1.31996E-4 41668 0 5.10009E-4
19-14507197-C-T p.Tyr130Tyr synonymous CD97 6 83374 7.19649E-5 41687 0 2.5468E-4
19-14507198-G-A p.Gly131Ser missense CD97 12 83374 1.4393E-4 41687 0 1.27348E-4
19-14507201-A-G p.Thr132Ala missense CD97 1 83360 1.19962E-5 41680 0 NA
19-14507206-C-T p.Cys133Cys synonymous CD97 3 83322 3.60049E-5 41661 0 3.82287E-4
19-14507218-T-C p.Leu137Leu synonymous CD97 2 83352 2.39946E-5 41676 0 4.95417E-5
19-14507240-C-G p.Leu145Val missense CD97 4 83404 4.79593E-5 41702 0 1.56497E-4
19-14507242-G-A p.Leu145Leu synonymous CD97 1 83402 1.19901E-5 41701 0 NA
19-14507259-T-C p.Ile151Thr missense CD97 1 83390 1.19918E-5 41695 0 3.97643E-6
19-14507260-A-G p.Ile151Met missense CD97 1 83390 1.19918E-5 41695 0 1.6475E-5
19-14507271-C-T p.Pro155Leu missense CD97 11 83376 1.31932E-4 41688 0 8.7487E-5
19-14507272-G-A p.Pro155Pro synonymous CD97 1 83374 1.19941E-5 41687 0 5.76682E-5
19-14507272-GAAGGTCTGCACAGGTAGAGGCCCCAGGAAGACGCCGTGAGGCTGGACGGGAGCTGGGGATGGAGCTGAGGCACGTCCTCCA-G p.Lys156fs frameshift CD97 1 83374 1.19941E-5 41687 0 NA
19-14507275-G-A p.Lys156Lys synonymous CD97 3 83370 3.59842E-5 41685 0 8.23913E-6
19-14507275-GGT-G p.Val157fs frameshift CD97 1 83370 1.19947E-5 41685 0 NA
19-14507276-G-A p.Val157Ile missense CD97 2 83372 2.39889E-5 41686 0 3.97678E-6
19-14507279-T-A p.Cys158Ser missense CD97 1 83370 1.19947E-5 41685 0 NA
19-14507282-A-C p.Thr159Pro missense CD97 1 83368 1.1995E-5 41684 0 NA
19-14507283-C-G p.Thr159Arg missense+splice_region CD97 1 83364 1.19956E-5 41682 0 NA
19-14507287-T-A c.478+2T>A splice_donor CD97 1 83354 1.1997E-5 41677 0 NA
19-14507288-A-G c.478+3A>G splice_region CD97 3 83354 3.59911E-5 41677 0 8.24022E-6
19-14507292-GCCCC-G c.478+8_478+11delCCCC splice_region CD97 1 83342 1.19988E-5 41671 0 NA
19-14507895-A-G p.Asn162Ser missense CD97 1 82974 1.2052E-5 41487 0 8.29738E-6
19-14507908-C-T p.Ser166Ser synonymous CD97 1 83110 1.20322E-5 41555 0 6.60524E-5
19-14507909-G-A p.Gly167Arg missense CD97 3 83124 3.60907E-5 41562 0 0.001875
19-14507910-G-C p.Gly167Ala missense CD97 1 83122 1.20305E-5 41561 0 NA
19-14507918-C-T p.Pro170Ser missense CD97 3 83180 3.60664E-5 41590 0 6.37267E-5
19-14507919-C-T p.Pro170Leu missense CD97 5 83164 6.01222E-5 41582 0 3.18674E-5
19-14507919-C-G p.Pro170Arg missense CD97 1 83164 1.20244E-5 41582 0 3.97753E-6
19-14507920-G-A p.Pro170Pro synonymous CD97 12 83068 1.4446E-4 41534 0 0.00201613
19-14507922-G-C p.Cys171Ser missense CD97 1 83168 1.20239E-5 41584 0 1.64859E-5
19-14507949-A-G p.Asn180Ser missense CD97 10 83126 1.20299E-4 41563 0 1.91363E-4
19-14507950-C-T p.Asn180Asn synonymous CD97 2 83118 2.40622E-5 41559 0 3.18674E-5
19-14507950-CGTG-C p.Val181del disruptive_inframe_deletion CD97 3 83118 3.60933E-5 41559 0 8.24049E-6
19-14507951-G-C p.Val181Leu missense CD97 13 83114 1.56412E-4 41557 0 6.36294E-5
19-14507951-G-T p.Val181Leu missense CD97 1 83116 1.20314E-5 41558 0 7.95368E-6
19-14507958-G-T p.Ser183Ile missense CD97 1 83108 1.20325E-5 41554 0 NA
19-14507969-C-T p.Arg187Cys missense CD97 10 83088 1.20354E-4 41544 0 1.9118E-4
19-14507974-C-T p.Cys188Cys synonymous CD97 1 83088 1.20354E-5 41544 0 3.97741E-6
19-14507975-C-T p.Arg189Cys missense CD97 4 83080 4.81464E-5 41540 0 1.27453E-4
19-14507976-G-A p.Arg189His missense CD97 61 83062 7.34391E-4 41531 0 8.6075E-4
19-14507979-C-T p.Pro190Leu missense CD97 2 83098 2.4068E-5 41549 0 4.37522E-5
19-14507979-CG-C p.Gly191fs frameshift CD97 1 83098 1.2034E-5 41549 0 3.97747E-6
19-14507980-G-A p.Pro190Pro synonymous CD97 62 83092 7.46161E-4 41546 0 0.00453172
19-14507982-G-A p.Gly191Asp missense CD97 1 83098 1.2034E-5 41549 0 8.24253E-6
19-14507989-A-G p.Gln193Gln synonymous CD97 1 83158 1.20253E-5 41579 0 8.24226E-6
19-14507990-C-G p.Pro194Ala missense CD97 2 83158 2.40506E-5 41579 0 3.97785E-6
19-14507991-C-T p.Pro194Leu missense CD97 5 83174 6.01149E-5 41587 0 6.37552E-5
19-14507992-G-A p.Pro194Pro synonymous CD97 1 83186 1.20213E-5 41593 0 8.24198E-6
19-14507998-G-A p.Pro196Pro synonymous CD97 1 83228 1.20152E-5 41614 0 4.37787E-5
19-14508006-C-T p.Pro199Leu missense CD97 1 83232 1.20146E-5 41616 0 NA
19-14508009-A-G p.Asn200Ser missense CD97 11 83250 1.32132E-4 41625 0 3.18756E-4
19-14508011-G-A p.Gly201Ser missense CD97 1 83248 1.20123E-5 41624 0 5.17187E-5
19-14508012-GC-G p.Pro202fs frameshift CD97 1 83240 1.20135E-5 41620 0 NA
19-14508025-C-T p.Thr205Thr synonymous CD97 6 83288 7.20392E-5 41644 0 7.41852E-5
19-14508026-G-A p.Val206Ile missense CD97 5 83290 6.00312E-5 41645 0 6.37389E-5
19-14508038-C-G c.625+3C>G splice_region CD97 17 83326 2.04018E-4 41663 0 6.37511E-4
19-14508039-G-A c.625+4G>A splice_region CD97 1 83318 1.20022E-5 41659 0 3.18837E-5
19-14508478-G-A p.Glu212Lys missense CD97 1 52796 1.89408E-5 26398 0 2.29727E-5
19-14508489-C-T p.Ser215Ser synonymous CD97 23 53344 4.31164E-4 26672 0 0.00379368
19-14508495-G-A p.Gln217Gln synonymous CD97 1 55090 1.81521E-5 27545 0 2.06635E-4
19-14508495-G-C p.Gln217His missense CD97 1 55092 1.81515E-5 27546 0 NA
19-14508496-C-A p.His218Asn missense CD97 1 55398 1.80512E-5 27699 0 2.06332E-4
19-14508516-C-T p.Thr224Thr synonymous CD97 2 58594 3.41332E-5 29297 0 6.41171E-4
19-14508529-A-G p.Thr229Ala missense CD97 1 60250 1.65975E-5 30125 0 1.29705E-5
19-14508531-C-A p.Thr229Thr synonymous CD97 5 60384 8.28034E-5 30192 0 0.003386
19-14508531-C-T p.Thr229Thr synonymous CD97 1 60398 1.65568E-5 30199 0 6.33714E-4
19-14508550-C-T p.Arg236Cys missense CD97 1 61392 1.62888E-5 30696 0 1.33274E-4
19-14508551-G-A p.Arg236His missense CD97 1 61276 1.63196E-5 30638 0 1.57664E-5
19-14508552-C-T p.Arg236Arg synonymous CD97 2 61498 3.25214E-5 30749 0 NA
19-14508557-G-A p.Arg238His missense CD97 2 60724 3.29359E-5 30362 0 5.855E-4
19-14508580-G-A p.Gly246Arg missense CD97 2 58550 3.41588E-5 29275 0 9.80008E-5
19-14508588-G-A p.Pro248Pro synonymous CD97 1 56724 1.76292E-5 28362 0 1.22997E-5
19-14508598-A-G p.Lys252Glu missense CD97 3 54498 5.50479E-5 27249 1 1.29166E-4
19-14508614-AAGGTATGACCTGGCCCTAGAAGCTCCCCACCCCCAGCACACACACTGACAAGCGGCCTAATGAGCCGCTTGTCTTGTTCCCTAC-A c.772+1_773-1delGTATGACCTGGCCCTAGAAGCTCCCCACCCCCAGCACACACACTGACAAGCGGCCTAATGAGCCGCTTGTCTTGTTCCCTACAG splice_acceptor CD97 12 50664 2.36855E-4 25332 6 NA
19-14508703-A-G p.Met259Val missense+splice_region CD97 1 58574 1.70724E-5 29287 0 NA
19-14508711-C-G p.Phe261Leu missense CD97 1 61820 1.6176E-5 30910 0 NA
19-14508725-C-T p.Pro266Leu missense CD97 1 66944 1.49379E-5 33472 0 2.63491E-5
19-14508726-G-A p.Pro156Pro splice_region+synonymous CD97 1 67074 1.49089E-5 33537 0 7.22543E-4
19-14508727-C-A p.Pro267Thr missense CD97 1 67632 1.47859E-5 33816 0 2.61301E-5
19-14508732-T-G p.Pro268Pro synonymous CD97 8 69568 1.14995E-4 34784 0 8.63111E-5
19-14508746-A-T p.Gln273Leu missense+splice_region CD97 2 72514 2.75809E-5 36257 0 1.48854E-4
19-14508782-CTCCA-C n.478_481delTCCA splice_region CD97 1 78772 1.26949E-5 39386 0 NA
19-14508868-C-T c.820-6C>T splice_region CD97 2 83180 2.40442E-5 41590 0 NA
19-14508871-C-A c.820-3C>A splice_region CD97 1 83182 1.20218E-5 41591 0 3.97674E-6
19-14508875-C-T p.Thr274Met missense+splice_region CD97 12 83210 1.44213E-4 41605 0 8.24076E-5
19-14508876-G-A p.Thr274Thr splice_region+synonymous CD97 1 83200 1.20192E-5 41600 0 7.95342E-6
19-14508884-G-A p.Arg277Gln missense CD97 4 83228 4.80607E-5 41614 0 3.1953E-5
19-14508891-C-T p.Phe279Phe synonymous CD97 6 83262 7.20617E-5 41631 0 2.23457E-4
19-14508892-G-A p.Asp280Asn missense CD97 1 83252 1.20117E-5 41626 0 3.19142E-5
19-14508893-A-G p.Asp280Gly missense CD97 6 83266 7.20582E-5 41633 0 0.00100705
19-14508906-C-T p.Asp284Asp synonymous CD97 2 83298 2.40102E-5 41649 0 1.40038E-4
19-14508907-C-G p.Leu285Val missense CD97 1 83308 1.20036E-5 41654 0 3.18756E-5
19-14508919-T-A p.Ser289Thr missense CD97 2 83320 2.40038E-5 41660 0 1.15325E-4
19-14508920-C-A p.Ser289Tyr missense CD97 1 83308 1.20036E-5 41654 0 3.57878E-5
19-14508932-C-T p.Ser293Leu missense CD97 1 83318 1.20022E-5 41659 0 3.18593E-5
19-14508936-C-T p.Ala294Ala synonymous CD97 1 83300 1.20048E-5 41650 0 1.98839E-5
19-14508937-G-A p.Glu295Lys missense CD97 1 83302 1.20045E-5 41651 0 5.03525E-4
19-14509079-C-T n.409C>T splice_region CD97 1 66610 1.50128E-5 33305 0 3.18878E-5
19-14512191-C-T c.898-7C>T splice_region CD97 1 82756 1.20837E-5 41378 0 1.20324E-5
19-14512193-C-T c.898-5C>T splice_region CD97 1 82792 1.20785E-5 41396 0 1.60045E-5
19-14512224-G-A p.Leu308Leu synonymous CD97 16 83242 1.92211E-4 41621 0 3.82141E-4
19-14512240-G-A p.Asp314Asn missense CD97 1 83270 1.20091E-5 41635 0 NA
19-14512242-C-T p.Asp314Asp synonymous CD97 2 83266 2.40194E-5 41633 0 5.03525E-4
19-14512243-G-A p.Val315Ile missense CD97 2 83272 2.40177E-5 41636 0 NA
19-14512246-G-A p.Glu316Lys missense CD97 2 83296 2.40108E-5 41648 0 8.25573E-6
19-14512248-G-A p.Glu316Glu synonymous CD97 3 83306 3.60118E-5 41653 1 NA
19-14512251-C-T p.Ala317Ala synonymous CD97 1 83304 1.20042E-5 41652 0 NA
19-14512253-T-G p.Leu318Arg missense CD97 1 83298 1.20051E-5 41649 0 NA
19-14512256-C-T p.Ala319Val missense CD97 458 83288 0.00549899 41644 11 0.0124562
19-14512257-G-A p.Ala319Ala synonymous CD97 1 83298 1.20051E-5 41649 0 3.18471E-5
19-14512260-A-T p.Pro320Pro synonymous CD97 398 83300 0.00477791 41650 10 0.0104552
19-14512269-G-C p.Arg323Arg synonymous CD97 1 83296 1.20054E-5 41648 0 NA
19-14512276-A-T p.Ile326Leu missense CD97 1 83324 1.20013E-5 41662 0 2.23001E-4
19-14512278-A-G p.Ile326Met missense CD97 1 83326 1.20011E-5 41663 0 NA
19-14512293-C-G p.Leu331Leu synonymous CD97 1 83340 1.1999E-5 41670 0 3.18431E-5
19-14512302-T-A p.Leu334Leu synonymous CD97 4 83350 4.79904E-5 41675 0 3.97697E-6
19-14512302-T-G p.Leu334Leu synonymous CD97 1 83350 1.19976E-5 41675 0 3.29576E-5
19-14512317-G-A p.Arg339Arg synonymous CD97 1 83332 1.20002E-5 41666 0 NA
19-14512331-G-A p.Ser344Asn missense CD97 2 83338 2.39987E-5 41669 0 5.17059E-5
19-14512332-C-T p.Ser344Ser synonymous CD97 10 83326 1.20011E-4 41663 0 6.25E-4
19-14512343-G-A p.Gly348Asp missense CD97 14 83308 1.68051E-4 41654 0 3.05185E-4
19-14512352-C-T p.Thr351Ile missense CD97 2 83316 2.4005E-5 41658 0 NA
19-14512363-C-T p.Pro355Ser missense CD97 1 83300 1.20048E-5 41650 0 NA
19-14512367-C-T p.Ser356Leu missense CD97 7 83272 8.40619E-5 41636 0 6.25E-4
19-14512372-ACAGGTGAGGCCTTGGCCTGGCCTGCCCTGCCCCAACCCTGGGCCCCACCTGGTACCTGGGGTCCCTAATCACAACTGCCCCTCTCCCCT-A p.Thr358_Glu359delinsLys splice_donor CD97 15 83262 1.80154E-4 41631 7 NA
19-14512376-G-A c.1075+1G>A splice_donor CD97 2 83246 2.40252E-5 41623 1 NA
19-14512383-C-T c.1075+8C>T splice_region CD97 2 83200 2.40385E-5 41600 0 NA
19-14512461-T-G c.1076-4T>G splice_region CD97 1 83140 1.20279E-5 41570 0 NA
19-14512488-C-T p.Arg367Trp missense CD97 222 83152 0.00266981 41576 4 0.00656553
19-14512489-G-A p.Arg367Gln missense CD97 11485 82888 0.13856 41444 943 0.19875
19-14512489-G-C p.Arg367Pro missense CD97 20 83160 2.405E-4 41580 0 6.06138E-4
19-14512502-C-T p.Asn371Asn synonymous CD97 616 83124 0.00741062 41562 5 0.0150143
19-14512502-C-G p.Asn371Lys missense CD97 1 83146 1.2027E-5 41573 0 NA
19-14512503-G-A p.Val372Ile missense CD97 2 83142 2.40552E-5 41571 0 3.18695E-5
19-14512508-T-C p.Thr373Thr synonymous CD97 1 83140 1.20279E-5 41570 0 NA
19-14512517-G-A p.Gln376Gln synonymous CD97 1 83136 1.20285E-5 41568 0 2.19118E-5
19-14512519-G-A p.Ser377Asn missense CD97 1 83132 1.20291E-5 41566 0 NA
19-14512520-C-G p.Ser377Arg missense CD97 5 83130 6.01468E-5 41565 0 2.67568E-5
19-14512523-C-T p.Ser378Ser synonymous CD97 1 83110 1.20322E-5 41555 0 0.00125
19-14512524-G-A p.Ala379Thr missense CD97 8 83114 9.62533E-5 41557 0 7.11124E-5
19-14512527-C-T p.Arg380Cys missense CD97 4 83080 4.81464E-5 41540 0 1.36027E-5
19-14512527-C-A p.Arg380Ser missense CD97 1 83080 1.20366E-5 41540 0 NA
19-14512528-G-A p.Arg380His missense CD97 2 83084 2.4072E-5 41542 0 3.18634E-5
19-14512530-A-G p.Met381Val missense CD97 19 83070 2.28723E-4 41535 0 2.5481E-4
19-14512546-C-T p.Ala386Val missense CD97 1 82982 1.20508E-5 41491 0 1.82455E-5
19-14512551-G-T p.Ala388Ser missense CD97 3 82938 3.61716E-5 41469 0 2.75877E-5
19-14512563-G-A p.Glu392Lys missense CD97 11 82728 1.32966E-4 41364 0 5.09749E-4
19-14512567-A-G p.Asp393Gly missense CD97 1 82680 1.20948E-5 41340 0 NA
19-14512580-C-T c.1183+8C>T splice_region CD97 17 82386 2.06346E-4 41193 0 3.8258E-4
19-14513405-C-G c.1184-4C>G splice_region CD97 1 82846 1.20706E-5 41423 0 NA
19-14513413-C-T p.Pro396Pro synonymous CD97 88 82896 0.00106157 41448 0 7.22053E-4
19-14513414-G-A p.Ala397Thr missense CD97 1 82908 1.20616E-5 41454 0 NA
19-14513417-G-A p.Val398Met missense CD97 1 82898 1.2063E-5 41449 0 NA
19-14513422-G-A p.Ala399Ala synonymous CD97 4 82962 4.82148E-5 41481 0 6.25E-4
19-14513429-C-T p.Leu402Phe missense CD97 2 83010 2.40935E-5 41505 0 1.19498E-5
19-14513431-C-T p.Leu402Leu synonymous CD97 1 83022 1.2045E-5 41511 0 NA
19-14513446-G-A p.Met407Ile missense CD97 1 83194 1.20201E-5 41597 0 1.27641E-4
19-14513448-C-T p.Thr408Met missense CD97 1 83200 1.20192E-5 41600 0 8.75253E-5
19-14513449-G-A p.Thr408Thr synonymous CD97 1 83182 1.20218E-5 41591 0 4.11834E-5
19-14513455-G-A p.Leu410Leu synonymous CD97 2 83254 2.40229E-5 41627 0 3.57933E-5
19-14513459-G-C p.Ala412Pro missense CD97 2 83266 2.40194E-5 41633 0 1.19312E-5
19-14513469-C-A p.Ser415Tyr missense CD97 1 83326 1.20011E-5 41663 0 NA
19-14513474-A-G p.Asn417Asp missense CD97 1 83348 1.19979E-5 41674 0 NA
19-14513497-C-G p.Ala424Ala synonymous CD97 1 83384 1.19927E-5 41692 0 NA
19-14513497-C-T p.Ala424Ala synonymous CD97 1 83384 1.19927E-5 41692 0 7.95248E-6
19-14513502-TGGA-T p.Glu428del conservative_inframe_deletion CD97 1 83392 1.19916E-5 41696 0 4.77149E-5
19-14513510-A-T p.Ile429Leu missense CD97 2 83408 2.39785E-5 41704 0 7.15723E-5
19-14513511-T-C p.Ile429Thr missense CD97 1 83412 1.19887E-5 41706 0 8.23655E-6
19-14513512-A-G p.Ile429Met missense CD97 1 83410 1.1989E-5 41705 0 3.97624E-6
19-14513528-C-T p.Arg435Cys missense CD97 8 83404 9.59187E-5 41702 0 9.94083E-5
19-14513529-G-A p.Arg435His missense CD97 3 83406 3.59686E-5 41703 0 9.55718E-5
19-14513544-G-A p.Arg440Lys missense CD97 2 83410 2.39779E-5 41705 0 3.18532E-5
19-14513547-G-A p.Arg441His missense CD97 1 83408 1.19893E-5 41704 0 2.47097E-5
19-14513557-C-G p.Ala444Ala synonymous CD97 5 83404 5.99492E-5 41702 0 0.00125078
19-14513557-C-T p.Ala444Ala synonymous CD97 5 83404 5.99492E-5 41702 0 6.25782E-4
19-14513558-G-A p.Val445Ile missense CD97 1 83404 1.19898E-5 41702 0 6.25E-4
19-14513579-CACA-C p.Asn454del disruptive_inframe_deletion CD97 3 83394 3.59738E-5 41697 0 3.18613E-5
19-14513583-AC-A p.Asn453fs frameshift CD97 2 83400 2.39808E-5 41700 0 NA
19-14513586-A-C p.Asn454Thr missense CD97 23 83396 2.75793E-4 41698 0 6.25E-4
19-14513606-C-T p.Pro461Ser missense CD97 4 83386 4.79697E-5 41693 0 4.37417E-5
19-14513608-C-T p.Pro461Pro synonymous CD97 1 83382 1.1993E-5 41691 0 NA
19-14513616-T-C p.Phe464Ser missense CD97 2 83364 2.39912E-5 41682 0 2.47166E-5
19-14513617-C-T p.Phe464Phe synonymous CD97 1 83366 1.19953E-5 41683 0 3.18857E-5
19-14513618-G-A p.Ala465Thr missense CD97 2 83356 2.39935E-5 41678 0 3.1904E-5
19-14513637-C-T p.Ser471Phe missense CD97 1 83320 1.20019E-5 41660 0 NA
19-14513640-C-T p.Ser472Phe missense CD97 1 83300 1.20048E-5 41650 0 6.76197E-5
19-14513642-G-A p.Asp473Asn missense CD97 2 83278 2.40159E-5 41639 0 4.94739E-5
19-14513642-G-T p.Asp473Tyr missense CD97 3 83278 3.60239E-5 41639 0 NA
19-14513652-C-A p.Ala476Glu missense CD97 1 83192 1.20204E-5 41596 0 NA
19-14513653-G-A p.Ala476Ala synonymous CD97 1 83186 1.20213E-5 41593 0 5.03525E-4
19-14513662-C-T p.Asp479Asp synonymous CD97 1 83104 1.20331E-5 41552 0 NA
19-14513666-C-T p.Pro481Ser missense CD97 1 83106 1.20328E-5 41553 0 NA
19-14513674-G-A p.Lys483Lys splice_region+synonymous CD97 2 83018 2.40912E-5 41509 0 NA
19-14513675-G-GACGTGA c.1449+1_1449+2insACGTGA splice_donor CD97 1 83014 1.20462E-5 41507 0 NA
19-14513676-TCTCTGCTCA-T c.1449+3_1449+11delCTCTGCTCA splice_region CD97 1 82982 1.20508E-5 41491 0 3.19591E-5
19-14515197-C-T p.Asp484Asp splice_region+synonymous CD97 2 81478 2.45465E-5 40739 0 3.67302E-5
19-14515198-G-A p.Val485Met missense CD97 27 81556 3.31061E-4 40778 0 6.05057E-4
19-14515204-C-T p.Pro487Ser missense CD97 2 81672 2.44882E-5 40836 0 6.36983E-5
19-14515207-G-T p.Gly488Trp missense CD97 1 81798 1.22252E-5 40899 0 NA
19-14515211-C-A p.Pro489Gln missense CD97 1 81810 1.22234E-5 40905 0 9.55597E-5
19-14515213-C-T p.Arg490Trp missense CD97 18 81810 2.20022E-4 40905 0 6.25E-4
19-14515214-G-A p.Arg490Gln missense CD97 1 81838 1.22193E-5 40919 0 1.62307E-5
19-14515217-A-C p.Gln491Pro missense CD97 2 81940 2.44081E-5 40970 0 NA
19-14515233-C-A p.Ala496Ala synonymous CD97 6 82196 7.29963E-5 41098 0 5.01094E-5
19-14515242-G-C p.Lys499Asn missense CD97 1 82242 1.21592E-5 41121 0 NA
19-14515251-C-T p.Ser502Ser synonymous CD97 4 82198 4.8663E-5 41099 0 0.00100908
19-14515252-G-A p.Asp503Asn missense CD97 12 82268 1.45865E-4 41134 0 1.91144E-4
19-14515254-C-G p.Asp503Glu missense CD97 1 82264 1.2156E-5 41132 0 NA
19-14515254-CAG-C p.Arg504fs frameshift CD97 3 82264 3.6468E-5 41132 0 8.31684E-6
19-14515261-G-C p.Gly506Arg missense CD97 3 82388 3.64131E-5 41194 0 3.18532E-5
19-14515269-G-A p.Trp508* stop_gained CD97 2 82408 2.42695E-5 41204 0 3.18796E-5
19-14515275-C-T p.Thr510Thr synonymous CD97 1 82328 1.21465E-5 41164 0 6.25E-4
19-14515276-G-A p.Glu511Lys missense CD97 1 82354 1.21427E-5 41177 0 3.61405E-5
19-14515288-G-GTGC p.Leu516dup conservative_inframe_insertion CD97 6 82504 7.27237E-5 41252 0 2.54777E-4
19-14515299-C-G p.Ser518Arg missense CD97 2 82514 2.42383E-5 41257 0 2.49211E-5
19-14515305-C-T p.Asn520Asn synonymous CD97 1 82452 1.21283E-5 41226 0 5.85343E-5
19-14515323-A-G p.Gln526Gln synonymous CD97 1 82974 1.2052E-5 41487 0 1.65503E-5
19-14515328-G-A p.Ser528Asn missense CD97 1 83000 1.20482E-5 41500 0 2.40381E-5
19-14515354-A-G p.Met537Val missense CD97 1 82896 1.20633E-5 41448 0 NA
19-14515360-C-T p.His539Tyr missense CD97 6 82840 7.24288E-5 41420 0 6.37105E-5
19-14515360-CATT-C p.Tyr540del conservative_inframe_deletion CD97 1 82840 1.20715E-5 41420 0 NA
19-14515368-C-T p.Asp541Asp synonymous CD97 451 82674 0.00545516 41337 4 0.0066242
19-14515369-G-A p.Val542Met missense CD97 3 82650 3.62976E-5 41325 0 6.36902E-5
19-14515373-A-C p.Glu543Ala missense+splice_region CD97 1 82582 1.21092E-5 41291 0 4.03112E-6
19-14515375-GT-G c.1629+2delT splice_donor CD97 1 82558 1.21127E-5 41279 0 NA
19-14516582-C-G p.Thr551Ser missense CD97 2 80454 2.48589E-5 40227 0 8.34014E-6
19-14516591-G-A p.Gly554Glu missense CD97 2 80550 2.48293E-5 40275 0 3.98921E-5
19-14516597-C-T p.Ala556Val missense CD97 1 80632 1.2402E-5 40316 0 3.9896E-6
19-14516600-T-C p.Leu557Pro missense CD97 4 80868 4.94633E-5 40434 0 6.37349E-5
19-14516607-C-T p.Leu559Leu synonymous CD97 2 81094 2.46627E-5 40547 0 8.27198E-6
19-14516643-G-A p.Leu571Leu synonymous CD97 4 81828 4.8883E-5 40914 0 1.99397E-5
19-14516655-C-G p.Ile575Met missense CD97 1 81960 1.22011E-5 40980 0 NA
19-14516666-G-A p.Arg579His missense CD97 2 81698 2.44804E-5 40849 0 8.27527E-5
19-14516667-C-G p.Arg579Arg synonymous CD97 2 81774 2.44577E-5 40887 0 NA
19-14516668-A-T p.Thr580Ser missense CD97 2 81794 2.44517E-5 40897 0 NA
19-14516675-T-C p.Ile582Thr missense CD97 1 81824 1.22214E-5 40912 0 NA
19-14516676-A-G p.Ile582Met missense CD97 2 81808 2.44475E-5 40904 0 3.19183E-5
19-14516682-G-C p.Leu584Leu synonymous CD97 1 81814 1.22228E-5 40907 0 NA
19-14516685-C-A p.His585Gln missense CD97 1 81854 1.22169E-5 40927 0 4.00048E-6
19-14516685-C-T p.His585His synonymous CD97 31 81854 3.78723E-4 40927 0 8.28659E-4
19-14516692-A-G p.Ile588Val missense CD97 2 81822 2.44433E-5 40911 0 9.95933E-5
19-14516704-G-C p.Val592Leu missense CD97 25 81496 3.06764E-4 40748 0 6.75057E-4
19-14516709-C-G p.Gly593Gly synonymous CD97 1 81426 1.22811E-5 40713 0 NA
19-14516716-A-G p.Ile596Val missense CD97 1 81300 1.23001E-5 40650 0 5.23383E-5
19-14516728-G-C p.Gly600Arg missense CD97 1 80550 1.24146E-5 40275 0 3.18695E-5
19-14516732-T-C p.Ile601Thr missense CD97 2 80288 2.49103E-5 40144 0 NA
19-14516734-G-A p.Glu602Lys missense CD97 1 80048 1.24925E-5 40024 0 8.55534E-6
19-14516735-A-C p.Glu602Ala missense CD97 4 80008 4.9995E-5 40004 0 9.56755E-5
19-14516750-A-G p.Gln607Arg missense+splice_region CD97 1 77514 1.29009E-5 38757 0 NA
19-14516757-G-A c.1821+6G>A splice_region CD97 852 76152 0.0111882 38076 6 0.0139733
19-14516758-T-C c.1821+7T>C splice_region CD97 1 75820 1.31891E-5 37910 0 NA
19-14517139-GC-TT c.1822-4_1822-3delGCinsTT splice_region CD97 1 66656 1.50024E-5 33328 0 NA
19-14517144-T-A p.Val608Glu missense+splice_region CD97 1 67992 1.47076E-5 33996 0 NA
19-14517147-G-C p.Gly609Ala missense CD97 1 68810 1.45328E-5 34405 0 5.81571E-6
19-14517151-G-A p.Leu610Leu synonymous CD97 1 69658 1.43559E-5 34829 0 NA
19-14517152-C-G p.Arg611Gly missense CD97 1 69694 1.43484E-5 34847 0 NA
19-14517169-C-T p.Ala616Ala synonymous CD97 1 73204 1.36605E-5 36602 0 5.21012E-6
19-14517171-G-A p.Gly617Glu missense CD97 1 73604 1.35862E-5 36802 0 5.15379E-6
19-14517172-G-A p.Gly617Gly synonymous CD97 2 73834 2.70878E-5 36917 0 3.43784E-5
19-14517173-C-T p.Leu618Leu synonymous CD97 2 73910 2.70599E-5 36955 0 NA
19-14517181-C-G p.His620Gln missense CD97 1 75516 1.32422E-5 37758 0 NA
19-14517184-C-G p.Tyr621* stop_gained CD97 1 75890 1.3177E-5 37945 0 NA
19-14517193-G-A p.Leu624Leu synonymous CD97 3 76574 3.91778E-5 38287 0 2.83688E-5
19-14517195-C-A p.Ala625Asp missense CD97 1 76706 1.30368E-5 38353 0 6.37552E-5
19-14517196-C-T p.Ala625Ala synonymous CD97 1 76774 1.30252E-5 38387 0 NA
19-14517196-C-A p.Ala625Ala synonymous CD97 1 76774 1.30252E-5 38387 0 0.00307377
19-14517198-CCTT-C p.Phe627del disruptive_inframe_deletion CD97 2 77278 2.58806E-5 38639 0 4.7217E-6
19-14517199-C-T p.Ala626Ala synonymous CD97 1 77542 1.28962E-5 38771 0 1.06866E-4
19-14517201-TCTG-T p.Cys628del disruptive_inframe_deletion CD97 2 77720 2.57334E-5 38860 0 NA
19-14517201-T-C p.Phe627Ser missense CD97 2 77720 2.57334E-5 38860 0 4.66087E-6
19-14517207-G-A p.Trp629* stop_gained CD97 1 78664 1.27123E-5 39332 0 NA
19-14517211-G-T p.Met630Ile missense CD97 3 78940 3.80035E-5 39470 0 3.18674E-5
19-14517213-G-A p.Ser631Asn missense CD97 103 79056 0.00130287 39528 2 0.00457782
19-14517213-G-C p.Ser631Thr missense CD97 3 79060 3.79459E-5 39530 0 NA
19-14517217-C-T p.Leu632Leu synonymous CD97 2 79342 2.52073E-5 39671 0 2.52092E-5
19-14517217-C-G p.Leu632Leu synonymous CD97 1 79342 1.26037E-5 39671 0 NA
19-14517226-G-A p.Leu635Leu synonymous CD97 424 79850 0.00530996 39925 4 0.0113101
19-14517227-G-A p.Glu636Lys missense CD97 1 79928 1.25113E-5 39964 0 NA
19-14517229-G-T p.Glu636Asp missense CD97 3 79996 3.75019E-5 39998 0 6.37105E-5
19-14517233-T-C p.Tyr638His missense CD97 1 80152 1.24763E-5 40076 0 NA
19-14517238-T-C p.Phe639Phe synonymous CD97 3 80280 3.73692E-5 40140 0 2.54531E-5
19-14517241-TGTG-T p.Val642del conservative_inframe_deletion CD97 1 80318 1.24505E-5 40159 0 NA
19-14517244-G-T p.Val641Val synonymous CD97 2 80378 2.48824E-5 40189 0 NA
19-14517273-G-T p.Ser651Ile missense CD97 1 81002 1.23454E-5 40501 0 NA
19-14517295-C-G p.Ile658Met missense CD97 3 81142 3.69722E-5 40571 0 7.07114E-5
19-14517296-G-C p.Gly659Arg missense CD97 2 81080 2.4667E-5 40540 0 NA
19-14517302-G-A p.Gly661Ser missense CD97 1 81210 1.23138E-5 40605 0 NA
19-14517317-A-G p.Ile666Val missense CD97 1 81216 1.23128E-5 40608 0 NA
19-14517319-C-G p.Ile666Met missense CD97 280 81130 0.00345125 40565 0 0.00253494
19-14517330-CG-C p.Ala671fs frameshift CD97 1 81012 1.23439E-5 40506 0 NA
19-14517332-G-A p.Ala671Thr missense CD97 2 80966 2.47017E-5 40483 0 3.18512E-5
19-14517333-C-T p.Ala671Val missense CD97 1 81010 1.23442E-5 40505 0 1.09033E-5
19-14517337-C-T p.Ala672Ala synonymous CD97 1 81030 1.23411E-5 40515 0 NA
19-14517339-T-C p.Ile673Thr missense CD97 1 81014 1.23435E-5 40507 0 NA
19-14517341-T-C p.Tyr674His missense CD97 26 81074 3.20695E-4 40537 0 7.96533E-4
19-14517369-A-C p.Tyr683Ser missense+splice_region CD97 1 81296 1.23007E-5 40648 0 NA
19-14517519-T-A p.Leu686Met missense CD97 1 83214 1.20172E-5 41607 0 NA
19-14517519-T-C p.Leu686Leu synonymous CD97 2 83214 2.40344E-5 41607 0 1.64747E-5
19-14517523-A-C p.Asp687Ala missense CD97 1 83206 1.20184E-5 41603 0 5.03525E-4
19-14517524-C-G p.Asp687Glu missense CD97 1 83206 1.20184E-5 41603 0 8.23723E-6
19-14517528-G-C p.Glu689Gln missense CD97 3 83198 3.60586E-5 41599 0 NA
19-14517539-C-T p.Phe692Phe synonymous CD97 1 83204 1.20187E-5 41602 0 NA
19-14517540-C-T p.Leu693Phe missense CD97 1 83216 1.20169E-5 41608 0 5.76616E-5
19-14517547-G-A p.Ser695Asn missense CD97 2 83208 2.40361E-5 41604 0 NA
19-14517561-G-A p.Val700Met missense CD97 5 83200 6.00962E-5 41600 1 8.2375E-6
19-14517565-C-T p.Thr701Ile missense CD97 3 83210 3.60534E-5 41605 0 3.18634E-5
19-14517577-TGGTAAGTACCCACTCTCCCTCCACCGAAGCCCGAGCGCCACAGGCCCAGGCCCGGCTGGACCATCGCTCTCGCCCTCTAACCCACAATCTGCTCCCTGCCCA-T p.Leu705fs frameshift CD97 4 83190 4.80827E-5 41595 0 NA
19-14517585-A-G c.2115+7A>G splice_region CD97 1 83180 1.20221E-5 41590 0 NA
19-14517681-T-G p.Cys706Gly missense+splice_region CD97 3 83246 3.60378E-5 41623 0 8.23764E-6
19-14517686-T-C p.Asn707Asn synonymous CD97 1 83252 1.20117E-5 41626 0 8.23778E-6
19-14517708-G-A p.Val715Ile missense CD97 22 83222 2.64353E-4 41611 0 4.14065E-4
19-14517710-C-G p.Val715Val synonymous CD97 1 83230 1.20149E-5 41615 0 NA
19-14517728-G-A p.Lys721Lys synonymous CD97 665 83168 0.00799586 41584 19 0.0156688
19-14517736-A-G p.Glu724Gly missense CD97 159 83174 0.00191166 41587 0 0.00117849
19-14517745-C-T p.Pro727Leu missense CD97 2 83160 2.405E-5 41580 0 3.18145E-5
19-14517764-G-A p.Lys733Lys synonymous CD97 2 83102 2.40668E-5 41551 0 2.38637E-5
19-14517765-AA-GC p.Lys734Ala missense CD97 1 83082 1.20363E-5 41541 0 NA
19-14517770-GAGGTGAGAGGAGAGGCTGGAAGGACTTGGAGGCGGGGCCGGGGTGAGGGGCATGAAGCTGGAGGTGAGGTGGGGGCCCACGCTGCAACCCCGCTCCTCGC-G p.Arg736fs frameshift CD97 2 83056 2.40801E-5 41528 0 NA
19-14517775-G-A c.2207+3G>A splice_region CD97 1 83062 1.20392E-5 41531 0 3.18451E-5
19-14517849-ACGCTGCAACCCCGCTCCTCGCAGGG-A p.Arg736fs frameshift CD97 2 81918 2.44147E-5 40959 0 3.18512E-5
19-14517868-C-T c.2208-5C>T splice_region CD97 2 81714 2.44756E-5 40857 0 NA
19-14517869-G-A c.2208-4G>A splice_region CD97 12 81560 1.47131E-4 40780 2 1.07422E-4
19-14517875-C-T p.Ala737Val missense+splice_region CD97 81 81284 9.96506E-4 40642 1 0.00267679
19-14517876-G-A p.Ala737Ala synonymous CD97 2 81514 2.45357E-5 40757 0 3.18532E-5
19-14517877-C-A p.Leu738Met missense CD97 1 81580 1.22579E-5 40790 0 NA
19-14517887-C-T p.Thr741Met missense CD97 1 81746 1.2233E-5 40873 0 8.25668E-6
19-14517888-G-A p.Thr741Thr synonymous CD97 6 81710 7.34304E-5 40855 0 3.3024E-5
19-14517894-C-T p.Ile743Ile synonymous CD97 2 81730 2.44708E-5 40865 0 8.256E-6
19-14517897-G-T p.Ala744Ala synonymous CD97 84 81620 0.00102916 40810 0 8.9172E-4
19-14517897-G-A p.Ala744Ala synonymous CD97 40 81620 4.90076E-4 40810 0 8.28025E-4
19-14517908-T-C p.Leu748Pro missense CD97 1 81888 1.22118E-5 40944 0 NA
19-14517920-C-T p.Thr752Ile missense CD97 1 81904 1.22094E-5 40952 0 NA
19-14517927-C-T p.Val754Val synonymous CD97 2 81994 2.4392E-5 40997 0 NA
19-14517930-T-C p.Phe755Phe synonymous CD97 1 82022 1.21919E-5 41011 0 1.65109E-5
19-14517935-T-A p.Leu757Gln missense CD97 1 82058 1.21865E-5 41029 0 8.25559E-6
19-14517942-C-G p.Ile759Met missense CD97 1 82092 1.21815E-5 41046 0 9.90786E-5
19-14517945-C-T p.Phe760Phe synonymous CD97 1 82056 1.21868E-5 41028 0 1.65134E-5
19-14517946-G-A p.Asp761Asn missense CD97 3 82056 3.65604E-5 41028 0 8.25696E-6
19-14517948-C-T p.Asp761Asp synonymous CD97 25 81986 3.0493E-4 40993 0 1.91107E-4
19-14517949-G-A p.Asp762Asn missense CD97 3 81980 3.65943E-5 40990 0 3.18492E-5
19-14517952-C-T p.Arg763Trp missense CD97 1 81966 1.22002E-5 40983 0 3.18512E-5
19-14517953-G-A p.Arg763Gln missense CD97 7 81968 8.53992E-5 40984 0 7.95817E-5
19-14517955-A-C p.Ser764Arg missense CD97 2 81974 2.4398E-5 40987 0 8.259E-6
19-14517957-C-A p.Ser764Arg missense CD97 1 81954 1.2202E-5 40977 0 3.18492E-5
19-14517959-T-G p.Leu765Trp missense CD97 1 82018 1.21924E-5 41009 0 2.78501E-5
19-14517968-C-T p.Thr768Ile missense CD97 1 81922 1.22067E-5 40961 0 NA
19-14517985-C-T p.Leu774Phe missense CD97 1 81576 1.22585E-5 40788 0 NA
19-14517987-C-T p.Leu774Leu synonymous CD97 1 81502 1.22696E-5 40751 0 2.48073E-5
19-14518002-C-T p.Gly779Gly synonymous CD97 3 79910 3.75422E-5 39955 0 1.19558E-5
19-14518003-G-A p.Ala780Thr missense CD97 2 79688 2.50979E-5 39844 0 3.18613E-5
19-14518009-C-T p.Leu782Phe missense CD97 2 79298 2.52213E-5 39649 0 3.98791E-6
19-14518016-T-A p.Leu784Gln missense CD97 1 78388 1.27571E-5 39194 0 3.18512E-5
19-14518019-T-G p.Leu785Arg missense CD97 2 77774 2.57155E-5 38887 0 NA
19-14518044-G-C c.2376+3G>C splice_region CD97 352 72136 0.00487967 36068 3 0.00646538
19-14518047-GGCCTGGGCACAGTGGCGCAC-G c.2376+7_2376+26delGCCTGGGCACAGTGGCGCAC splice_region CD97 8 71036 1.12619E-4 35518 0 1.82852E-4
19-14518714-C-T c.2377-6C>T splice_region CD97 6 82812 7.24533E-5 41406 0 3.20272E-5
19-14518715-G-A c.2377-5G>A splice_region CD97 27 82846 3.25906E-4 41423 0 7.6477E-4
19-14518720-G-A p.Val793Ile missense+splice_region CD97 3 82834 3.6217E-5 41417 0 1.59824E-5
19-14518723-C-T p.Arg794Trp missense CD97 5 82790 6.03938E-5 41395 0 1.53584E-4
19-14518725-G-A p.Arg794Arg synonymous CD97 1 82860 1.20685E-5 41430 0 3.18593E-5
19-14518726-G-C p.Glu795Gln missense CD97 1 82858 1.20688E-5 41429 0 NA
19-14518734-C-T p.Tyr797Tyr synonymous CD97 1 82904 1.20621E-5 41452 0 9.28678E-5
19-14518734-C-A p.Tyr797* stop_gained CD97 1 82904 1.20621E-5 41452 0 NA
19-14518735-C-T p.Arg798Trp missense CD97 4 82918 4.82404E-5 41459 0 6.37227E-5
19-14518735-CG-C p.Lys799fs frameshift CD97 1 82918 1.20601E-5 41459 0 1.68788E-5
19-14518736-G-A p.Arg798Gln missense CD97 2 82936 2.4115E-5 41468 0 3.37359E-5
19-14518750-C-A p.Leu803Ile missense CD97 1 83028 1.20441E-5 41514 0 8.36638E-6
19-14518752-A-C p.Leu803Leu synonymous CD97 7 83014 8.43231E-5 41507 0 8.36064E-6
19-14518753-G-C p.Val804Leu missense CD97 1 83030 1.20438E-5 41515 0 6.25E-4
19-14518758-T-TG p.Ser808fs frameshift CD97 1 83026 1.20444E-5 41513 0 NA
19-14518758-T-TGG p.Ser808fs frameshift CD97 1 83026 1.20444E-5 41513 0 NA
19-14518759-G-A p.Gly806Arg missense CD97 5 83048 6.02061E-5 41524 0 1.66992E-5
19-14518759-G-C p.Gly806Arg missense CD97 3 83048 3.61237E-5 41524 0 1.66992E-5
19-14518760-G-C p.Gly806Ala missense CD97 7 83056 8.42805E-5 41528 0 1.5132E-4
19-14518760-G-T p.Gly806Val missense CD97 1 83056 1.20401E-5 41528 0 NA
19-14518766-G-A p.Ser808Asn missense CD97 3 83026 3.61333E-5 41513 0 NA
19-14518767-C-T p.Ser808Ser synonymous CD97 2 83012 2.40929E-5 41506 0 7.96438E-6
19-14518780-T-A p.Phe813Ile missense CD97 6 83064 7.22335E-5 41532 0 6.37714E-5
19-14518789-A-G p.Thr816Ala missense CD97 2 83030 2.40877E-5 41515 0 NA
19-14518791-C-G p.Thr816Thr synonymous CD97 2 83042 2.40842E-5 41521 1 NA
19-14518792-A-T p.Thr817Ser missense CD97 2 83038 2.40854E-5 41519 0 8.3131E-6
19-14518793-C-T p.Thr817Met missense CD97 1 83048 1.20412E-5 41524 0 3.18796E-5
19-14518794-G-A p.Thr817Thr synonymous CD97 682 83026 0.00821429 41513 18 0.0157526
19-14518811-A-G p.Asn823Ser missense CD97 14 83080 1.68512E-4 41540 0 2.22973E-4
19-14518817-C-T p.Thr825Ile missense CD97 1 83044 1.20418E-5 41522 0 NA
19-14518818-C-T p.Thr825Thr synonymous CD97 1 83034 1.20433E-5 41517 0 7.96768E-6
19-14518819-C-A p.Arg826Arg splice_region+synonymous CD97 1 83024 1.20447E-5 41512 0 4.78171E-5
19-14518820-G-A p.Arg826Gln missense+splice_region CD97 3 83036 3.61289E-5 41518 0 3.18451E-5
19-14518820-GGGTAAGGGGCTGCGCCTGGGGCGGGTGTGGGCAGGAAGGCACCAGGGCTAGCGGGGCTCAGGCCTCTGGGCTCTCCTCTCCA-G p.Ala827fs frameshift CD97 4 83028 4.81765E-5 41514 0 NA
19-14518826-G-A c.2478+5G>A splice_region CD97 2 83020 2.40906E-5 41510 0 NA
19-14518828-G-A c.2478+7G>A splice_region CD97 2 82988 2.40999E-5 41494 0 6.36943E-5
19-14518901-C-T c.2479-3C>T splice_region CD97 1 82848 1.20703E-5 41424 0 8.3524E-6
19-14518905-C-A p.Ala827Asp missense+splice_region CD97 3 82810 3.62275E-5 41405 0 3.18735E-5
19-14518913-G-A p.Ala830Thr missense CD97 26 82784 3.1407E-4 41392 0 0.00202429
19-14518914-C-T p.Ala830Val missense CD97 42 82782 5.07357E-4 41391 0 4.85396E-4
19-14518919-G-C p.Glu832Gln missense CD97 4 82724 4.83536E-5 41362 0 5.02614E-5
19-14518924-C-T p.Ser833Ser synonymous CD97 2 82632 2.42037E-5 41316 0 3.18776E-5
19-14518925-G-A p.Gly834Ser missense CD97 5 82598 6.05342E-5 41299 0 1.84893E-4
19-14518929-T-C p.Ile835Thr missense CD97 2 82518 2.42371E-5 41259 0 8.40675E-6
19-14519535-A-G c.*602A>G splice_region CD97 1 40792 2.45146E-5 20396 0 NA