Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-6887623-C-T p.Arg2Cys missense EMR1 3 83222 3.60482E-5 41611 0 1.40367E-4
19-6887624-G-T p.Arg2Leu missense EMR1 675 83202 0.00811279 41601 13 0.0144941
19-6887624-G-A p.Arg2His missense EMR1 2 83220 2.40327E-5 41610 0 9.55657E-5
19-6887634-C-A p.Asn5Lys missense EMR1 1 83198 1.20195E-5 41599 0 6.25E-4
19-6887638-C-T p.Leu7Phe missense EMR1 1 83200 1.20192E-5 41600 0 8.23968E-6
19-6887640-C-T p.Leu7Leu synonymous EMR1 12 83202 1.44227E-4 41601 0 0.00100705
19-6887649-G-T p.Trp10Cys missense+splice_region EMR1 2 83160 2.405E-5 41580 0 3.18552E-5
19-6887650-G-C p.Gly11Arg missense+splice_region EMR1 1 83142 1.20276E-5 41571 0 NA
19-6887651-G-GA c.31+1_31+2insA splice_donor EMR1 1 83150 1.20265E-5 41575 0 NA
19-6887651-G-T c.31+1G>T splice_donor EMR1 1 83150 1.20265E-5 41575 0 1.21252E-5
19-6890484-C-T c.32-8C>T splice_region EMR1 1 81814 1.22228E-5 40907 0 0.015885
19-6890484-C-A c.32-8C>A splice_region EMR1 4 81992 4.87852E-5 40996 0 NA
19-6890504-T-C p.Met15Thr missense EMR1 1 82994 1.20491E-5 41497 0 NA
19-6890510-G-A p.Ser17Asn missense EMR1 1 83080 1.20366E-5 41540 0 NA
19-6890513-G-A p.Trp18* stop_gained EMR1 2 83120 2.40616E-5 41560 0 8.71688E-6
19-6890523-C-T p.His21His synonymous EMR1 2 83184 2.40431E-5 41592 0 1.19581E-5
19-6890524-A-G p.Ile22Val missense EMR1 1 83200 1.20192E-5 41600 0 NA
19-6890531-C-T p.Pro24Leu missense EMR1 1 83222 1.20161E-5 41611 0 3.21481E-5
19-6890536-C-G p.Arg26Gly missense EMR1 1 83236 1.2014E-5 41618 0 NA
19-6890537-G-A p.Arg26Gln missense EMR1 1 83248 1.20123E-5 41624 0 3.48159E-5
19-6890542-C-T p.Pro28Ser missense EMR1 1 83250 1.2012E-5 41625 0 NA
19-6890542-C-CCAAACA p.Asn29_Thr30dup disruptive_inframe_insertion EMR1 1 83250 1.2012E-5 41625 0 NA
19-6890546-A-G p.Asn29Ser missense EMR1 1 83262 1.20103E-5 41631 0 NA
19-6890547-C-T p.Asn29Asn synonymous EMR1 1 83256 1.20111E-5 41628 0 1.99497E-5
19-6890562-G-A c.94+8G>A splice_region EMR1 1 83218 1.20166E-5 41609 0 NA
19-6896408-G-T c.95-1G>T splice_acceptor EMR1 1 83326 1.20011E-5 41663 0 3.18512E-5
19-6896414-A-G p.Asn34Asp missense EMR1 1 83324 1.20013E-5 41662 0 3.18451E-5
19-6896427-G-T p.Ser38Ile missense EMR1 2 83310 2.40067E-5 41655 0 NA
19-6896430-C-A p.Thr39Asn missense EMR1 5 83320 6.00096E-5 41660 0 4.37773E-5
19-6896431-C-A p.Thr39Thr synonymous EMR1 7 83322 8.40114E-5 41661 0 0.00100705
19-6896439-C-A p.Pro42Gln missense EMR1 1 83304 1.20042E-5 41652 0 3.97918E-6
19-6896455-C-A p.Cys47* stop_gained EMR1 1 83296 1.20054E-5 41648 0 NA
19-6896471-A-G p.Ser53Gly missense EMR1 1 83278 1.2008E-5 41639 0 2.47117E-5
19-6896472-G-C p.Ser53Thr missense EMR1 46 83274 5.52393E-4 41637 0 2.22769E-4
19-6896473-T-C p.Ser53Ser synonymous EMR1 1 83274 1.20085E-5 41637 0 NA
19-6896477-T-C p.Tyr55His missense EMR1 1 83274 1.20085E-5 41637 0 NA
19-6896478-A-G p.Tyr55Cys missense EMR1 10 83264 1.201E-4 41632 0 1.59266E-4
19-6896482-C-T p.Cys56Cys synonymous EMR1 20 83260 2.40211E-4 41630 0 6.17813E-4
19-6896483-G-A p.Ala57Thr missense EMR1 26605 83030 0.320426 41515 4272 0.374375
19-6896483-GC-AT p.Ala57Ile missense EMR1 2 83260 2.40211E-5 41630 0 NA
19-6896483-G-T p.Ala57Ser missense EMR1 1 83260 1.20106E-5 41630 0 8.24008E-6
19-6896514-G-A p.Gly67Glu missense EMR1 3 83260 3.60317E-5 41630 0 3.97874E-5
19-6896515-G-A p.Gly67Gly synonymous EMR1 1 83264 1.201E-5 41632 0 1.1937E-5
19-6896515-G-C p.Gly67Gly synonymous EMR1 4 83264 4.804E-5 41632 0 2.47349E-5
19-6896516-C-A p.Gln68Lys missense EMR1 2 83264 2.402E-5 41632 0 7.95767E-6
19-6896527-C-G p.Phe71Leu missense EMR1 3 83250 3.6036E-5 41625 0 1.65199E-5
19-6896534-C-T p.Pro74Ser missense EMR1 1 83244 1.20129E-5 41622 0 NA
19-6896544-G-A p.Arg77Gln missense EMR1 1 83194 1.20201E-5 41597 0 3.33823E-5
19-6896550-A-C p.Lys79Thr missense+splice_region EMR1 12 83176 1.44272E-4 41588 0 0.00100705
19-6897152-C-G c.239-8C>G splice_region EMR1 1 82324 1.21471E-5 41162 0 NA
19-6897173-T-C p.Cys84Cys synonymous EMR1 422 82936 0.00508826 41468 3 0.0103992
19-6897177-C-T p.Gln86* stop_gained EMR1 8 83012 9.63716E-5 41506 0 2.78827E-5
19-6897181-G-A p.Ser87Asn missense EMR1 1 83076 1.20372E-5 41538 0 NA
19-6897182-C-T p.Ser87Ser synonymous EMR1 1 83068 1.20383E-5 41534 0 3.22352E-5
19-6897184-C-G p.Pro88Arg missense EMR1 2 83108 2.40651E-5 41554 0 3.98038E-6
19-6897195-G-C p.Gly92Arg missense EMR1 561 83206 0.0067423 41603 4 0.0133389
19-6897195-G-A p.Gly92Ser missense EMR1 1 83240 1.20135E-5 41620 0 8.26911E-6
19-6897203-C-T p.Asn94Asn synonymous EMR1 2 83284 2.40142E-5 41642 0 6.42343E-5
19-6897219-C-A p.Leu100Met missense EMR1 2 83338 2.39987E-5 41669 0 3.58049E-5
19-6897221-G-C p.Leu100Leu synonymous EMR1 2 83342 2.39975E-5 41671 0 3.30087E-5
19-6897230-G-A p.Arg103Arg synonymous EMR1 1 83366 1.19953E-5 41683 0 NA
19-6897259-C-T p.Ser113Phe missense EMR1 8 83400 9.59233E-5 41700 0 1.6487E-5
19-6897265-C-T p.Pro115Leu missense EMR1 1 83402 1.19901E-5 41701 0 1.64864E-5
19-6897275-T-C p.Asn118Asn synonymous EMR1 2 83406 2.39791E-5 41703 0 3.29685E-5
19-6897282-G-A p.Val121Ile missense EMR1 497 83342 0.00596338 41671 5 0.0128705
19-6897295-C-T p.Pro125Leu missense EMR1 1 83396 1.1991E-5 41698 0 1.27959E-4
19-6897296-G-A p.Pro125Pro synonymous EMR1 3 83394 3.59738E-5 41697 0 6.25E-4
19-6897299-C-A p.Gly126Gly synonymous EMR1 158 83392 0.00189467 41696 0 0.00255526
19-6897299-C-T p.Gly126Gly synonymous EMR1 1 83396 1.1991E-5 41698 0 7.95469E-6
19-6897307-C-A p.Ser129Tyr missense EMR1 14 83394 1.67878E-4 41697 0 6.25E-4
19-6897307-C-T p.Ser129Phe missense EMR1 1 83396 1.1991E-5 41698 0 3.97731E-6
19-6897309-T-C p.Cys130Arg missense EMR1 117 83388 0.00140308 41694 0 0.00302115
19-6897312-A-G p.Thr131Ala missense EMR1 1 83392 1.19916E-5 41696 0 1.1933E-5
19-6897314-TGGTAATGCTCTCAGGTTCCCAGGGATGGGTCTTGGGTGGATATCTATCAGTGGGGTGAGTTCATGTATTTCTGAACTGAGGCACCCAATTTCTTATCTGCTCACCCTCTTCCACTGCTTCTCA-T p.Asp132fs frameshift EMR1 5 83392 5.99578E-5 41696 2 NA
19-6897318-A-G c.394+3A>G splice_region EMR1 1 83376 1.19939E-5 41688 0 1.1935E-5
19-6897452-C-A p.Cys136* stop_gained EMR1 1 83264 1.201E-5 41632 0 8.53264E-6
19-6897455-C-A p.Leu137Leu synonymous EMR1 1 83266 1.20097E-5 41633 0 NA
19-6897456-A-T p.Thr138Ser missense EMR1 3 83270 3.60274E-5 41635 0 8.60023E-6
19-6897457-C-T p.Thr138Ile missense EMR1 1 83262 1.20103E-5 41631 0 NA
19-6897459-A-G p.Ser139Gly missense EMR1 1 83254 1.20114E-5 41627 0 1.27437E-4
19-6897460-G-T p.Ser139Ile missense+splice_region EMR1 1 83238 1.20137E-5 41619 0 4.23948E-6
19-6897464-C-G c.418+2C>G splice_donor EMR1 31484 82498 0.381633 41249 6692 0.433574
19-6897465-G-A p.Val141Ile missense EMR1 3 83214 3.60516E-5 41607 0 1.19974E-4
19-6897472-C-G p.Pro143Arg missense EMR1 4 83210 4.80711E-5 41605 1 1.68801E-5
19-6897474-G-T p.Glu144* stop_gained EMR1 16 83194 1.92322E-4 41597 0 8.57501E-5
19-6897489-G-A p.Val149Ile missense EMR1 1 83152 1.20262E-5 41576 0 4.24117E-6
19-6897503-A-AGAAGAG p.Gly153_Ser154insGluGlu conservative_inframe_insertion EMR1 1 83084 1.2036E-5 41542 0 NA
19-6897506-C-G p.Ser154Arg missense EMR1 1 83042 1.20421E-5 41521 0 NA
19-6897511-G-A p.Ser156Asn missense EMR1 10 83024 1.20447E-4 41512 0 5.03525E-4
19-6897518-C-T p.Ser158Ser synonymous EMR1 2 82938 2.41144E-5 41469 0 4.06891E-4
19-6897519-TG-T p.Cys159fs frameshift EMR1 1 82918 1.20601E-5 41459 0 NA
19-6897524-A-G p.Gln160Gln synonymous EMR1 1 82888 1.20645E-5 41444 0 NA
19-6897530-A-G p.Gly162Gly synonymous EMR1 1 82834 1.20723E-5 41417 0 NA
19-6897533-C-T p.Phe163Phe synonymous EMR1 1 82804 1.20767E-5 41402 0 NA
19-6897535-T-A p.Ile164Asn missense EMR1 3 82810 3.62275E-5 41405 0 NA
19-6897543-A-C p.Asn167His missense EMR1 2 82710 2.41809E-5 41355 0 3.18695E-5
19-6897553-G-C p.Cys170Ser missense EMR1 1 82572 1.21106E-5 41286 0 1.77393E-5
19-6897555-G-T p.Glu171* stop_gained EMR1 1 82542 1.2115E-5 41271 0 NA
19-6897925-TTTCCTTCCTTCC-T n.807_*1delTTCCTTCCTTCC splice_region EMR1 62 3786 0.0163761 1893 3 0.0293051
19-6897925-TTTCCTTCCTTCCTTCC-T n.807_*5delTTCCTTCCTTCCTTCC splice_region EMR1 2 3834 5.21648E-4 1917 0 NA
19-6901887-C-T p.Asp172Asp splice_region+synonymous EMR1 4 83276 4.8033E-5 41638 0 6.59261E-5
19-6901888-G-A p.Val173Met missense+splice_region EMR1 1 83272 1.20088E-5 41636 0 3.18451E-5
19-6901891-G-A p.Asp174Asn missense EMR1 26920 82672 0.325624 41336 4766 0.372608
19-6901904-A-C p.Asp178Ala missense EMR1 1 83310 1.20034E-5 41655 0 NA
19-6901906-C-G p.Pro179Ala missense EMR1 3 83308 3.60109E-5 41654 0 3.97798E-6
19-6901908-A-G p.Pro179Pro synonymous EMR1 1 83312 1.20031E-5 41656 0 NA
19-6901909-A-G p.Arg180Gly missense EMR1 1 83310 1.20034E-5 41655 0 NA
19-6901919-C-T p.Pro183Leu missense EMR1 2 83310 2.40067E-5 41655 0 NA
19-6901923-G-T p.Glu184Asp missense EMR1 1004 83294 0.0120537 41647 7 0.0117225
19-6901925-A-G p.His185Arg missense EMR1 1 83324 1.20013E-5 41662 0 3.18471E-5
19-6901926-T-C p.His185His synonymous EMR1 1 83324 1.20013E-5 41662 0 1.64734E-5
19-6901952-A-G p.Asn194Ser missense EMR1 1 83330 1.20005E-5 41665 0 NA
19-6901961-G-C p.Cys197Ser missense EMR1 221 83338 0.00265185 41669 2 0.01
19-6901972-C-T p.Pro201Ser missense EMR1 3 83348 3.59937E-5 41674 0 5.03525E-4
19-6901976-G-A p.Gly202Glu missense EMR1 2 83342 2.39975E-5 41671 0 NA
19-6902001-G-A p.Leu210Leu synonymous EMR1 3 83344 3.59954E-5 41672 0 3.18512E-5
19-6902024-C-T p.Ser218Leu missense EMR1 8 83358 9.59716E-5 41679 0 1.27397E-4
19-6902025-G-A p.Ser218Ser synonymous EMR1 3 83350 3.59928E-5 41675 0 2.22916E-4
19-6902032-G-GATATTGATGAATGCACTGAAAT c.661_661+1insATATTGATGAATGCACTGAAAT splice_donor EMR1 2 83338 2.39987E-5 41669 0 NA
19-6902034-T-A c.661+2T>A splice_donor EMR1 2 83318 2.40044E-5 41659 0 8.24294E-6
19-6903812-AC-A c.662-8delC splice_region EMR1 2 82506 2.42407E-5 41253 0 8.25001E-6
19-6903815-C-T c.662-6C>T splice_region EMR1 1 82558 1.21127E-5 41279 0 NA
19-6903843-G-A p.Met228Ile missense EMR1 1 82902 1.20624E-5 41451 0 NA
19-6903852-C-A p.Ile231Ile synonymous EMR1 1 82986 1.20502E-5 41493 0 NA
19-6903854-A-G p.Asn232Ser missense EMR1 1 83012 1.20465E-5 41506 0 8.23805E-6
19-6903864-C-G p.Cys235Trp missense EMR1 1 83038 1.20427E-5 41519 0 NA
19-6903880-A-T p.Ser241Cys missense EMR1 182 83080 0.00219066 41540 0 0.00806452
19-6903881-G-T p.Ser241Ile missense EMR1 1 83086 1.20357E-5 41543 0 NA
19-6903886-T-G p.Phe243Val missense EMR1 1 83102 1.20334E-5 41551 0 3.97985E-6
19-6903886-T-TTTTGCACCTGCCACCCTGGC p.Ser253fs frameshift EMR1 1 83102 1.20334E-5 41551 0 NA
19-6903897-C-A p.Cys246* stop_gained EMR1 2 83080 2.40732E-5 41540 0 6.25E-4
19-6903900-C-T p.His247His synonymous EMR1 1 83084 1.2036E-5 41542 0 2.3881E-5
19-6903902-C-G p.Pro248Arg missense EMR1 2 83088 2.40709E-5 41544 0 NA
19-6903920-A-G p.Asn254Ser missense EMR1 27194 82824 0.328335 41412 4905 0.370594
19-6903927-G-T p.Gln256His missense EMR1 1 83062 1.20392E-5 41531 0 NA
19-6903957-T-G p.Cys266Trp missense EMR1 26 83042 3.13095E-4 41521 1 6.3674E-5
19-6903959-GAGGTGAGCAGAGAGTTTGATGGACAATCCAGAAAAGACATTTCTCTTTGCTCTTCTGGGTTTCTTGATATTCTCCAGTTCTTTGC-G p.Asp268fs frameshift EMR1 10 83038 1.20427E-4 41519 3 NA
19-6903960-A-T p.Arg267Ser missense+splice_region EMR1 2 83048 2.40825E-5 41524 0 3.18431E-5
19-6903964-G-A c.802+3G>A splice_region EMR1 1 83042 1.20421E-5 41521 0 NA
19-6903967-CAG-C c.802+7_802+8delAG splice_region EMR1 1 83028 1.20441E-5 41514 0 8.23805E-6
19-6903969-G-C c.802+8G>C splice_region EMR1 1 83026 1.20444E-5 41513 0 3.1839E-5
19-6904051-T-G p.Ile269Met missense EMR1 1 83144 1.20273E-5 41572 0 NA
19-6904061-C-T p.Arg273Cys missense EMR1 1 83146 1.2027E-5 41573 0 2.47117E-5
19-6904062-G-A p.Arg273His missense EMR1 9 83142 1.08249E-4 41571 0 6.25E-4
19-6904066-A-G p.Gln274Gln synonymous EMR1 2 83146 2.40541E-5 41573 0 NA
19-6904067-G-A p.Asp275Asn missense EMR1 1 83152 1.20262E-5 41576 0 NA
19-6904094-A-G p.Ile284Val missense EMR1 1 83088 1.20354E-5 41544 0 4.11862E-5
19-6904096-C-A p.Ile284Ile synonymous EMR1 1 83074 1.20375E-5 41537 0 NA
19-6904105-T-C p.Asn287Asn synonymous EMR1 3 83070 3.61141E-5 41535 0 9.54988E-5
19-6904108-C-T p.Ala288Ala synonymous EMR1 1 83044 1.20418E-5 41522 0 7.96077E-6
19-6904119-A-C p.Tyr292Ser missense EMR1 7 82956 8.43821E-5 41478 1 3.18552E-5
19-6904137-C-T p.Ala298Val missense EMR1 26157 81444 0.321165 40722 4514 0.370594
19-6904161-G-T p.Gly306Val missense EMR1 1 82302 1.21504E-5 41151 0 3.18593E-5
19-6904164-C-T p.Ser307Phe missense EMR1 2 82250 2.43161E-5 41125 0 NA
19-6904168-G-GA p.Asp310fs frameshift EMR1 2 82196 2.43321E-5 41098 0 NA
19-6904171-A-G p.Lys309Lys synonymous EMR1 5 82162 6.08554E-5 41081 0 3.30568E-5
19-6904197-A-C c.949+4A>C splice_region EMR1 2 80942 2.47091E-5 40471 0 NA
19-6904197-A-G c.949+4A>G splice_region EMR1 1 80942 1.23545E-5 40471 0 NA
19-6906455-A-G p.Lys321Glu missense EMR1 1 83354 1.1997E-5 41677 0 3.98511E-6
19-6906469-T-C p.Asp325Asp synonymous EMR1 645 83348 0.00773864 41674 4 0.00655242
19-6906478-C-T p.Pro328Pro synonymous EMR1 3 83356 3.59902E-5 41678 0 1.64794E-5
19-6906479-G-A p.Asp329Asn missense EMR1 2 83356 2.39935E-5 41678 0 9.55536E-5
19-6906481-T-A p.Asp329Glu missense EMR1 1 83358 1.19964E-5 41679 0 NA
19-6906483-A-T p.Asn330Ile missense EMR1 1 83362 1.19959E-5 41681 0 NA
19-6906490-G-T p.Gln332His missense EMR1 1 83356 1.19967E-5 41678 0 NA
19-6906492-TC-T p.Gln334fs frameshift EMR1 2 83354 2.3994E-5 41677 0 NA
19-6906497-C-A p.Gln335Lys missense EMR1 1 83356 1.19967E-5 41678 0 1.64807E-5
19-6906503-C-T p.Gln337* stop_gained EMR1 23 83348 2.75951E-4 41674 0 5.4389E-4
19-6906508-G-A p.Glu338Glu synonymous EMR1 1 83348 1.19979E-5 41674 0 NA
19-6906514-C-T p.Thr340Thr synonymous EMR1 4 83336 4.79985E-5 41668 0 3.71195E-4
19-6906515-G-A p.Ala341Thr missense EMR1 5 83328 6.00038E-5 41664 0 1.31981E-4
19-6906533-G-GTCTCCTTTTGTGCACAAATAAATAACATCTTCAGCGTTCTGGA c.1038+1_1038+2insTCTCCTTTTGTGCACAAATAAATAACATCTTCAGCGTTCTGGA splice_donor EMR1 2 83274 2.40171E-5 41637 1 NA
19-6906535-A-C c.1038+3A>C splice_region EMR1 1 83264 1.201E-5 41632 0 NA
19-6906537-G-A c.1038+5G>A splice_region EMR1 1 83248 1.20123E-5 41624 0 2.51109E-5
19-6906539-A-AT c.1038+7_1038+8insT splice_region EMR1 33 83216 3.96558E-4 41608 1 4.77646E-4
19-6908695-C-T c.1039-5C>T splice_region EMR1 16 83110 1.92516E-4 41555 0 1.67196E-4
19-6908696-G-A c.1039-4G>A splice_region EMR1 22 83138 2.6462E-4 41569 0 2.37643E-4
19-6908716-A-G p.Gln352Arg missense EMR1 1 83372 1.19944E-5 41686 0 3.19795E-5
19-6908729-C-T p.Ile356Ile synonymous EMR1 3 83372 3.59833E-5 41686 0 1.65175E-5
19-6908736-G-A p.Val359Ile missense EMR1 1 83374 1.19941E-5 41687 0 3.20492E-5
19-6908747-AGT-A p.Cys364fs frameshift EMR1 1 83384 1.19927E-5 41692 0 NA
19-6908750-G-A p.Val363Val synonymous EMR1 3 83388 3.59764E-5 41694 0 4.43452E-5
19-6908759-T-C p.Asn366Asn synonymous EMR1 1 83376 1.19939E-5 41688 0 8.25137E-6
19-6908764-C-T p.Thr368Met missense EMR1 18 83386 2.15864E-4 41693 0 5.03525E-4
19-6908765-G-A p.Thr368Thr synonymous EMR1 11 83374 1.31936E-4 41687 0 6.25E-4
19-6908768-C-T p.Thr369Thr synonymous EMR1 1 83382 1.1993E-5 41691 0 2.42573E-5
19-6908769-G-A p.Val370Ile missense EMR1 3 83376 3.59816E-5 41688 0 9.90328E-5
19-6908770-T-C p.Val370Ala missense EMR1 1 83378 1.19936E-5 41689 0 3.23947E-5
19-6908772-G-A p.Val371Ile missense EMR1 1 83376 1.19939E-5 41688 0 NA
19-6908783-G-C p.Lys374Asn missense+splice_region EMR1 1 83366 1.19953E-5 41683 0 NA
19-6908784-G-A c.1122+1G>A splice_donor EMR1 1 83348 1.19979E-5 41674 0 4.15559E-6
19-6908788-C-T c.1122+5C>T splice_region EMR1 1 83332 1.20002E-5 41666 0 8.27486E-6
19-6908789-G-A c.1122+6G>A splice_region EMR1 1 83334 1.19999E-5 41667 0 2.1033E-5
19-6913665-A-G p.Asn375Ser missense+splice_region EMR1 1 83064 1.20389E-5 41532 0 NA
19-6913668-C-A p.Thr376Lys missense EMR1 1 83062 1.20392E-5 41531 0 1.70844E-5
19-6913677-G-A p.Ser379Asn missense EMR1 2 83172 2.40466E-5 41586 0 2.53674E-5
19-6913684-C-T p.Val381Val synonymous EMR1 2 83228 2.40304E-5 41614 0 NA
19-6913694-A-G p.Lys385Glu missense EMR1 2 83260 2.40211E-5 41630 0 4.00744E-6
19-6913702-A-T p.Ile387Ile synonymous EMR1 2 83286 2.40136E-5 41643 0 NA
19-6913707-C-T p.Thr389Met missense EMR1 17149 82964 0.206704 41482 1833 0.200906
19-6913708-G-T p.Thr389Thr synonymous EMR1 1 83292 1.2006E-5 41646 0 3.99616E-6
19-6913734-C-T p.Thr398Met missense EMR1 78 83324 9.36105E-4 41662 0 0.0040282
19-6913737-C-T p.Ser399Phe missense EMR1 2 83322 2.40033E-5 41661 0 3.98845E-6
19-6913743-T-C p.Leu401Pro missense EMR1 1 83332 1.20002E-5 41666 0 3.18492E-5
19-6913749-C-T p.Thr403Ile missense EMR1 1 83326 1.20011E-5 41663 0 8.24158E-6
19-6913770-A-C p.Glu410Ala missense EMR1 5 83304 6.00211E-5 41652 0 2.22987E-4
19-6913803-C-T p.Ser421Leu missense EMR1 4 83290 4.8025E-5 41645 0 8.24307E-6
19-6913811-A-G p.Ile424Val missense EMR1 59942 82376 0.727663 41188 21930 0.7825
19-6913818-C-T p.Pro426Leu missense EMR1 30 83224 3.60473E-4 41612 0 7.32344E-4
19-6913819-G-A p.Pro426Pro synonymous EMR1 3 83202 3.60568E-5 41601 0 6.36862E-5
19-6913826-CGGAC-AGAAT p.ArgThr429ArgMet missense EMR1 1 83136 1.20285E-5 41568 0 NA
19-6913826-C-T p.Arg429Trp missense EMR1 7 83136 8.41994E-5 41568 0 8.36372E-5
19-6913827-G-A p.Arg429Gln missense EMR1 2 83130 2.40587E-5 41565 0 5.03525E-4
19-6913830-C-T p.Thr430Met missense EMR1 6 83088 7.22126E-5 41544 0 1.59195E-4
19-6913831-G-A p.Thr430Thr synonymous EMR1 28 83078 3.37033E-4 41539 0 4.13907E-4
19-6913841-G-GACATTGAGAGCAAA c.1300_1300+1insACATTGAGAGCAAA splice_donor EMR1 2 82940 2.41138E-5 41470 1 NA
19-6913841-G-GACATTGAGAGCAAAGTTATCAACAAAGAATGCAGTGAAGAGAATGTGAC c.1300_1300+1insACATTGAGAGCAAAGTTATCAACAAAGAATGCAGTGAAGAGAATGTGAC splice_donor EMR1 2 82938 2.41144E-5 41469 1 NA
19-6913844-A-G c.1300+3A>G splice_region EMR1 28 82922 3.37667E-4 41461 0 8.2792E-4
19-6916269-G-A p.Ser437Asn missense EMR1 1 83244 1.20129E-5 41622 0 NA
19-6916271-A-C p.Lys438Gln missense EMR1 3 83264 3.603E-5 41632 0 2.47668E-5
19-6916272-A-C p.Lys438Thr missense EMR1 19 83262 2.28195E-4 41631 0 1.91119E-4
19-6916274-G-T p.Val439Phe missense EMR1 1 83278 1.2008E-5 41639 0 NA
19-6916278-T-C p.Ile440Thr missense EMR1 1 83264 1.201E-5 41632 0 3.99556E-6
19-6916282-C-G p.Asn441Lys missense EMR1 1 83272 1.20088E-5 41636 0 NA
19-6916298-G-A p.Glu447Lys missense EMR1 3 83312 3.60092E-5 41656 0 4.12147E-5
19-6916308-C-T p.Thr450Met missense EMR1 5 83330 6.00024E-5 41665 0 5.18147E-5
19-6916312-G-C p.Leu451Phe missense EMR1 1 83338 1.19993E-5 41669 0 NA
19-6916316-T-G p.Leu453Val missense EMR1 1 83330 1.20005E-5 41665 0 6.25E-4
19-6916329-G-C p.Gly457Ala missense EMR1 1 83334 1.19999E-5 41667 0 NA
19-6916340-A-C p.Lys461Gln missense EMR1 1 83328 1.20008E-5 41664 0 NA
19-6916345-C-T p.Ile462Ile synonymous EMR1 1 83318 1.20022E-5 41659 0 2.4759E-5
19-6916345-C-A p.Ile462Ile synonymous EMR1 2 83318 2.40044E-5 41659 0 NA
19-6916346-G-T p.Gly463Trp missense EMR1 1 83320 1.20019E-5 41660 0 NA
19-6916350-G-A p.Cys464Tyr missense EMR1 1 83320 1.20019E-5 41660 0 1.65145E-5
19-6916353-C-G p.Ser465Cys missense EMR1 1 83320 1.20019E-5 41660 0 NA
19-6916358-A-G p.Ile467Val missense EMR1 3 83306 3.60118E-5 41653 0 1.65475E-5
19-6916375-C-T p.Ser472Ser synonymous EMR1 1 83270 1.20091E-5 41635 0 1.19761E-5
19-6919551-A-G c.1421-8A>G splice_region EMR1 1 82886 1.20648E-5 41443 0 4.94625E-5
19-6919552-C-G c.1421-7C>G splice_region EMR1 1 82912 1.2061E-5 41456 0 8.24334E-6
19-6919563-C-T p.Thr475Thr synonymous EMR1 1 83164 1.20244E-5 41582 0 NA
19-6919578-T-C p.Phe480Phe synonymous EMR1 1 83294 1.20057E-5 41647 0 3.97662E-6
19-6919585-T-A p.Phe483Ile missense EMR1 1 83298 1.20051E-5 41649 0 NA
19-6919592-G-T p.Gly485Val missense EMR1 1 83302 1.20045E-5 41651 0 NA
19-6919597-G-A p.Glu487Lys missense EMR1 1 83316 1.20025E-5 41658 0 3.20225E-5
19-6919600-T-A p.Ser488Thr missense EMR1 1 83314 1.20028E-5 41657 0 NA
19-6919601-C-T p.Ser488Leu missense EMR1 2 83312 2.40061E-5 41656 0 3.97668E-6
19-6919602-G-A p.Ser488Ser synonymous EMR1 1 83314 1.20028E-5 41657 0 7.95361E-6
19-6919614-G-A p.Glu492Glu synonymous EMR1 1 83316 1.20025E-5 41658 0 1.19295E-5
19-6919615-C-T p.Arg493Cys missense EMR1 1 83310 1.20034E-5 41655 0 3.14145E-4
19-6919621-T-C p.Phe495Leu missense EMR1 5 83318 6.0011E-5 41659 0 3.19673E-5
19-6919624-A-C p.Lys496Gln missense EMR1 62396 82954 0.752176 41477 23586 0.805625
19-6919627-GACCAC-G p.Asp497fs frameshift EMR1 1 83316 1.20025E-5 41658 0 NA
19-6919628-A-G p.Asp497Gly missense EMR1 1 83316 1.20025E-5 41658 0 8.23818E-6
19-6919638-T-C p.Ala500Ala synonymous EMR1 8 83312 9.60246E-5 41656 0 5.04541E-4
19-6919646-C-T p.Thr503Ile missense EMR1 1 83312 1.20031E-5 41656 0 NA
19-6919665-G-A p.Leu509Leu synonymous EMR1 1 83298 1.20051E-5 41649 0 NA
19-6919684-G-A p.Val516Ile missense EMR1 3 83228 3.60456E-5 41614 0 1.56574E-4
19-6919688-G-C p.Gly517Ala missense EMR1 1 83220 1.20163E-5 41610 0 1.23622E-4
19-6919689-G-A p.Gly517Gly synonymous EMR1 1 83230 1.20149E-5 41615 0 1.64829E-5
19-6919690-G-A p.Gly518Ser missense EMR1 1 83220 1.20163E-5 41610 0 NA
19-6919697-T-A p.Met520Lys missense EMR1 1 83186 1.20213E-5 41593 0 NA
19-6919701-T-C p.Thr521Thr synonymous EMR1 1 83152 1.20262E-5 41576 0 NA
19-6919717-G-A p.Gly527Ser missense EMR1 3 82956 3.61638E-5 41478 0 1.64891E-5
19-6919723-T-C p.Ser529Pro missense EMR1 1 82930 1.20584E-5 41465 0 3.19611E-5
19-6919734-C-T p.Ile532Ile synonymous EMR1 2 82766 2.41645E-5 41383 0 NA
19-6919739-A-G p.Tyr534Cys missense EMR1 2 82660 2.41955E-5 41330 0 7.17229E-5
19-6919743-T-C p.Thr535Thr synonymous EMR1 2 82588 2.42166E-5 41294 0 NA
19-6919747-G-A p.Glu537Lys missense EMR1 1 82506 1.21203E-5 41253 0 NA
19-6919753-A-G p.Ile539Val missense EMR1 48451 68824 0.703984 34412 16761 0.800375
19-6919766-A-T c.1620+8A>T splice_region EMR1 1 81946 1.22032E-5 40973 0 4.1502E-5
19-6921717-T-TG c.1621-7_1621-6insG splice_region EMR1 1 83056 1.20401E-5 41528 0 NA
19-6921717-T-C c.1621-7T>C splice_region EMR1 1 83056 1.20401E-5 41528 0 NA
19-6921721-T-C c.1621-3T>C splice_region EMR1 2 83138 2.40564E-5 41569 0 1.01106E-5
19-6921724-C-G p.Pro541Ala missense+splice_region EMR1 2 83160 2.405E-5 41580 0 1.30141E-4
19-6921735-G-A p.Lys544Lys synonymous EMR1 1 83276 1.20083E-5 41638 0 NA
19-6921737-T-C p.Phe545Ser missense EMR1 1 83286 1.20068E-5 41643 0 1.75605E-5
19-6921755-T-C p.Val551Ala missense EMR1 8 83352 9.59785E-5 41676 0 5.85578E-4
19-6921756-T-G p.Val551Val synonymous EMR1 1 83358 1.19964E-5 41679 0 NA
19-6921770-A-G p.Asp556Gly missense EMR1 1 83372 1.19944E-5 41686 0 NA
19-6921791-C-A p.Thr563Lys missense EMR1 1 83390 1.19918E-5 41695 0 NA
19-6921798-T-C p.Phe565Phe synonymous EMR1 2 83394 2.39825E-5 41697 0 3.18552E-5
19-6921802-T-C p.Cys567Arg missense EMR1 1 83390 1.19918E-5 41695 0 NA
19-6921803-G-A p.Cys567Tyr missense EMR1 6 83392 7.19493E-5 41696 0 3.18654E-5
19-6921808-A-G p.Ile569Val missense EMR1 1 83388 1.19921E-5 41694 0 4.37424E-5
19-6921822-T-A p.Ser573Ser synonymous EMR1 1 83378 1.19936E-5 41689 0 1.6475E-5
19-6921831-T-C p.Tyr576Tyr synonymous EMR1 1 83382 1.1993E-5 41691 0 7.95317E-6
19-6921832-A-G p.Thr577Ala missense EMR1 2 83378 2.39871E-5 41689 0 NA
19-6921842-G-A p.Ser580Asn missense EMR1 2 83368 2.399E-5 41684 0 NA
19-6921851-A-G p.Gln583Arg missense EMR1 1 83352 1.19973E-5 41676 0 5.57236E-5
19-6921868-G-A p.Val589Ile missense EMR1 17300 82722 0.209134 41361 1812 0.26435
19-6921878-C-T p.Ala592Val missense EMR1 1 83302 1.20045E-5 41651 0 3.18674E-5
19-6921879-G-A p.Ala592Ala synonymous EMR1 368 83272 0.00441925 41636 1 0.00453172
19-6921883-G-A p.Gly594Arg missense EMR1 2 83284 2.40142E-5 41642 0 2.48381E-5
19-6921883-GG-AT p.Gly594Met missense EMR1 2 83284 2.40142E-5 41642 0 NA
19-6921893-C-T p.Thr597Met missense+splice_region EMR1 5 83250 6.00601E-5 41625 0 1.3301E-4
19-6921894-G-A p.Thr597Thr splice_region+synonymous EMR1 5 83244 6.00644E-5 41622 0 0.00100806
19-6921894-G-T p.Thr597Thr splice_region+synonymous EMR1 1 83246 1.20126E-5 41623 0 4.01139E-6
19-6921895-G-A c.1791+1G>A splice_donor EMR1 4 83224 4.80631E-5 41612 0 8.31753E-6
19-6921898-A-G c.1791+4A>G splice_region EMR1 1 83208 1.20181E-5 41604 0 1.24036E-5
19-6921898-AG-A c.1791+5delG splice_region EMR1 1 83208 1.20181E-5 41604 0 NA
19-6921900-T-C c.1791+6T>C splice_region EMR1 5 83190 6.01034E-5 41595 0 6.59234E-5
19-6921901-A-G c.1791+7A>G splice_region EMR1 1 83186 1.20213E-5 41593 0 NA
19-6924694-C-T p.Asp599Asp synonymous EMR1 1 83168 1.20239E-5 41584 0 8.27554E-5
19-6924703-G-A p.Leu602Leu synonymous EMR1 2 83188 2.40419E-5 41594 0 NA
19-6924710-A-G p.Ile605Val missense EMR1 4 83208 4.80723E-5 41604 0 3.58694E-5
19-6924718-T-C p.His607His synonymous EMR1 1 83228 1.20152E-5 41614 0 6.3678E-5
19-6924725-A-G p.Ile610Val missense EMR1 2 83230 2.40298E-5 41615 0 NA
19-6924727-T-C p.Ile610Ile synonymous EMR1 265 83222 0.00318425 41611 0 0.00358062
19-6924728-A-G p.Ile611Val missense EMR1 3 83242 3.60395E-5 41621 0 4.94976E-5
19-6924733-C-T p.Ile612Ile synonymous EMR1 1 83258 1.20109E-5 41629 0 1.64967E-5
19-6924748-C-T p.Leu617Leu synonymous EMR1 1 83294 1.20057E-5 41647 0 1.64902E-5
19-6924749-G-A p.Val618Ile missense EMR1 2 83298 2.40102E-5 41649 0 9.55718E-5
19-6924750-T-A p.Val618Asp missense EMR1 1 83302 1.20045E-5 41651 0 NA
19-6924756-C-T p.Ala620Val missense EMR1 18 83324 2.16024E-4 41662 0 9.55597E-5
19-6924758-A-G p.Ile621Val missense EMR1 48 83324 5.76065E-4 41662 0 0.00146497
19-6924760-C-T p.Ile621Ile synonymous EMR1 2 83328 2.40015E-5 41664 0 1.19331E-5
19-6924761-G-A p.Ala622Thr missense EMR1 2 83322 2.40033E-5 41661 0 3.18674E-5
19-6924762-CCACCTTTCTGCTGTGTCGCTCCATCCGAAATCACAACACCTACCTCCACCTG-C p.Phe624fs frameshift EMR1 1 83320 1.20019E-5 41660 0 NA
19-6924779-C-T p.Arg628Cys missense EMR1 3 83338 3.5998E-5 41669 0 1.15376E-4
19-6924780-G-A p.Arg628His missense EMR1 1 83336 1.19996E-5 41668 0 6.25E-4
19-6924785-A-G p.Ile630Val missense EMR1 3 83344 3.59954E-5 41672 0 7.95475E-6
19-6924788-C-G p.Arg631Gly missense EMR1 1 83332 1.20002E-5 41666 0 8.24049E-6
19-6924788-C-T p.Arg631* stop_gained EMR1 2 83332 2.40004E-5 41666 0 1.6481E-5
19-6924789-G-A p.Arg631Gln missense EMR1 6 83324 7.20081E-5 41662 0 4.77354E-5
19-6924792-A-G p.Asn632Ser missense EMR1 3 83342 3.59963E-5 41671 0 4.12004E-5
19-6924797-A-G p.Asn634Asp missense EMR1 1 83348 1.19979E-5 41674 0 3.97712E-6
19-6924798-A-G p.Asn634Ser missense EMR1 1 83346 1.19982E-5 41673 0 3.97712E-6
19-6924823-C-T p.Cys642Cys synonymous EMR1 1 83338 1.19993E-5 41669 0 3.18451E-5
19-6924825-T-C p.Val643Ala missense EMR1 2 83340 2.39981E-5 41670 0 3.18593E-5
19-6924829-TCTC-T p.Leu646del conservative_inframe_deletion EMR1 1 83336 1.19996E-5 41668 0 NA
19-6924832-C-T p.Leu645Leu synonymous EMR1 1 83332 1.20002E-5 41666 0 1.07151E-4
19-6924834-T-C p.Leu646Pro missense EMR1 4 83328 4.80031E-5 41664 0 8.24212E-6
19-6924840-C-G p.Ala648Gly missense EMR1 1 83314 1.20028E-5 41657 0 NA
19-6924840-C-T p.Ala648Val missense EMR1 2 83314 2.40056E-5 41657 0 1.64878E-5
19-6924841-G-A p.Ala648Ala synonymous EMR1 1 83314 1.20028E-5 41657 0 5.5689E-5
19-6924846-C-T p.Thr650Ile missense EMR1 1 83304 1.20042E-5 41652 0 8.24606E-6
19-6924850-C-T p.Leu651Leu synonymous EMR1 3 83294 3.6017E-5 41647 0 3.18431E-5
19-6924856-C-T p.Leu653Leu synonymous EMR1 2 83282 2.40148E-5 41641 0 6.25E-4
19-6924857-G-A p.Ala654Thr missense EMR1 2 83260 2.40211E-5 41630 0 9.55962E-5
19-6924859-C-T p.Ala654Ala synonymous EMR1 1 83248 1.20123E-5 41624 0 1.19385E-5
19-6924859-C-G p.Ala654Ala synonymous EMR1 1 83248 1.20123E-5 41624 0 NA
19-6924860-G-A p.Gly655Ser missense EMR1 3 83246 3.60378E-5 41623 0 3.18715E-5
19-6924862-T-C p.Gly655Gly synonymous EMR1 1 83244 1.20129E-5 41622 0 3.97988E-6
19-6924864-T-C p.Ile656Thr missense EMR1 5 83232 6.0073E-5 41616 0 8.259E-5
19-6924875-GACA-G p.Asn661del disruptive_inframe_deletion EMR1 1 83156 1.20256E-5 41578 0 8.27458E-6
19-6924882-A-T p.Lys662Met missense+splice_region EMR1 5 83098 6.01699E-5 41549 0 1.59398E-4
19-6924890-A-C c.1986+7A>C splice_region EMR1 22 82940 2.65252E-4 41470 0 3.82507E-4
19-6926373-C-G c.1792-4C>G splice_region EMR1 1 83102 1.20334E-5 41551 0 5.81811E-5
19-6926378-T-C p.Met598Thr missense+splice_region EMR1 23789 80268 0.29637 40134 3479 0.339812
19-6926378-TG-CA p.Met598Thr missense+splice_region EMR1 2 83150 2.40529E-5 41575 0 NA
19-6926379-G-A p.Met598Ile missense+splice_region EMR1 3 83162 3.60742E-5 41581 0 2.38905E-5
19-6926383-T-G p.Cys600Gly missense EMR1 1 83198 1.20195E-5 41599 0 NA
19-6926385-C-A p.Cys600* stop_gained EMR1 1 83208 1.20181E-5 41604 0 8.26078E-6
19-6926386-G-A p.Ala601Thr missense EMR1 2 83238 2.40275E-5 41619 0 3.1835E-5
19-6926392-A-G p.Ile603Val missense EMR1 1 83276 1.20083E-5 41638 0 3.9789E-6
19-6926394-C-T p.Ile603Ile synonymous EMR1 2 83270 2.40183E-5 41635 0 1.64965E-5
19-6926396-C-T p.Ala604Val missense EMR1 173 83280 0.00207733 41640 1 0.008125
19-6926397-G-A p.Ala604Ala synonymous EMR1 1 83292 1.2006E-5 41646 0 0.0025
19-6926412-C-G p.Tyr609* stop_gained EMR1 1 83352 1.19973E-5 41676 0 5.03525E-4
19-6926441-T-C p.Leu619Pro missense EMR1 3 83406 3.59686E-5 41703 0 NA
19-6926443-G-C p.Val620Leu missense EMR1 1 83410 1.1989E-5 41705 0 3.1841E-5
19-6926458-C-T p.Leu625Leu synonymous EMR1 2 83414 2.39768E-5 41707 0 3.18471E-5
19-6926478-C-T p.Asn631Asn synonymous EMR1 1 83418 1.19878E-5 41709 0 6.37186E-5
19-6926484-G-A p.Lys633Lys synonymous EMR1 16 83418 1.91805E-4 41709 0 8.23642E-6
19-6926503-T-G p.Ser640Ala missense EMR1 1 83412 1.19887E-5 41706 0 NA
19-6926506-C-T p.Arg641Cys missense EMR1 1 83412 1.19887E-5 41706 0 1.64728E-5
19-6926507-G-A p.Arg641His missense EMR1 2 83412 2.39774E-5 41706 0 2.47097E-5
19-6926510-A-G p.Asn642Ser missense EMR1 2 83412 2.39774E-5 41706 0 NA
19-6926529-C-T p.Ile648Ile synonymous EMR1 3 83414 3.59652E-5 41707 0 6.58913E-5
19-6926534-C-T p.Ala650Val missense EMR1 1 83408 1.19893E-5 41704 0 NA
19-6926545-G-A p.Gly654Arg missense EMR1 1 83408 1.19893E-5 41704 0 8.23655E-6
19-6926552-C-T p.Pro656Leu missense EMR1 38 83408 4.55592E-4 41704 0 5.0499E-4
19-6926553-G-A p.Pro656Pro synonymous EMR1 13 83408 1.5586E-4 41704 0 5.76559E-5
19-6926560-G-C p.Val659Leu missense EMR1 477 83396 0.0057197 41698 6 0.0117486
19-6926565-G-C p.Val660Val synonymous EMR1 1 83400 1.19904E-5 41700 0 NA
19-6926566-G-GTGA p.Val661_Ile662insMet disruptive_inframe_insertion EMR1 1 83400 1.19904E-5 41700 0 NA
19-6926582-T-C p.Val666Ala missense EMR1 1 83396 1.1991E-5 41698 0 8.23655E-6
19-6926593-G-A p.Gly670Ser missense EMR1 1 83390 1.19918E-5 41695 0 8.23655E-6
19-6926604-G-A p.Met673Ile missense EMR1 1 83374 1.19941E-5 41687 0 NA
19-6926610-TC-T p.Arg676fs frameshift EMR1 1 83346 1.19982E-5 41673 0 6.36943E-5
19-6926611-C-T p.Arg676Cys missense+splice_region EMR1 2 83348 2.39958E-5 41674 0 5.17195E-5
19-6926612-G-A p.Arg676His missense+splice_region EMR1 2 83334 2.39998E-5 41667 0 3.18492E-5
19-6926619-G-T c.2027+7G>T splice_region EMR1 2 83290 2.40125E-5 41645 0 8.23873E-6
19-6928150-C-T c.2028-6C>T splice_region EMR1 177 83342 0.00212378 41671 0 0.00455559
19-6928179-G-T p.Gly684Val missense EMR1 4 83396 4.79639E-5 41698 0 3.18552E-5
19-6928198-G-T p.Leu690Phe missense EMR1 1 83410 1.1989E-5 41705 0 NA
19-6928205-G-A p.Val693Ile missense EMR1 2 83408 2.39785E-5 41704 0 1.89531E-4
19-6928207-T-G p.Val693Val synonymous EMR1 1 83410 1.1989E-5 41705 0 NA
19-6928217-A-G p.Ile697Val missense EMR1 5 83418 5.99391E-5 41709 0 9.55171E-5
19-6928218-T-G p.Ile697Arg missense EMR1 2 83414 2.39768E-5 41707 0 2.78388E-5
19-6928222-G-C p.Val698Val splice_region+synonymous EMR1 3 83412 3.5966E-5 41706 0 NA
19-6928226-A-G p.Ser713Gly missense EMR1 1 83418 1.19878E-5 41709 0 NA
19-6928231-A-C p.Lys714Asn missense EMR1 1 83424 1.1987E-5 41712 0 1.59085E-5
19-6928238-A-G p.Asn717Asp missense EMR1 381 83406 0.00456802 41703 4 0.0096503
19-6928239-A-G p.Asn717Ser missense EMR1 1 83412 1.19887E-5 41706 0 NA
19-6928248-C-T p.Ala720Val missense EMR1 14 83402 1.67862E-4 41701 0 4.14145E-4
19-6928249-G-A p.Ala720Ala synonymous EMR1 3 83414 3.59652E-5 41707 0 7.95608E-6
19-6928259-C-T p.Leu724Leu synonymous EMR1 1 83408 1.19893E-5 41704 0 6.36983E-5
19-6928269-A-T p.Glu727Val missense EMR1 1027 83372 0.0123183 41686 10 0.015625
19-6928273-A-G p.Gln728Gln synonymous EMR1 2 83374 2.39883E-5 41687 0 3.98416E-6
19-6928277-G-C p.Asp730His missense EMR1 1 83358 1.19964E-5 41679 0 NA
19-6928305-C-T p.Thr739Met missense EMR1 3 83292 3.60179E-5 41646 0 9.21914E-5
19-6934997-G-A c.2095-1G>A splice_acceptor EMR1 2 82410 2.42689E-5 41205 1 NA
19-6935005-C-T p.Ser701Phe missense EMR1 1 82552 1.21136E-5 41276 0 NA
19-6935007-C-T p.Leu702Phe missense EMR1 4 82510 4.8479E-5 41255 0 3.19754E-5
19-6935020-G-C p.Trp706Ser missense EMR1 1 82842 1.20712E-5 41421 0 NA
19-6935033-C-A p.Ile710Ile synonymous EMR1 1065 82916 0.0128443 41458 8 0.0179302
19-6935045-G-T p.Arg714Ser missense EMR1 1 83052 1.20406E-5 41526 0 NA
19-6935058-A-G p.Asn719Asp missense EMR1 1 83084 1.2036E-5 41542 0 NA
19-6935063-C-T p.Ala720Ala synonymous EMR1 1 83070 1.2038E-5 41535 0 3.19428E-5
19-6935064-G-A p.Glu721Lys missense EMR1 1 83070 1.2038E-5 41535 0 4.13678E-6
19-6935074-C-T p.Thr724Met missense EMR1 4 83078 4.81475E-5 41539 0 3.40628E-5
19-6935077-T-C p.Leu725Pro missense EMR1 6 83074 7.22248E-5 41537 0 6.25E-4
19-6935082-GAC-G p.Thr728fs frameshift EMR1 5 83026 6.02221E-5 41513 0 3.13834E-5
19-6935095-G-A c.2186+6G>A splice_region EMR1 1 82872 1.20668E-5 41436 0 NA
19-6937246-C-G c.2187-8C>G splice_region EMR1 1 81334 1.2295E-5 40667 0 NA
19-6937249-C-A c.2187-5C>A splice_region EMR1 1 81350 1.22926E-5 40675 0 NA
19-6937250-C-T c.2187-4C>T splice_region EMR1 195 81360 0.00239676 40680 2 0.00369521
19-6937294-G-C p.Gly743Arg missense EMR1 1 82986 1.20502E-5 41493 0 NA
19-6937325-T-C p.Ile753Thr missense EMR1 1 83220 1.20163E-5 41610 0 NA
19-6937325-T-A p.Ile753Asn missense EMR1 1 83220 1.20163E-5 41610 0 NA
19-6937331-C-T p.Pro755Leu missense EMR1 2 83256 2.40223E-5 41628 0 NA
19-6937338-A-G p.Ala757Ala synonymous EMR1 1 83256 1.20111E-5 41628 0 NA
19-6937338-A-T p.Ala757Ala synonymous EMR1 1 83256 1.20111E-5 41628 0 NA
19-6937342-G-T p.Val759Phe missense EMR1 2 83244 2.40258E-5 41622 0 NA
19-6937350-T-C p.Ala761Ala synonymous EMR1 1 83260 1.20106E-5 41630 0 NA
19-6937364-T-C p.Ile766Thr missense EMR1 1 83248 1.20123E-5 41624 0 NA
19-6937378-C-T p.Gln771* stop_gained EMR1 3 83202 3.60568E-5 41601 0 NA
19-6937389-C-T p.Phe774Phe synonymous EMR1 1 83144 1.20273E-5 41572 0 NA
19-6937398-C-T p.Leu777Leu synonymous EMR1 2 83050 2.40819E-5 41525 0 8.25341E-6
19-6937401-C-T p.Ile778Ile synonymous EMR1 1 82994 1.20491E-5 41497 0 NA
19-6937402-C-T p.His779Tyr missense EMR1 4 82976 4.82067E-5 41488 0 2.47717E-5
19-6937410-G-GTGGCAGGTGTCATGGCTTAC p.Leu782fs frameshift EMR1 1 82724 1.20884E-5 41362 0 NA
19-6937416-C-T p.Asn783Asn synonymous EMR1 72 82582 8.71861E-4 41291 0 0.00213798
19-6937417-G-A p.Gly784Ser missense EMR1 1 82484 1.21236E-5 41242 0 1.27706E-4
19-6937421-A-T p.Gln785Leu missense+splice_region EMR1 1 82392 1.21371E-5 41196 0 NA
19-6937424-T-TACGAGAAGAATACAAGAGGTGGATCACTGGGAAGACGAA c.2355+2_2355+3insACGAGAAGAATACAAGAGGTGGATCACTGGGAAGACGAA splice_region EMR1 2 82270 2.43102E-5 41135 1 NA
19-6937551-C-T c.2356-4C>T splice_region EMR1 2 83180 2.40442E-5 41590 0 4.95156E-5
19-6937558-C-A p.Arg787Arg synonymous EMR1 11 83192 1.32224E-4 41596 0 1.91327E-4
19-6937558-C-G p.Arg787Gly missense EMR1 1 83192 1.20204E-5 41596 0 3.97782E-6
19-6937559-G-A p.Arg787Gln missense EMR1 30 83198 3.60586E-4 41599 0 2.47459E-4
19-6937567-T-A p.Tyr790Asn missense EMR1 3 83232 3.60438E-5 41616 0 8.24715E-6
19-6937575-G-A p.Arg792Arg synonymous EMR1 1 83212 1.20175E-5 41606 0 7.9545E-6
19-6937577-G-C p.Trp793Ser missense EMR1 1 83228 1.20152E-5 41614 0 NA
19-6937584-T-C p.Thr795Thr synonymous EMR1 1 83232 1.20146E-5 41616 0 NA
19-6937586-G-A p.Gly796Glu missense EMR1 1 83222 1.20161E-5 41611 0 NA
19-6937590-G-A p.Lys797Lys synonymous EMR1 1 83206 1.20184E-5 41603 0 NA
19-6937604-C-T p.Ser802Phe missense EMR1 1 83106 1.20328E-5 41553 0 6.25E-4
19-6937607-A-G p.Gln803Arg missense EMR1 3 83080 3.61098E-5 41540 0 6.25E-4
19-6937617-C-T p.Thr806Thr synonymous EMR1 67 82938 8.07832E-4 41469 0 0.00385399
19-6937619-C-T p.Ser807Leu missense EMR1 1 82920 1.20598E-5 41460 0 1.64878E-5
19-6937625-T-C p.Ile809Thr missense EMR1 7 82854 8.4486E-5 41427 0 1.59203E-5
19-6937634-C-T p.Ser812Phe missense EMR1 1 82688 1.20937E-5 41344 0 NA
19-6937635-C-T p.Ser812Ser synonymous EMR1 1 82666 1.20969E-5 41333 0 3.18613E-5
19-6937640-T-C p.Met814Thr missense EMR1 2 82528 2.42342E-5 41264 0 NA
19-6937642-C-A p.Pro815Thr missense EMR1 192 82422 0.00232948 41211 1 0.00372706
19-6937658-C-T p.Thr820Met missense+splice_region EMR1 338 81762 0.00413395 40881 3 0.00758445
19-6937662-G-A c.2460+3G>A splice_region EMR1 2 81546 2.4526E-5 40773 1 3.99017E-6
19-6937664-G-A c.2460+5G>A splice_region EMR1 1 81440 1.2279E-5 40720 0 3.18552E-5
19-6940033-A-C c.2461-2A>C splice_acceptor EMR1 1 83072 1.20378E-5 41536 0 NA
19-6940037-T-C p.Gly821Gly splice_region+synonymous EMR1 32 83088 3.85134E-4 41544 0 5.30468E-4