Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-14847056-C-T p.Val822Ile missense+splice_region EMR2 1 81824 1.22214E-5 40912 0 NA
19-14847060-A-G c.2464-4T>C splice_region EMR2 1 81622 1.22516E-5 40811 0 3.18512E-5
19-14847061-A-AAT c.2464-6_2464-5insAT splice_region EMR2 37 81468 4.54166E-4 40734 0 0.00105243
19-14847061-AAT-A c.2464-7_2464-6delAT splice_region EMR2 4 81532 4.90605E-5 40766 0 1.79074E-4
19-14852289-T-C c.*544A>G splice_region EMR2 1 24 0.0416667 12 0 0.0149683
19-14852846-C-T p.Arg828Lys missense EMR2 10 780 0.0128205 390 0 0.75
19-14854231-C-T c.2463+1G>A splice_donor EMR2 28 83376 3.35828E-4 41688 0 3.50296E-4
19-14854232-C-A p.Thr821Thr splice_region+synonymous EMR2 1 83380 1.19933E-5 41690 0 5.03525E-4
19-14854232-C-T p.Thr821Thr splice_region+synonymous EMR2 1 83380 1.19933E-5 41690 0 6.25E-4
19-14854233-G-A p.Thr821Met missense+splice_region EMR2 491 83362 0.00588997 41681 4 0.00669007
19-14854250-G-A p.Asp815Asp synonymous EMR2 3 83392 3.59747E-5 41696 0 4.11848E-5
19-14854257-T-G p.Lys813Thr missense EMR2 1 83394 1.19913E-5 41697 0 8.23683E-6
19-14854264-T-C p.Ser811Gly missense EMR2 1 83402 1.19901E-5 41701 0 5.03525E-4
19-14854272-AGT-A p.Ser809fs frameshift EMR2 2 83402 2.39802E-5 41701 0 NA
19-14854273-G-A p.Leu808Phe missense EMR2 1 83404 1.19898E-5 41702 0 7.95254E-6
19-14854275-G-C p.Thr807Arg missense EMR2 1 83406 1.19895E-5 41703 0 NA
19-14854277-G-A p.His806His synonymous EMR2 1 83404 1.19898E-5 41702 0 3.97627E-6
19-14854288-A-T p.Ser803Thr missense EMR2 10 83406 1.19895E-4 41703 0 1.91314E-4
19-14854310-C-A p.Gly795Gly synonymous EMR2 1 83390 1.19918E-5 41695 0 6.36862E-5
19-14854318-A-G p.Ser793Pro missense EMR2 1 83396 1.1991E-5 41698 0 NA
19-14854320-C-T p.Trp792* stop_gained EMR2 1 83400 1.19904E-5 41700 0 7.95311E-6
19-14854330-AT-A p.Gln788fs frameshift EMR2 1 83394 1.19913E-5 41697 0 NA
19-14854338-C-T p.Arg786Gln missense EMR2 1045 83374 0.0125339 41687 12 0.0136983
19-14854339-G-C p.Arg786Gly missense EMR2 2 83382 2.3986E-5 41691 0 NA
19-14854339-G-A p.Arg786Trp missense EMR2 2 83382 2.3986E-5 41691 0 4.11868E-5
19-14854340-GACCTGCAGAGGCAAAGTGTGTACTGGGTCAGCTCACAGAGAGCAGTGAGGACAGGAAGAGTCCTGGGTGGGAGCTGGGCAGTGGT-G p.Val785fs frameshift EMR2 10 83380 1.19933E-4 41690 2 NA
19-14854344-T-C c.2353-2A>G splice_acceptor EMR2 1 83388 1.19921E-5 41694 0 NA
19-14854345-G-A c.2353-3C>T splice_region EMR2 1 83386 1.19924E-5 41693 0 6.36943E-5
19-14854429-T-A p.Gln784Leu missense+splice_region EMR2 2 83384 2.39854E-5 41692 0 NA
19-14854431-C-G p.Gln783His missense EMR2 5 83382 5.9965E-5 41691 0 6.37064E-5
19-14854439-G-A p.Leu781Phe missense EMR2 1 83380 1.19933E-5 41690 0 3.98035E-6
19-14854485-G-A p.Ile765Ile synonymous EMR2 2 83350 2.39952E-5 41675 0 3.18613E-5
19-14854493-A-C p.Phe763Val missense EMR2 2 83354 2.3994E-5 41677 0 1.5909E-5
19-14854496-G-A p.Leu762Phe missense EMR2 1 83350 1.19976E-5 41675 0 NA
19-14854498-T-C p.Tyr761Cys missense EMR2 1 83334 1.19999E-5 41667 0 NA
19-14854510-C-T p.Arg757Gln missense EMR2 7 83314 8.40195E-5 41657 0 6.58989E-5
19-14854511-G-A p.Arg757Trp missense EMR2 16 83320 1.92031E-4 41660 0 5.03525E-4
19-14854514-C-A p.Ala756Ser missense EMR2 5 83312 6.00154E-5 41656 0 3.97779E-5
19-14854518-C-T p.Pro754Pro synonymous EMR2 6 83308 7.20219E-5 41654 0 9.88484E-5
19-14854519-G-A p.Pro754Leu missense EMR2 7 83302 8.40316E-5 41651 0 3.18878E-5
19-14854530-C-T p.Leu750Leu synonymous EMR2 1 83304 1.20042E-5 41652 0 5.03525E-4
19-14854536-G-A p.Gly748Gly synonymous EMR2 1 83294 1.20057E-5 41647 0 1.19347E-4
19-14854548-C-T p.Thr744Thr synonymous EMR2 3 83256 3.60334E-5 41628 0 3.18532E-5
19-14854549-G-A p.Thr744Met missense EMR2 1 83254 1.20114E-5 41627 0 9.55962E-5
19-14854566-C-T p.Leu738Leu synonymous EMR2 1 83208 1.20181E-5 41604 0 NA
19-14854568-G-A p.Leu738Leu synonymous EMR2 5 83192 6.01019E-5 41596 0 1.91119E-4
19-14854578-C-T c.*517G>A splice_region EMR2 13 83150 1.56344E-4 41575 0 1.59379E-4
19-14854588-G-A p.Ala731Val missense EMR2 5 83046 6.02076E-5 41523 0 2.22958E-4
19-14854594-A-G p.Met729Thr missense+splice_region EMR2 1 82988 1.20499E-5 41494 0 9.55475E-5
19-14854597-C-T c.2184-1G>A splice_acceptor EMR2 1 82938 1.20572E-5 41469 0 NA
19-14857050-T-C p.Asn726Ser missense EMR2 2 83056 2.40801E-5 41528 1 3.18451E-5
19-14857053-C-T p.Arg725Gln missense EMR2 7 83038 8.42988E-5 41519 0 6.77966E-5
19-14857053-CGG-TGA p.LeuArg724LeuGln missense EMR2 1 83038 1.20427E-5 41519 0 NA
19-14857054-G-A p.Arg725Trp missense EMR2 14 83082 1.68508E-4 41541 0 1.23674E-4
19-14857055-G-A p.Leu724Leu synonymous EMR2 5037 82908 0.0607541 41454 173 0.0694184
19-14857055-G-T p.Leu724Leu synonymous EMR2 2 83090 2.40703E-5 41545 0 6.71592E-4
19-14857064-C-CACTT p.Thr723fs frameshift EMR2 2 83132 2.40581E-5 41566 0 3.98194E-6
19-14857065-A-G p.Val721Ala missense EMR2 2 83134 2.40575E-5 41567 0 7.9628E-6
19-14857067-T-G p.Glu720Asp missense EMR2 2508 83070 0.0301914 41535 233 0.0699668
19-14857076-G-C p.Leu717Leu synonymous EMR2 1 83196 1.20198E-5 41598 0 8.23805E-6
19-14857081-A-G p.Ser716Pro missense EMR2 1 83210 1.20178E-5 41605 0 3.97886E-6
19-14857089-C-G p.Arg713Thr missense EMR2 5 83248 6.00615E-5 41624 0 3.18776E-4
19-14857089-C-A p.Arg713Ile missense EMR2 4 83248 4.80492E-5 41624 0 3.18776E-5
19-14857103-C-T p.Trp708* stop_gained EMR2 3 83260 3.60317E-5 41630 0 3.02449E-4
19-14857104-C-T p.Trp708* stop_gained EMR2 1 83258 1.20109E-5 41629 0 1.64783E-5
19-14857114-C-G p.Val705Leu missense EMR2 125 83222 0.00150201 41611 0 0.00166134
19-14857123-G-T p.Leu702Ile missense EMR2 10 83122 1.20305E-4 41561 0 6.39182E-5
19-14857126-C-T p.Val701Ile missense EMR2 2 83118 2.40622E-5 41559 0 8.24334E-6
19-14857701-C-T c.2091+7G>A splice_region EMR2 2 83258 2.40217E-5 41629 0 NA
19-14857705-C-T c.2091+3G>A splice_region EMR2 2 83280 2.40154E-5 41640 0 1.76407E-5
19-14857712-A-T p.Phe696Tyr missense EMR2 1 83296 1.20054E-5 41648 0 3.98444E-6
19-14857713-A-G p.Phe696Leu missense EMR2 1 83298 1.20051E-5 41649 0 NA
19-14857719-C-T p.Ala694Thr missense EMR2 4 83300 4.80192E-5 41650 0 3.18939E-5
19-14857719-C-A p.Ala694Ser missense EMR2 1 83300 1.20048E-5 41650 0 NA
19-14857720-G-A p.Cys693Cys synonymous EMR2 330 83302 0.00396149 41651 3 0.0100128
19-14857738-G-A p.Gly687Gly synonymous EMR2 1 83308 1.20036E-5 41654 0 NA
19-14857739-C-T p.Gly687Asp missense EMR2 1 83304 1.20042E-5 41652 0 1.73557E-5
19-14857742-C-T p.Trp686* stop_gained EMR2 1 83308 1.20036E-5 41654 0 1.19587E-5
19-14857743-A-G p.Trp686Arg missense EMR2 1 83298 1.20051E-5 41649 0 1.99279E-5
19-14857750-T-TC p.Phe684fs frameshift EMR2 1 83272 1.20088E-5 41636 0 NA
19-14857772-C-A p.Cys676Phe missense+splice_region EMR2 2 83154 2.40518E-5 41577 0 9.20912E-6
19-14862247-C-T c.2024+1G>A splice_donor EMR2 37 83338 4.43975E-4 41669 0 0.00125
19-14862248-C-T p.Arg675His missense+splice_region EMR2 1 83350 1.19976E-5 41675 0 3.18593E-5
19-14862256-T-C p.Thr672Thr synonymous EMR2 2 83370 2.39894E-5 41685 0 NA
19-14862258-T-C p.Thr672Ala missense EMR2 1 83372 1.19944E-5 41686 0 2.47154E-5
19-14862266-A-C p.Leu669Arg missense EMR2 1 83376 1.19939E-5 41688 0 2.47129E-5
19-14862268-G-C p.His668Gln missense EMR2 1 83382 1.1993E-5 41691 0 3.18492E-5
19-14862273-G-A p.Pro667Ser missense EMR2 1 83374 1.19941E-5 41687 0 NA
19-14862275-C-T p.Arg666Lys missense EMR2 1 83380 1.19933E-5 41690 0 1.98831E-5
19-14862278-G-A p.Ser665Phe missense EMR2 857 83352 0.0102817 41676 10 0.0161208
19-14862306-C-T p.Ala656Thr missense EMR2 3 83380 3.59799E-5 41690 0 1.27437E-4
19-14862315-C-T p.Gly653Arg missense EMR2 3 83388 3.59764E-5 41694 0 2.47093E-5
19-14862323-A-C p.Val650Gly missense EMR2 2 83386 2.39848E-5 41693 0 3.18492E-5
19-14862332-A-T p.Met647Lys missense EMR2 33 83378 3.95788E-4 41689 0 7.08332E-4
19-14862353-T-C p.Asn640Ser missense EMR2 52 83364 6.2377E-4 41682 0 0.00146534
19-14862370-G-A p.Val634Val synonymous EMR2 3 83356 3.59902E-5 41678 0 8.23655E-5
19-14862373-C-T p.Val633Val synonymous EMR2 1 83358 1.19964E-5 41679 0 NA
19-14862376-C-T p.Thr632Thr synonymous EMR2 1 83352 1.19973E-5 41676 0 5.76559E-5
19-14862376-C-A p.Thr632Thr synonymous EMR2 1 83352 1.19973E-5 41676 0 NA
19-14862377-G-A p.Thr632Met missense EMR2 8 83346 9.59854E-5 41673 0 3.18157E-5
19-14862386-C-T p.Arg629Gln missense EMR2 248 83324 0.00297633 41662 1 0.00713785
19-14862396-G-A p.Leu626Phe missense EMR2 14 83346 1.67974E-4 41673 0 5.03525E-4
19-14862399-A-G p.Phe625Leu missense EMR2 1 83346 1.19982E-5 41673 0 3.18532E-5
19-14862411-C-T p.Ala621Thr missense EMR2 2 83322 2.40033E-5 41661 0 7.95501E-6
19-14862423-T-A p.Met617Leu missense EMR2 5 83314 6.00139E-5 41657 0 8.23669E-6
19-14862430-C-G p.Leu614Phe missense EMR2 59081 81818 0.722103 40909 21479 0.772164
19-14862450-A-G p.Tyr608His missense EMR2 1 83290 1.20062E-5 41645 0 NA
19-14862458-G-A p.Thr605Ile missense EMR2 1555 83188 0.0186926 41594 78 0.0433743
19-14862462-C-T p.Gly604Ser missense EMR2 7 83236 8.40982E-5 41618 0 1.27494E-4
19-14862463-G-A p.Ala603Ala synonymous EMR2 3 83234 3.6043E-5 41617 0 1.19468E-5
19-14862465-C-T p.Ala603Thr missense EMR2 3 83220 3.6049E-5 41610 0 3.18776E-5
19-14862466-G-A p.Ile602Ile synonymous EMR2 9 83218 1.0815E-4 41609 0 4.77893E-5
19-14862467-A-G p.Ile602Thr missense EMR2 1 83214 1.20172E-5 41607 0 8.26187E-6
19-14862471-T-C p.Ile601Val missense EMR2 1 83200 1.20192E-5 41600 0 NA
19-14862479-A-G p.Leu598Pro missense EMR2 2 83144 2.40547E-5 41572 0 8.31228E-6
19-14862488-C-T c.1789-5G>A splice_region EMR2 2 83074 2.40749E-5 41537 0 8.3849E-5
19-14862489-G-A c.1789-6C>T splice_region EMR2 7 83064 8.42724E-5 41532 0 1.59388E-4
19-14862490-G-T c.1789-7C>A splice_region EMR2 17 83058 2.04676E-4 41529 0 1.99877E-4
19-14863149-C-A p.Gly594* stop_gained EMR2 34 82946 4.09905E-4 41473 0 6.25E-4
19-14863150-G-A p.Thr593Thr synonymous EMR2 2759 82870 0.0332931 41435 68 0.0334884
19-14863160-A-G p.Ile590Thr missense EMR2 4 83096 4.81371E-5 41548 0 6.37064E-5
19-14863162-T-C p.Ala589Ala synonymous EMR2 4 83108 4.81301E-5 41554 0 1.64965E-5
19-14863163-G-C p.Ala589Gly missense EMR2 4 83118 4.81244E-5 41559 0 1.64965E-5
19-14863164-C-T p.Ala589Thr missense EMR2 1 83118 1.20311E-5 41559 0 NA
19-14863165-C-T p.Val588Val synonymous EMR2 4 83144 4.81093E-5 41572 0 0.0010582
19-14863167-C-T p.Val588Met missense EMR2 4 83162 4.80989E-5 41581 0 3.57995E-5
19-14863168-G-A p.Leu587Leu synonymous EMR2 1 83198 1.20195E-5 41599 0 3.97728E-6
19-14863172-AAG-A p.Phe586fs frameshift EMR2 27 83220 3.24441E-4 41610 1 0.00162423
19-14863201-C-T p.Ser576Ser synonymous EMR2 2 83302 2.4009E-5 41651 0 5.05561E-4
19-14863202-G-A p.Ser576Leu missense EMR2 6 83310 7.20202E-5 41655 0 0.00100705
19-14863205-A-T p.Leu575His missense EMR2 2 83320 2.40038E-5 41660 0 6.37064E-5
19-14863219-TGAGGTGCTGGTGTTCTG-T p.Gln565fs frameshift EMR2 267 83298 0.00320536 41649 2 0.0038738
19-14863220-G-T p.Ser570* stop_gained EMR2 10 83298 1.20051E-4 41649 0 4.78103E-4
19-14863229-G-A p.Thr567Ile missense EMR2 1 83300 1.20048E-5 41650 0 3.9808E-6
19-14863235-T-C p.Gln565Arg missense EMR2 1 83290 1.20062E-5 41645 0 1.65423E-5
19-14863237-G-T p.Ile564Ile synonymous EMR2 1 83306 1.20039E-5 41653 0 NA
19-14863247-C-T p.Cys561Tyr missense EMR2 13 83284 1.56092E-4 41642 0 8.35289E-5
19-14863258-A-G p.Phe376Leu missense EMR2 1 83250 1.2012E-5 41625 0 8.24851E-6
19-14863267-C-T p.Gly373Ser missense EMR2 1 83236 1.2014E-5 41618 0 3.30006E-5
19-14863268-G-A p.Ala554Val missense EMR2 3 83246 3.60378E-5 41623 0 5.03525E-4
19-14863276-G-A p.Pro370Ser missense EMR2 186 83202 0.00223552 41601 1 0.00430101
19-14863279-G-A p.Pro369Ser missense EMR2 4 83196 4.80792E-5 41598 0 6.37267E-5
19-14863279-G-T p.Cys550* stop_gained EMR2 2 83196 2.40396E-5 41598 0 3.18634E-5
19-14863279-G-GGC p.Cys550fs frameshift EMR2 1 83196 1.20198E-5 41598 0 NA
19-14863281-A-G p.Cys550Arg missense EMR2 1 83192 1.20204E-5 41596 0 NA
19-14863282-CAG-C p.Leu549fs frameshift EMR2 1 83190 1.20207E-5 41595 0 NA
19-14863289-G-A p.Ser547Phe missense EMR2 11 83178 1.32247E-4 41589 0 2.02948E-4
19-14863293-C-T p.Val546Ile missense EMR2 1 83162 1.20247E-5 41581 0 4.77616E-5
19-14863294-G-T p.Ser545Arg missense EMR2 3 83132 3.60872E-5 41566 0 NA
19-14863295-C-G p.Ser545Thr missense EMR2 1 83136 1.20285E-5 41568 0 NA
19-14863305-T-C p.Met542Val missense EMR2 529 83044 0.00637012 41522 12 0.0171198
19-14863305-TG-CA p.TyrMet541TyrVal missense EMR2 4 83054 4.81614E-5 41527 0 NA
19-14863306-G-A p.His360Tyr missense EMR2 14 83048 1.68577E-4 41524 0 6.0552E-4
19-14863316-ACAGT-A p.Thr537fs frameshift EMR2 2 82926 2.41179E-5 41463 0 NA
19-14863326-C-T p.Val535Met missense EMR2 19 82756 2.29591E-4 41378 0 2.76057E-4
19-14863327-G-C p.Arg353Gly missense EMR2 1 82702 1.20916E-5 41351 0 NA
19-14863331-TCCTCCTCCTGGGAC-T p.Glu531fs frameshift EMR2 1 82644 1.21001E-5 41322 0 NA
19-14863334-T-C p.Glu532Gly missense EMR2 1 82608 1.21054E-5 41304 0 NA
19-14863336-C-T p.Gly350Arg missense+splice_region EMR2 2 82624 2.4206E-5 41312 0 3.18674E-5
19-14863339-C-A c.1591-1G>T splice_acceptor EMR2 1 82582 1.21092E-5 41291 0 NA
19-14865766-C-G p.Gln530His missense+splice_region EMR2 1 83010 1.20467E-5 41505 0 3.9894E-6
19-14865774-C-T p.Asp528Asn missense EMR2 4 83004 4.81904E-5 41502 0 3.98587E-6
19-14865775-G-A p.Arg192* stop_gained EMR2 4 83010 4.8187E-5 41505 0 8.24579E-5
19-14865775-G-T p.Tyr527* stop_gained EMR2 11 83008 1.32517E-4 41504 0 0.00302115
19-14865776-T-G p.Tyr527Ser missense EMR2 40 82988 4.81997E-4 41494 0 0.00175249
19-14865780-G-A p.His526Tyr missense EMR2 1 82994 1.20491E-5 41497 0 2.47341E-5
19-14865792-C-T p.Val522Ile missense EMR2 3 83032 3.61306E-5 41516 0 3.18634E-5
19-14865793-G-A p.Arg186Cys missense EMR2 2 83038 2.40854E-5 41519 0 NA
19-14865800-C-G p.Ser519Thr missense EMR2 3 83054 3.61211E-5 41527 0 NA
19-14865802-G-C p.Ser518Arg missense EMR2 121 83050 0.00145695 41525 0 0.00407695
19-14865808-G-A p.Pro181Ser missense EMR2 1 83076 1.20372E-5 41538 0 NA
19-14865818-C-T p.Arg513His missense EMR2 4 83144 4.81093E-5 41572 0 5.17125E-5
19-14865825-T-C p.Ile511Val missense EMR2 3 83164 3.60733E-5 41582 1 1.6478E-5
19-14865832-G-A p.Gln173* stop_gained EMR2 2 83148 2.40535E-5 41574 0 NA
19-14865837-C-T p.Asp507Asn missense EMR2 1 83162 1.20247E-5 41581 0 NA
19-14865857-C-T p.Cys500Tyr missense EMR2 38 83168 4.56907E-4 41584 0 7.97906E-4
19-14865863-GT-G p.Thr498fs frameshift EMR2 2 83144 2.40547E-5 41572 0 1.59653E-4
19-14865871-C-T p.Trp495* stop_gained EMR2 1 83096 1.20343E-5 41548 0 3.19898E-5
19-14865893-C-T p.Trp152* stop_gained EMR2 1 82988 1.20499E-5 41494 0 NA
19-14865896-T-C p.His487Arg missense EMR2 1 82998 1.20485E-5 41499 0 NA
19-14865900-C-T p.Glu486Lys missense EMR2 1 82922 1.20595E-5 41461 0 6.25E-4
19-14865902-C-T p.Trp485* stop_gained EMR2 1 82936 1.20575E-5 41468 0 1.19421E-5
19-14865914-A-G p.Leu481Pro missense EMR2 1 82728 1.20878E-5 41364 0 NA
19-14865918-C-A p.Val480Leu missense EMR2 2 82592 2.42154E-5 41296 0 8.25641E-6
19-14865921-T-A p.Lys479* stop_gained EMR2 4 82534 4.84649E-5 41267 0 2.39162E-5
19-14865924-G-C p.Gln478Glu missense EMR2 2 82368 2.42813E-5 41184 0 3.98785E-6
19-14865928-C-T p.Glu141Lys missense EMR2 5 82152 6.08628E-5 41076 0 0.00100705
19-14865929-G-A p.Pro476Leu missense EMR2 9 82138 1.09572E-4 41069 0 0.00100705
19-14865946-G-A c.1417-7C>T splice_region EMR2 2 81110 2.46579E-5 40555 0 NA
19-14866463-C-G c.1416+3G>C splice_region EMR2 8 82728 9.67024E-5 41364 0 5.45121E-4
19-14866466-A-G p.Arg472Arg splice_region+synonymous EMR2 1 82778 1.20805E-5 41389 0 NA
19-14866467-C-T p.Arg472His missense+splice_region EMR2 1 82772 1.20814E-5 41386 0 5.7814E-5
19-14866468-G-A p.Arg472Cys missense+splice_region EMR2 5 82782 6.03996E-5 41391 0 9.90933E-5
19-14866470-T-C p.His471Arg missense EMR2 2 82806 2.41528E-5 41403 0 NA
19-14866472-G-A p.Ser470Ser synonymous EMR2 1 82840 1.20715E-5 41420 0 8.25464E-6
19-14866475-G-A p.Phe469Phe synonymous EMR2 1 82878 1.20659E-5 41439 0 8.25341E-6
19-14866484-G-A p.Thr466Thr synonymous EMR2 1 82954 1.20549E-5 41477 0 1.19351E-5
19-14866492-G-C p.Pro464Ala missense EMR2 2 83068 2.40767E-5 41534 0 NA
19-14866501-G-A p.Leu461Phe missense EMR2 3 83110 3.60967E-5 41555 0 NA
19-14866513-CGTT-C p.Asn456del conservative_inframe_deletion EMR2 2 83138 2.40564E-5 41569 0 3.29592E-5
19-14866513-C-T p.Asp457Asn missense EMR2 1 83138 1.20282E-5 41569 0 7.95361E-6
19-14866514-G-C p.Asn456Lys missense EMR2 1 83142 1.20276E-5 41571 0 6.59207E-5
19-14866519-T-C p.Asn455Asp missense EMR2 1 83144 1.20273E-5 41572 0 NA
19-14866532-A-G p.Ser450Ser synonymous EMR2 1 83162 1.20247E-5 41581 0 NA
19-14866535-G-A p.Ile449Ile synonymous EMR2 1 83172 1.20233E-5 41586 0 4.11902E-5
19-14866548-A-G p.Leu445Pro missense EMR2 8 83136 9.62279E-5 41568 0 1.59317E-4
19-14866550-C-T p.Leu444Leu synonymous EMR2 3 83116 3.60941E-5 41558 0 NA
19-14866556-G-T p.Pro442Pro synonymous EMR2 4 83118 4.81244E-5 41559 0 0.00100705
19-14866565-G-A p.Asp439Asp synonymous EMR2 1 83108 1.20325E-5 41554 0 1.64739E-5
19-14866570-G-T p.Gln438Lys missense EMR2 1 83116 1.20314E-5 41558 0 8.23696E-6
19-14866577-G-A p.Gly435Gly synonymous EMR2 1 83092 1.20349E-5 41546 0 NA
19-14866588-T-C p.Thr432Ala missense EMR2 1 83086 1.20357E-5 41543 0 1.98855E-5
19-14866599-A-G p.Leu428Pro missense EMR2 31 83060 3.73224E-4 41530 0 6.69045E-4
19-14866600-G-A p.Leu428Phe missense EMR2 100 83052 0.00120406 41526 0 0.0025
19-14866617-T-C p.Glu422Gly missense EMR2 1 82954 1.20549E-5 41477 0 NA
19-14866625-C-T p.Leu419Leu synonymous EMR2 4 82920 4.82393E-5 41460 0 1.64842E-5
19-14866625-C-G p.Leu419Leu synonymous EMR2 2 82920 2.41196E-5 41460 0 NA
19-14866630-G-T p.Pro418Thr missense EMR2 1 82886 1.20648E-5 41443 0 3.98076E-6
19-14866638-GC-AA p.Ala415Phe missense EMR2 1 82814 1.20753E-5 41407 0 NA
19-14866639-C-T p.Ala415Thr missense EMR2 4 82804 4.83068E-5 41402 0 6.25E-4
19-14866640-C-G p.Leu414Leu synonymous EMR2 1 82794 1.20782E-5 41397 0 5.03525E-4
19-14866654-T-C p.Met399Val missense+splice_region EMR2 2 82580 2.42189E-5 41290 0 NA
19-14866672-G-A p.Leu404Phe missense EMR2 1 82166 1.21705E-5 41083 0 4.00125E-6
19-14866678-C-A p.Val402Leu missense EMR2 1 81934 1.22049E-5 40967 0 NA
19-14866685-A-C p.Pro399Pro synonymous EMR2 82 81782 0.00100267 40891 0 0.00273885
19-14866695-G-A c.1193-6C>T splice_region EMR2 1 81254 1.23071E-5 40627 0 NA
19-14866695-G-T c.1193-6C>A splice_region EMR2 4 81254 4.92283E-5 40627 0 3.23468E-5
19-14867079-C-T p.Trp388* stop_gained EMR2 1 83352 1.19973E-5 41676 0 1.19317E-5
19-14867083-C-T p.Asp387Asn missense EMR2 7 83342 8.39913E-5 41671 0 3.97703E-6
19-14867093-C-T p.Val383Val synonymous EMR2 3 83342 3.59963E-5 41671 0 3.1841E-5
19-14867095-C-G p.Val383Leu missense EMR2 1 83334 1.19999E-5 41667 0 6.25E-4
19-14867098-C-T p.Ala382Thr missense EMR2 3 83338 3.5998E-5 41669 0 1.64772E-5
19-14867105-C-G p.Gln379His missense EMR2 2 83332 2.40004E-5 41666 0 3.1841E-5
19-14867105-C-T p.Gln379Gln synonymous EMR2 2 83332 2.40004E-5 41666 0 NA
19-14867116-T-C p.Thr376Ala missense EMR2 1 83286 1.20068E-5 41643 0 3.18512E-5
19-14867120-A-G p.Ser374Ser synonymous EMR2 1 83268 1.20094E-5 41634 0 8.23886E-6
19-14867133-T-C p.Gln370Arg missense EMR2 1 83186 1.20213E-5 41593 0 1.98899E-5
19-14867144-C-G p.Glu366Asp missense EMR2 1 83076 1.20372E-5 41538 0 NA
19-14867160-A-G c.1085-3T>C splice_region EMR2 2 82832 2.41453E-5 41416 0 NA
19-14867164-G-A c.1085-7C>T splice_region EMR2 5 82732 6.04361E-5 41366 0 6.36983E-5
19-14875253-G-C p.Ala359Gly missense EMR2 1 83056 1.20401E-5 41528 0 3.99738E-5
19-14875267-G-T p.Asn354Lys missense EMR2 1 83084 1.2036E-5 41542 0 3.9962E-6
19-14875273-C-T p.Leu352Leu synonymous EMR2 2 83082 2.40726E-5 41541 0 3.996E-6
19-14875278-C-T p.Gly351Arg missense EMR2 1 83074 1.20375E-5 41537 0 NA
19-14875283-G-C p.Ser349Cys missense EMR2 1 83078 1.20369E-5 41539 0 NA
19-14875287-G-A p.Leu348Phe missense EMR2 2 83088 2.40709E-5 41544 0 3.99594E-6
19-14875288-G-T p.Asn347Lys missense EMR2 1 83082 1.20363E-5 41541 0 8.35589E-6
19-14875288-G-A p.Asn347Asn synonymous EMR2 2 83082 2.40726E-5 41541 0 1.99808E-5
19-14875297-C-T p.Leu344Leu synonymous EMR2 2 83068 2.40767E-5 41534 0 8.35171E-6
19-14875306-G-A p.Leu341Leu synonymous EMR2 1 83060 1.20395E-5 41530 0 3.99671E-6
19-14875307-A-G p.Leu341Pro missense EMR2 1 83054 1.20404E-5 41527 0 NA
19-14875331-A-G p.Leu333Pro missense EMR2 1 83018 1.20456E-5 41509 0 1.6692E-5
19-14875361-C-T p.Arg323His missense EMR2 3 82850 3.621E-5 41425 0 2.50618E-5
19-14875362-G-A p.Arg323Cys missense EMR2 14 82846 1.68988E-4 41423 0 1.92125E-4
19-14875362-G-C p.Arg323Gly missense EMR2 6 82844 7.24253E-5 41422 0 1.27421E-4
19-14875376-A-G p.Leu318Pro missense EMR2 1 82668 1.20966E-5 41334 0 4.00612E-6
19-14875388-G-A p.Ala314Val missense EMR2 21311 80536 0.264615 40268 2785 0.286875
19-14875396-C-A p.Leu311Leu synonymous EMR2 1 82142 1.2174E-5 41071 0 NA
19-14875398-G-T p.Leu311Met missense EMR2 5 82110 6.08939E-5 41055 0 5.06586E-4
19-14875408-C-T p.Ala307Ala synonymous EMR2 2 81558 2.45224E-5 40779 0 0.00151362
19-14875409-G-A p.Ala307Val missense EMR2 9 81454 1.10492E-4 40727 0 0.00439147
19-14876125-T-C c.906+7A>G splice_region EMR2 1862 83162 0.02239 41581 36 0.0368074
19-14876132-C-T p.Gln302Gln splice_region+synonymous EMR2 1 83248 1.20123E-5 41624 0 NA
19-14876138-G-A p.Thr300Thr synonymous EMR2 2 83274 2.40171E-5 41637 0 1.65172E-5
19-14876141-GTT-G p.Asn299fs frameshift EMR2 10 83270 1.20091E-4 41635 1 4.1396E-4
19-14876144-A-ACC p.Asn298fs frameshift EMR2 10 83264 1.201E-4 41632 1 4.14224E-4
19-14876146-T-C p.Asn298Asp missense EMR2 8 83258 9.60869E-5 41629 1 4.14065E-4
19-14876150-C-T p.Leu296Leu synonymous EMR2 7 83258 8.4076E-5 41629 1 4.14065E-4
19-14876151-A-G p.Leu296Ser missense EMR2 6 83264 7.206E-5 41632 1 4.14594E-4
19-14876153-G-A p.Gly295Gly synonymous EMR2 1 83292 1.2006E-5 41646 0 9.07965E-5
19-14876155-C-T p.Gly295Ser missense EMR2 8 83264 9.60799E-5 41632 1 3.84492E-4
19-14876155-C-A p.Gly295Cys missense EMR2 1 83284 1.20071E-5 41642 0 3.2041E-5
19-14876158-G-T p.Pro294Thr missense EMR2 7 83256 8.4078E-5 41628 1 3.85877E-4
19-14876163-T-G p.Tyr292Ser missense EMR2 171 83250 0.00205405 41625 1 0.00221918
19-14876174-C-G p.Leu288Leu synonymous EMR2 1 83292 1.2006E-5 41646 0 0.00100705
19-14876191-C-T p.Asp283Asn missense EMR2 5 83274 6.00428E-5 41637 0 1.91083E-4
19-14876192-G-A p.Phe282Phe synonymous EMR2 185 83264 0.00222185 41632 0 0.00410828
19-14876195-G-T p.Phe281Leu missense EMR2 1012 83230 0.0121591 41615 35 0.027861
19-14876199-C-T p.Arg280Gln missense EMR2 4 83272 4.80354E-5 41636 0 7.4239E-5
19-14876208-G-T p.Thr277Lys missense+splice_region EMR2 16 83260 1.92169E-4 41630 0 0.00302115
19-14876208-G-A p.Thr277Met missense+splice_region EMR2 2 83258 2.40217E-5 41629 0 6.36902E-5
19-14876209-T-A p.Thr277Ser missense+splice_region EMR2 9 83256 1.081E-4 41628 0 4.12487E-4
19-14876209-TCTGCAGAGAGAGGAGATGTGGGGGTCAGAGAGCCTGGACGGCGGGTGGGAAGTTTAGAACAAGGAGACGGATGCAGTGCTGTGTGGATGGAGTTCCCGCCGCCTCGTCCCTGTGGGGGCCACTCAC-T c.828+1_829-1del splice_acceptor EMR2 3 83256 3.60334E-5 41628 0 NA
19-14876213-C-CAG c.829-5_829-4insCT splice_region EMR2 2 83248 2.40246E-5 41624 0 9.07621E-5
19-14876214-A-G c.829-5T>C splice_region EMR2 1 83248 1.20123E-5 41624 0 3.97959E-6
19-14876330-A-G c.828+6T>C splice_region EMR2 1 82966 1.20531E-5 41483 0 NA
19-14876337-T-C p.Gln276Arg missense+splice_region EMR2 1 83048 1.20412E-5 41524 0 3.18451E-5
19-14876347-C-G p.Val273Leu missense EMR2 1 83120 1.20308E-5 41560 0 8.27869E-6
19-14876348-T-C p.Gly272Gly synonymous EMR2 1 83118 1.20311E-5 41559 0 1.59286E-4
19-14876351-A-C p.Pro271Pro synonymous EMR2 3 83118 3.60933E-5 41559 0 6.37024E-5
19-14876353-G-A p.Pro271Ser missense EMR2 1 83178 1.20224E-5 41589 0 4.13408E-5
19-14876358-G-A p.Pro269Leu missense EMR2 2 83218 2.40333E-5 41609 0 1.65196E-5
19-14876370-G-C p.Ser265Cys missense EMR2 1 83332 1.20002E-5 41666 0 4.12337E-5
19-14876372-GAA-G p.Phe264fs frameshift EMR2 1 83354 1.1997E-5 41677 0 NA
19-14876376-G-A p.Thr263Ile missense EMR2 1 83370 1.19947E-5 41685 0 8.24457E-6
19-14876382-TCTGTAGGGAACAAGACAAGCGGCTCATTAGGCGGGAGCGTGTCAGTGTGTGTGCTGGGGGTGGGGAGCTTCTAGGGCCAGGTCATAC-T c.781+1_782-1delGTATGACCTGGCCCTAGAAGCTCCCCACCCCCAGCACACACACTGACACGCTCCCGCCTAATGAGCCGCTTGTCTTGTTCCCTACAG splice_acceptor EMR2 3 83376 3.59816E-5 41688 0 NA
19-14876387-A-G c.782-5T>C splice_region EMR2 3 83398 3.59721E-5 41699 0 3.18329E-5
19-14876469-C-T c.781+1G>A splice_donor EMR2 1 83384 1.19927E-5 41692 0 1.64995E-5
19-14876483-G-A p.Asp256Asp synonymous EMR2 1539 82338 0.0186912 41169 4 0.040625
19-14876490-T-C p.Gln254Arg missense EMR2 1 83208 1.20181E-5 41604 0 NA
19-14876498-C-T p.Pro251Pro synonymous EMR2 3 83070 3.61141E-5 41535 0 3.33946E-5
19-14876499-G-C p.Pro251Arg missense EMR2 1 83052 1.20406E-5 41526 0 1.91424E-4
19-14876506-C-T p.Gly249Arg missense EMR2 3 82880 3.61969E-5 41440 0 9.17125E-5
19-14876507-G-A c.-40C>T 5_prime_UTR_premature_start_codon_gain EMR2 12 82850 1.4484E-4 41425 0 0.00125
19-14876520-C-T p.Trp244* stop_gained EMR2 1 82596 1.21071E-5 41298 0 0.00100705
19-14876526-G-A p.Pro242Leu missense EMR2 1 82522 1.2118E-5 41261 0 NA
19-14876527-G-GGCGGCA p.Arg241_Pro242insCysArg conservative_inframe_insertion EMR2 1 82506 1.21203E-5 41253 0 3.98578E-6
19-14876527-G-T p.Pro242Thr missense EMR2 1 82506 1.21203E-5 41253 0 NA
19-14876529-C-T p.Arg241His missense EMR2 15 82404 1.8203E-4 41202 0 9.29924E-4
19-14876530-G-A p.Arg241Cys missense EMR2 3 82466 3.63786E-5 41233 0 2.39175E-5
19-14876535-C-T p.Arg239His missense EMR2 4 82424 4.85296E-5 41212 0 3.31757E-5
19-14876536-G-A p.Arg239Cys missense EMR2 2 82410 2.42689E-5 41205 0 9.12106E-5
19-14876543-G-A p.Tyr236Tyr synonymous EMR2 2 82282 2.43067E-5 41141 0 3.22914E-5
19-14876550-C-T p.Gly234Asp missense EMR2 1 82294 1.21516E-5 41147 0 NA
19-14876554-C-T p.Val233Met missense EMR2 2 82284 2.43061E-5 41142 0 4.98173E-5
19-14876555-G-T p.Thr232Thr synonymous EMR2 4 82260 4.86263E-5 41130 0 0.00151057
19-14876555-G-A c.-88C>T 5_prime_UTR_premature_start_codon_gain EMR2 1 82296 1.21513E-5 41148 0 6.25782E-4
19-14876558-G-T p.Asn231Lys missense EMR2 1 82298 1.2151E-5 41149 0 NA
19-14876564-G-A p.Cys229Cys synonymous EMR2 1 82276 1.21542E-5 41138 0 NA
19-14876569-C-T p.Val228Ile missense EMR2 10 82240 1.21595E-4 41120 0 2.25095E-4
19-14876570-G-A c.-103C>T 5_prime_UTR_premature_start_codon_gain EMR2 3 82242 3.64777E-5 41121 0 1.9159E-4
19-14876573-G-A p.Ser226Ser synonymous EMR2 1 82250 1.21581E-5 41125 0 NA
19-14876596-C-T p.Gly219Arg missense EMR2 1 81650 1.22474E-5 40825 0 3.19224E-5
19-14876597-G-A c.-130C>T 5_prime_UTR_premature_start_codon_gain EMR2 21 81428 2.57897E-4 40714 0 0.0015873
19-14876605-A-G p.Cys216Arg missense EMR2 2 81336 2.45894E-5 40668 0 1.68691E-5
19-14876606-C-T c.-139G>A 5_prime_UTR_premature_start_codon_gain EMR2 1 81316 1.22977E-5 40658 0 NA
19-14876606-C-A p.Glu215Asp missense EMR2 1 81316 1.22977E-5 40658 0 NA
19-14876609-G-A c.-142C>T 5_prime_UTR_premature_start_codon_gain EMR2 1 81070 1.2335E-5 40535 0 8.87154E-5
19-14876613-A-G p.Val213Ala missense EMR2 3 80872 3.70957E-5 40436 0 9.35454E-5
19-14876618-T-G c.635-2A>C splice_acceptor EMR2 2 80588 2.48176E-5 40294 0 6.37633E-5
19-14876622-G-A c.635-6C>T splice_region EMR2 3 80198 3.74074E-5 40099 0 8.09107E-6
19-14877043-C-T c.634+4G>A splice_region EMR2 21986 82654 0.266 41327 3073 0.285376
19-14877052-C-T p.Cys210Tyr missense EMR2 1 83318 1.20022E-5 41659 0 3.18674E-5
19-14877056-C-T p.Val209Ile missense EMR2 3 83320 3.60058E-5 41660 0 5.77605E-5
19-14877073-T-C p.Asn203Ser missense EMR2 13 83286 1.56089E-4 41643 0 0.00100705
19-14877074-TG-T p.Asn203fs frameshift EMR2 1 83278 1.2008E-5 41639 0 6.37267E-5
19-14877075-G-A p.Pro202Pro synonymous EMR2 1 83274 1.20085E-5 41637 0 8.25287E-6
19-14877078-G-A p.Ser201Ser synonymous EMR2 1 83250 1.2012E-5 41625 0 NA
19-14877079-G-C p.Ser201Cys missense EMR2 1 83228 1.20152E-5 41614 0 3.98273E-6
19-14877085-G-A p.Pro199Leu missense EMR2 36 83218 4.32599E-4 41609 0 2.50962E-4
19-14877090-C-T p.Pro197Pro synonymous EMR2 4 83216 4.80677E-5 41608 0 NA
19-14877091-G-A p.Pro197Leu missense EMR2 4 83204 4.80746E-5 41602 0 6.25E-4
19-14877097-C-T p.Trp195* stop_gained EMR2 14 83178 1.68314E-4 41589 0 2.06912E-4
19-14877102-C-T p.Pro193Pro synonymous EMR2 708 83146 0.00851514 41573 17 0.0202401
19-14877106-C-T p.Arg192His missense EMR2 3 83162 3.60742E-5 41581 0 1.07426E-4
19-14877112-C-T p.Arg190His missense EMR2 3 83162 3.60742E-5 41581 0 1.27502E-4
19-14877115-C-T p.Cys189Tyr missense EMR2 4 83172 4.80931E-5 41586 0 1.91253E-4
19-14877116-A-G p.Cys189Arg missense EMR2 1 83176 1.20227E-5 41588 0 NA
19-14877117-C-G p.Gln188His missense EMR2 96 83170 0.00115426 41585 1 0.00302837
19-14877118-T-C p.Gln188Arg missense EMR2 9 83174 1.08207E-4 41587 0 4.73413E-4
19-14877131-C-A p.Val184Leu missense EMR2 1 83160 1.2025E-5 41580 0 3.97833E-6
19-14877131-C-T p.Val184Met missense EMR2 3 83160 3.6075E-5 41580 0 1.47198E-4
19-14877132-G-T p.Asn183Lys missense EMR2 1 83166 1.20241E-5 41583 0 NA
19-14877147-G-A p.Thr178Thr synonymous EMR2 9 83168 1.08215E-4 41584 0 5.03525E-4
19-14877148-G-T p.Thr178Asn missense EMR2 326 83132 0.00392147 41566 4 0.00777664
19-14877148-G-A p.Thr178Ile missense EMR2 1 83172 1.20233E-5 41586 0 NA
19-14877157-T-C p.His175Arg missense EMR2 20 83136 2.4057E-4 41568 1 0.00503525
19-14877157-T-G p.His175Pro missense EMR2 21 83136 2.52598E-4 41568 0 1.71056E-4
19-14877162-T-C p.Pro173Pro synonymous EMR2 5 83114 6.01583E-5 41557 0 0.00151057
19-14877173-C-T p.Gly170Arg missense EMR2 3 83092 3.61046E-5 41546 0 3.58109E-5
19-14877174-G-A p.Ser169Ser synonymous EMR2 4 83086 4.81429E-5 41543 0 6.37511E-5
19-14877176-A-C p.Ser169Ala missense EMR2 1 83072 1.20378E-5 41536 0 NA
19-14877179-T-G p.Thr168Pro missense EMR2 1 83024 1.20447E-5 41512 0 1.4893E-4
19-14877180-G-T p.Cys167* stop_gained EMR2 2 83022 2.409E-5 41511 0 NA
19-14877182-A-G p.Cys167Arg missense EMR2 98 83016 0.0011805 41508 0 0.00654582
19-14877200-A-G c.488-7T>C splice_region EMR2 342 82562 0.00414234 41281 3 0.00867845
19-14877792-G-C p.Thr162Arg missense+splice_region EMR2 2 74396 2.68832E-5 37198 0 1.02343E-5
19-14877799-G-C p.Leu160Val missense EMR2 16982 50830 0.334094 25415 6255 0.528788
19-14877803-C-T p.Pro158Pro synonymous EMR2 2 69262 2.88759E-5 34631 0 NA
19-14877806-G-A p.Asp157Asp synonymous EMR2 12576 47890 0.262602 23945 4494 0.480454
19-14877816-T-A p.Lys154Ile missense EMR2 6727 45520 0.147781 22760 2416 0.422882
19-14877820-G-A p.Leu153Phe missense EMR2 5616 46008 0.122066 23004 2120 0.384123
19-14877841-G-A p.Gln146* stop_gained EMR2 42 61594 6.81885E-4 30797 14 0.00228061
19-14877845-C-G c.-205G>C 5_prime_UTR_premature_start_codon_gain EMR2 2591 43936 0.0589721 21968 1139 0.123983
19-14877847-T-G p.Thr144Pro missense EMR2 2 60514 3.30502E-5 30257 0 9.16776E-4
19-14877848-G-A p.Tyr143Tyr synonymous EMR2 2852 43308 0.0658539 21654 1215 0.130225
19-14877856-C-T p.Gly141Ser missense EMR2 1 66358 1.50698E-5 33179 0 1.62006E-5
19-14877857-G-A c.-217C>T 5_prime_UTR_premature_start_codon_gain EMR2 9920 49320 0.201135 24660 4162 0.424195
19-14877868-C-T p.Val137Ile missense EMR2 1 73576 1.35914E-5 36788 0 3.69905E-5
19-14877869-G-A p.Cys136Cys synonymous EMR2 6 74078 8.09957E-5 37039 0 3.18095E-4
19-14877877-C-G p.Gly134Arg missense EMR2 3 77378 3.87707E-5 38689 1 1.31699E-5
19-14877877-C-T p.Gly134Ser missense EMR2 1 77382 1.29229E-5 38691 0 8.89173E-6
19-14877878-G-A c.-238C>T 5_prime_UTR_premature_start_codon_gain EMR2 4 77794 5.14178E-5 38897 0 1.58297E-4
19-14877880-AG-A p.Tyr133fs frameshift EMR2 21 78492 2.67543E-4 39246 0 5.05561E-4
19-14877890-G-A c.-250C>T 5_prime_UTR_premature_start_codon_gain EMR2 1 80204 1.24682E-5 40102 0 8.39088E-6
19-14877913-C-T p.Glu122Lys missense EMR2 9 81844 1.09965E-4 40922 0 1.32153E-4
19-14877914-G-A c.-274C>T 5_prime_UTR_premature_start_codon_gain EMR2 22 81884 2.68673E-4 40942 0 0.00194049
19-14877919-C-T p.Val120Met missense+splice_region EMR2 3 82072 3.65533E-5 41036 0 2.28058E-4
19-14883154-C-G p.Asp119His missense+splice_region EMR2 6 83384 7.19563E-5 41692 0 6.37186E-5
19-14883154-C-T p.Asp119Asn missense+splice_region EMR2 2 83384 2.39854E-5 41692 0 NA
19-14883161-C-T c.-289G>A 5_prime_UTR_premature_start_codon_gain EMR2 1 83400 1.19904E-5 41700 0 1.98836E-5
19-14883162-G-A p.Thr116Met missense EMR2 1 83402 1.19901E-5 41701 0 5.28541E-4
19-14883170-G-A p.Ser113Ser synonymous EMR2 7 83408 8.39248E-5 41704 0 3.18756E-5
19-14883185-T-A p.Thr108Thr synonymous EMR2 2 83426 2.39733E-5 41713 0 5.28541E-4
19-14883202-C-T p.Val103Ile missense EMR2 21 83422 2.51732E-4 41711 0 7.6477E-4
19-14883215-T-C p.Pro98Pro synonymous EMR2 20 83414 2.39768E-4 41707 0 0.00125
19-14883217-G-C p.Pro98Ala missense EMR2 1 83422 1.19872E-5 41711 0 NA
19-14883226-C-T p.Val95Met missense EMR2 14 83414 1.67838E-4 41707 0 5.09652E-4
19-14883227-G-A p.Cys94Cys synonymous EMR2 2 83414 2.39768E-5 41707 0 3.97659E-5
19-14883235-A-T p.Tyr92Asn missense EMR2 1 83412 1.19887E-5 41706 0 3.97649E-6
19-14883241-CCT-C p.Glu89fs frameshift EMR2 1 83402 1.19901E-5 41701 0 NA
19-14883255-CA-C p.Cys85fs frameshift EMR2 2 83398 2.39814E-5 41699 0 NA
19-14883260-C-T p.Ser83Ser synonymous EMR2 5 83394 5.99564E-5 41697 0 6.25E-4
19-14883261-G-A p.Ser83Leu missense EMR2 2 83392 2.39831E-5 41696 0 4.37466E-5
19-14883271-C-T p.Gly80Arg missense EMR2 2 83378 2.39871E-5 41689 0 9.06783E-5
19-14883272-G-T p.Cys79* stop_gained EMR2 2 83378 2.39871E-5 41689 0 NA
19-14883272-G-A p.Cys79Cys synonymous EMR2 1 83378 1.19936E-5 41689 0 1.64897E-5
19-14883274-A-G p.Cys79Arg missense EMR2 2 83382 2.3986E-5 41691 0 3.18715E-5
19-14883284-C-T p.Ser75Ser synonymous EMR2 39 83380 4.67738E-4 41690 0 3.30469E-4
19-14883292-T-C p.Thr73Ala missense EMR2 5 83364 5.99779E-5 41682 0 4.97504E-5
19-14883295-C-T p.Ala72Thr missense EMR2 1 83358 1.19964E-5 41679 0 1.98908E-5
19-14883299-C-CT p.Cys71fs frameshift EMR2 1 83346 1.19982E-5 41673 0 NA
19-14883299-C-A p.Glu70Asp missense EMR2 1 83346 1.19982E-5 41673 0 3.97877E-6
19-14883301-C-T p.Glu70Lys missense EMR2 2 83342 2.39975E-5 41671 0 NA
19-14883301-CGTT-C p.Asn69del conservative_inframe_deletion EMR2 5 83342 5.99938E-5 41671 0 1.00167E-4
19-14883302-G-A p.Asn69Asn synonymous EMR2 9 83338 1.07994E-4 41669 0 1.91192E-4
19-14883308-G-A p.Asp67Asp splice_region+synonymous EMR2 1 83310 1.20034E-5 41655 0 NA
19-14883309-T-A p.Asp67Val missense+splice_region EMR2 1 83304 1.20042E-5 41652 0 1.68144E-5
19-14883314-A-G c.200-5T>C splice_region EMR2 17 83276 2.0414E-4 41638 0 1.27494E-4
19-14884749-C-A c.199+1G>T splice_donor EMR2 5 83304 6.00211E-5 41652 0 3.57896E-5
19-14884750-C-T p.Asp67Asn missense+splice_region EMR2 2 83308 2.40073E-5 41654 0 1.59063E-5
19-14884751-G-A p.Asp66Asp splice_region+synonymous EMR2 3989 83000 0.0480602 41500 156 0.081571
19-14884755-C-G p.Cys65Ser missense EMR2 3 83316 3.60075E-5 41658 0 3.29522E-5
19-14884758-G-A p.Thr64Ile missense EMR2 2 83320 2.40038E-5 41660 0 1.56518E-4
19-14884760-C-T p.Glu63Glu synonymous EMR2 1 83322 1.20016E-5 41661 0 3.29511E-5
19-14884764-A-G p.Met62Thr missense EMR2 9 83312 1.08028E-4 41656 0 5.03525E-4
19-14884765-T-C p.Met62Val missense EMR2 1 83322 1.20016E-5 41661 0 NA
19-14884766-G-C p.Pro61Pro synonymous EMR2 9 83306 1.08035E-4 41653 0 5.03525E-4
19-14884782-T-C p.Glu56Gly missense EMR2 1 83304 1.20042E-5 41652 0 NA
19-14884802-T-A p.Pro49Pro synonymous EMR2 2 83264 2.402E-5 41632 0 3.19183E-5
19-14884806-T-C p.Asn48Ser missense EMR2 1 83242 1.20132E-5 41621 0 NA
19-14884807-T-C p.Asn48Asp missense EMR2 2 83232 2.40292E-5 41616 0 1.19293E-5
19-14884811-G-T p.Arg46Arg synonymous EMR2 10 83208 1.20181E-4 41604 0 9.88517E-5
19-14884812-C-T p.Arg46His missense EMR2 8 83202 9.61515E-5 41601 0 8.74835E-5
19-14884813-G-A p.Arg46Cys missense EMR2 1 83198 1.20195E-5 41599 0 3.18857E-5
19-14884815-C-T p.Cys45Tyr missense EMR2 1 83188 1.2021E-5 41594 0 1.64756E-5
19-14884819-C-T p.Ala44Thr missense EMR2 2 83174 2.4046E-5 41587 0 3.295E-5
19-14884820-G-A p.Thr43Thr synonymous EMR2 3 83166 3.60724E-5 41583 0 3.18776E-5
19-14884841-G-A p.Asp36Asp synonymous EMR2 3941 82720 0.0476426 41360 144 0.0784413
19-14884841-G-C p.Asp36Glu missense EMR2 1 83032 1.20435E-5 41516 0 NA
19-14884843-C-T p.Asp36Asn missense EMR2 18 82958 2.16977E-4 41479 0 0.01625
19-14884857-C-T p.Arg31Gln missense EMR2 3 82820 3.62231E-5 41410 0 3.19285E-5
19-14884863-C-T p.Cys29Tyr missense EMR2 4 82762 4.83314E-5 41381 0 2.74435E-4
19-14885062-A-G c.82+6T>C splice_region EMR2 1 75010 1.33316E-5 37505 0 3.24002E-5
19-14885066-A-C c.82+2T>G splice_donor EMR2 5 75328 6.63764E-5 37664 0 3.22393E-5
19-14885071-T-C p.Arg27Gly missense EMR2 1 75862 1.31818E-5 37931 0 6.42261E-5
19-14885079-T-C p.Gln24Arg missense EMR2 6 76380 7.85546E-5 38190 1 1.17802E-4
19-14885093-C-A p.Pro19Pro synonymous EMR2 1 76910 1.30022E-5 38455 0 NA
19-14885094-G-A p.Pro19Leu missense EMR2 1 77006 1.2986E-5 38503 0 0.0019084
19-14885096-CAG-C p.Leu18fs frameshift EMR2 1 77134 1.29645E-5 38567 0 6.84463E-5
19-14885125-C-T c.32-7G>A splice_region EMR2 25 76498 3.26806E-4 38249 0 0.00105901
19-14887208-GCACT-G n.203+4_203+7delAGTG splice_region EMR2 1 13902 7.19321E-5 6951 0 9.74089E-5
19-14887535-T-C c.31+3A>G splice_region EMR2 6 82130 7.30549E-5 41065 0 5.2432E-5
19-14887537-CCGAGAAAGA-C p.Val8_Leu10del disruptive_inframe_deletion EMR2 5 82204 6.08243E-5 41102 0 1.63619E-4
19-14887537-C-CCGAGAAAGA p.Val8_Leu10dup conservative_inframe_insertion EMR2 1 82204 1.21649E-5 41102 0 2.04524E-5
19-14887545-G-C p.Val8Val synonymous EMR2 1 82262 1.21563E-5 41131 0 NA
19-14887555-A-T p.Val5Asp missense EMR2 1 82270 1.21551E-5 41135 0 3.18898E-5
19-14887557-G-T p.Arg4Arg synonymous EMR2 3 82252 3.64733E-5 41126 0 3.79615E-5
19-14887558-C-T p.Arg4His missense EMR2 1 82278 1.21539E-5 41139 0 NA
19-14887565-C-T p.Gly2Arg missense EMR2 2 82318 2.4296E-5 41159 0 NA
19-14887566-C-A p.Met1? start_lost EMR2 1 82320 1.21477E-5 41160 0 6.57821E-5
19-14887567-A-G p.Met1? start_lost EMR2 2 82292 2.43037E-5 41146 0 1.12594E-4
19-14887578-T-A c.-10A>T 5_prime_UTR_premature_start_codon_gain EMR2 21 82258 2.55294E-4 41129 0 9.33219E-5
19-14887592-G-C c.-24C>G 5_prime_UTR_premature_start_codon_gain EMR2 1 82306 1.21498E-5 41153 0 4.03998E-6
19-14887649-G-A c.-81C>T 5_prime_UTR_premature_start_codon_gain EMR2 18 81516 2.20816E-4 40758 0 5.7387E-4
19-14887656-G-A c.-88C>T 5_prime_UTR_premature_start_codon_gain EMR2 10 81456 1.22766E-4 40728 0 2.23342E-4
19-14887666-G-A c.-98C>T 5_prime_UTR_premature_start_codon_gain EMR2 1 81232 1.23104E-5 40616 0 NA
19-14887696-G-A c.-128C>T 5_prime_UTR_premature_start_codon_gain EMR2 1 80100 1.24844E-5 40050 0 NA
19-14887703-C-A c.-135G>T 5_prime_UTR_premature_start_codon_gain EMR2 1 79906 1.25147E-5 39953 0 NA
19-14887740-C-A c.-171-1G>T splice_acceptor EMR2 7 78326 8.93701E-5 39163 0 3.1953E-5
19-14887744-A-G c.-171-5T>C splice_region EMR2 5 78098 6.40221E-5 39049 0 NA
19-14889063-A-G c.-172+6T>C splice_region EMR2 1 4408 2.2686E-4 2204 0 3.18715E-5
19-14889114-G-A c.-217C>T 5_prime_UTR_premature_start_codon_gain EMR2 1 9686 1.03242E-4 4843 0 NA
19-14889162-G-A c.-265C>T 5_prime_UTR_premature_start_codon_gain EMR2 1 14672 6.8157E-5 7336 0 1.59246E-4
19-14889238-A-C c.-341T>G 5_prime_UTR_premature_start_codon_gain EMR2 1 23446 4.26512E-5 11723 0 NA
19-14889267-T-C c.-370A>G 5_prime_UTR_premature_start_codon_gain EMR2 2 24304 8.2291E-5 12152 0 3.18898E-5