Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-32192771-G-A n.1718C>T splice_region BAI2 2 26522 7.54091E-5 13261 0 1.27445E-4
1-32192779-G-A n.1734C>T splice_region BAI2 111 29546 0.00375685 14773 1 0.00576911
1-32192781-C-T n.1732G>A splice_region BAI2 54 29856 0.00180868 14928 1 0.00337902
1-32192919-C-T c.*102G>A splice_region BAI2 4 75186 5.32014E-5 37593 0 NA
1-32192920-G-A c.*101C>T splice_region BAI2 1 75354 1.32707E-5 37677 0 NA
1-32193013-C-G c.*8G>C splice_region BAI2 1 82024 1.21916E-5 41012 0 3.18756E-5
1-32193013-C-T c.*8G>A splice_region BAI2 4 82022 4.87674E-5 41011 0 0.00250313
1-32193014-G-A c.*7C>T splice_region BAI2 1 82020 1.21921E-5 41010 0 6.37755E-5
1-32193044-C-T p.Gly1545Ser missense BAI2 20 82410 2.42689E-4 41205 0 5.30866E-4
1-32193048-C-T p.Pro1543Pro synonymous BAI2 7 82404 8.49473E-5 41202 0 1.27486E-4
1-32193049-G-A p.Pro1543Leu missense BAI2 775 82430 0.00940192 41215 61 0.0120004
1-32193055-T-C p.Glu1541Gly missense BAI2 1 82434 1.21309E-5 41217 0 NA
1-32193063-C-T p.Glu1538Glu synonymous BAI2 301 82470 0.00364981 41235 1 0.00673696
1-32193077-C-T p.Ala1534Thr missense BAI2 2 82306 2.42996E-5 41153 0 3.38329E-5
1-32193079-C-T p.Arg1533Gln missense BAI2 1 82268 1.21554E-5 41134 0 5.03525E-4
1-32193080-G-A p.Arg1533Trp missense BAI2 2 82264 2.4312E-5 41132 0 1.73256E-5
1-32193084-CAG-C p.Leu1531fs frameshift BAI2 1 82290 1.21521E-5 41145 0 NA
1-32193084-C-G p.Leu1531Leu synonymous BAI2 1 82290 1.21521E-5 41145 0 NA
1-32193088-G-A p.Thr1530Ile missense BAI2 3 82234 3.64813E-5 41117 0 8.48551E-6
1-32193093-C-T p.Arg1528Arg synonymous BAI2 1 82216 1.21631E-5 41108 0 1.70387E-5
1-32193095-G-A p.Arg1528Trp missense BAI2 1 82142 1.2174E-5 41071 0 5.03525E-4
1-32193101-G-A p.Arg1526* stop_gained BAI2 1 82048 1.2188E-5 41024 0 3.1902E-5
1-32193105-C-A p.Lys1524Asn missense BAI2 1 82012 1.21933E-5 41006 0 NA
1-32193109-G-C p.Pro1523Arg missense BAI2 3 81978 3.65952E-5 40989 0 NA
1-32193117-C-T p.Ser1520Ser synonymous BAI2 7 81676 8.57045E-5 40838 0 2.62545E-5
1-32193118-G-A p.Ser1520Leu missense BAI2 1 81718 1.22372E-5 40859 0 NA
1-32193141-G-A p.Thr1512Thr synonymous BAI2 2 81898 2.44206E-5 40949 0 1.83063E-5
1-32193142-G-T p.Thr1512Asn missense BAI2 2 81872 2.44284E-5 40936 0 NA
1-32193146-T-C p.Ser1511Gly missense BAI2 1 81822 1.22217E-5 40911 0 NA
1-32193161-G-A p.Arg1506Cys missense BAI2 1 81588 1.22567E-5 40794 0 1.43405E-5
1-32193164-G-A p.Arg1505Trp missense BAI2 8 81594 9.80464E-5 40797 0 6.29723E-4
1-32193166-T-C p.His1504Arg missense BAI2 3 81606 3.6762E-5 40803 0 2.02573E-5
1-32193172-G-A p.Ser1502Phe missense BAI2 1 81530 1.22654E-5 40765 0 3.19142E-5
1-32193182-G-C p.Pro1499Ala missense BAI2 1 81262 1.23059E-5 40631 0 NA
1-32193183-G-A p.Arg1498Arg synonymous BAI2 1 81208 1.23141E-5 40604 0 NA
1-32193184-C-T p.Arg1498His missense BAI2 4 81024 4.93681E-5 40512 0 6.91005E-5
1-32193185-G-A p.Arg1498Cys missense BAI2 419 80932 0.00517719 40466 1 0.0134299
1-32193205-T-A p.Asp1491Val missense+splice_region BAI2 3 80492 3.72708E-5 40246 0 NA
1-32193619-G-T c.4470+7C>A splice_region BAI2 2 73796 2.71017E-5 36898 0 5.97564E-6
1-32193621-C-T c.4470+5G>A splice_region BAI2 4 74184 5.392E-5 37092 0 5.20725E-5
1-32193625-C-T c.4470+1G>A splice_donor BAI2 1 74912 1.3349E-5 37456 0 9.82222E-5
1-32193626-G-A p.Thr1490Thr splice_region+synonymous BAI2 5 74936 6.67236E-5 37468 0 4.78377E-5
1-32193630-C-T p.Cys1489Tyr missense BAI2 1 75614 1.32251E-5 37807 0 NA
1-32193634-C-G p.Val1488Leu missense BAI2 6 76282 7.86555E-5 38141 0 8.3612E-5
1-32193634-C-T p.Val1488Met missense BAI2 1 76282 1.31093E-5 38141 0 8.3612E-5
1-32193635-G-A p.Ser1487Ser synonymous BAI2 2 76388 2.61821E-5 38194 0 4.0853E-5
1-32193636-C-G p.Ser1487Thr missense BAI2 2 76768 2.60525E-5 38384 0 1.99108E-4
1-32193639-C-T p.Arg1486Gln missense BAI2 1 77266 1.29423E-5 38633 0 NA
1-32193640-G-A p.Arg1486Trp missense BAI2 1 77372 1.29246E-5 38686 0 1.52332E-5
1-32193643-C-T p.Glu1485Lys missense BAI2 1 78078 1.28077E-5 39039 0 1.01667E-4
1-32193644-G-C p.Ala1484Ala synonymous BAI2 134 78184 0.00171391 39092 2 0.00858586
1-32193644-G-A p.Ala1484Ala synonymous BAI2 1 78190 1.27894E-5 39095 0 6.45995E-5
1-32193647-T-C p.Ala1483Ala synonymous BAI2 43509 71200 0.611081 35600 13324 0.678837
1-32193652-C-T p.Gly1482Arg missense BAI2 1 79268 1.26154E-5 39634 0 NA
1-32193656-C-T p.Ser1480Ser synonymous BAI2 9 79630 1.13023E-4 39815 0 0.00151822
1-32193657-G-A p.Ser1480Leu missense BAI2 3 79696 3.7643E-5 39848 0 3.19224E-5
1-32193659-G-A p.Ser1479Ser synonymous BAI2 3 79990 3.75047E-5 39995 0 9.00852E-6
1-32193690-G-A c.4414-8C>T splice_region BAI2 7 81218 8.61878E-5 40609 0 0.00125
1-32193789-C-T p.Thr1469Thr synonymous BAI2 1 82656 1.20983E-5 41328 0 3.98102E-6
1-32193790-G-A p.Thr1469Met missense BAI2 348 82692 0.00420839 41346 2 0.00961845
1-32193802-C-T p.Arg1465His missense BAI2 1 82690 1.20934E-5 41345 0 1.67805E-5
1-32193804-G-A p.Tyr1464Tyr synonymous BAI2 1 82728 1.20878E-5 41364 0 NA
1-32193808-C-A p.Arg1463Leu missense BAI2 5 82696 6.04624E-5 41348 0 NA
1-32193808-C-T p.Arg1463His missense BAI2 1 82696 1.20925E-5 41348 0 1.27518E-4
1-32193810-G-A p.Asp1462Asp synonymous BAI2 1 82750 1.20846E-5 41375 0 1.65719E-5
1-32193830-G-A p.Gln1456* stop_gained BAI2 1 82920 1.20598E-5 41460 0 3.97924E-6
1-32193832-T-C p.Asn1455Ser missense BAI2 1 82926 1.20589E-5 41463 0 NA
1-32193840-G-A p.His1452His synonymous BAI2 5 82940 6.02845E-5 41470 0 2.48246E-5
1-32193858-C-T p.Arg1446Arg synonymous BAI2 1 82918 1.20601E-5 41459 0 NA
1-32193859-C-T p.Arg1446Gln missense BAI2 1 82922 1.20595E-5 41461 0 3.18796E-5
1-32193860-G-A p.Arg1446Trp missense BAI2 1 82912 1.2061E-5 41456 0 3.18898E-5
1-32193865-C-T p.Arg1444Gln missense BAI2 2 82874 2.4133E-5 41437 0 3.32055E-5
1-32193866-G-A p.Arg1444Trp missense BAI2 8 82854 9.65554E-5 41427 0 8.30427E-5
1-32194196-T-C c.4317+3A>G splice_region BAI2 1 83178 1.20224E-5 41589 0 NA
1-32194202-A-G p.Phe1438Phe synonymous BAI2 1 83208 1.20181E-5 41604 0 NA
1-32194220-C-T p.Arg1432Arg synonymous BAI2 1 83220 1.20163E-5 41610 0 8.23954E-6
1-32194221-C-T p.Arg1432Gln missense BAI2 3 83194 3.60603E-5 41597 0 6.37714E-5
1-32194222-G-T p.Arg1432Arg synonymous BAI2 1 83198 1.20195E-5 41599 0 NA
1-32194229-C-A p.Lys1429Asn missense BAI2 1 83180 1.20221E-5 41590 0 NA
1-32194234-G-A p.Arg1428* stop_gained BAI2 1 83144 1.20273E-5 41572 0 NA
1-32194242-G-A c.4282-8C>T splice_region BAI2 3 83140 3.60837E-5 41570 0 6.25E-4
1-32196437-G-A p.Thr1415Thr synonymous BAI2 3 82368 3.64219E-5 41184 0 9.25292E-6
1-32196441-C-T p.Arg1414His missense BAI2 1 82402 1.21356E-5 41201 0 9.24402E-6
1-32196453-C-T p.Arg1410Gln missense BAI2 2 82610 2.42101E-5 41305 0 1.05372E-5
1-32196454-G-A p.Arg1410Trp missense BAI2 3 82568 3.63337E-5 41284 0 9.21421E-6
1-32196466-C-T p.Gly1406Arg missense BAI2 1 82646 1.20998E-5 41323 0 NA
1-32196473-G-A p.Pro1403Pro synonymous BAI2 7 82586 8.47601E-5 41293 0 2.38607E-4
1-32196480-T-C p.Gln1401Arg missense BAI2 1 82600 1.21065E-5 41300 0 NA
1-32196483-C-T p.Arg1400His missense BAI2 2 82632 2.42037E-5 41316 0 2.74559E-5
1-32196484-G-A p.Arg1400Cys missense BAI2 2 82628 2.42049E-5 41314 0 5.04541E-4
1-32196488-G-A p.Ser1398Ser synonymous BAI2 3 82604 3.63179E-5 41302 0 0.00125
1-32196493-G-A p.Pro1397Ser missense BAI2 6 82662 7.25847E-5 41331 0 9.1181E-6
1-32196497-C-T p.Pro1395Pro synonymous BAI2 2 82604 2.42119E-5 41302 0 6.38279E-5
1-32196500-C-T p.Pro1394Pro synonymous BAI2 8 82582 9.68734E-5 41291 0 9.10233E-6
1-32196501-G-T p.Pro1394Gln missense BAI2 3 82590 3.6324E-5 41295 0 6.37105E-5
1-32196503-T-A p.Pro1393Pro synonymous BAI2 6 82500 7.27273E-5 41250 0 8.08771E-5
1-32196506-C-T p.Pro1392Pro synonymous BAI2 227 82480 0.00275218 41240 1 0.00375
1-32196549-G-A p.Ala1378Val missense BAI2 10 82330 1.21462E-4 41165 0 1.2751E-4
1-32196563-C-T p.Leu1373Leu synonymous BAI2 1 82212 1.21637E-5 41106 0 4.63388E-6
1-32196569-C-T p.Ser1371Ser synonymous BAI2 2 82108 2.43582E-5 41054 0 3.18756E-5
1-32196578-C-T p.Val1368Val synonymous BAI2 2 82120 2.43546E-5 41060 0 NA
1-32196584-C-T p.Leu1366Leu synonymous BAI2 810 81996 0.00987853 40998 11 0.0220705
1-32196591-C-G p.Ser1364Thr missense BAI2 1 81892 1.22112E-5 40946 0 3.18939E-5
1-32196595-G-C p.Pro1363Ala missense BAI2 1 81868 1.22148E-5 40934 0 4.55411E-6
1-32196600-C-A p.Gly1361Val missense BAI2 1 81760 1.22309E-5 40880 0 NA
1-32196611-G-A p.Ala1357Ala synonymous BAI2 1 81450 1.22775E-5 40725 0 NA
1-32196630-C-T p.Arg1351Gln missense BAI2 3 80638 3.72033E-5 40319 0 2.71584E-5
1-32196631-G-A p.Arg1351* stop_gained BAI2 1 80416 1.24353E-5 40208 0 NA
1-32196633-C-T p.Arg1350Gln missense BAI2 1 80470 1.2427E-5 40235 0 3.1957E-5
1-32196634-G-A p.Arg1350Trp missense BAI2 3 80452 3.72893E-5 40226 0 1.16009E-5
1-32196635-G-C p.Pro1349Pro synonymous BAI2 5 80572 6.20563E-5 40286 0 1.15859E-5
1-32196647-C-G p.Pro1345Pro synonymous BAI2 18184 78608 0.231325 39304 2703 0.330526
1-32196647-C-T p.Pro1345Pro synonymous BAI2 3 80222 3.73962E-5 40111 0 4.17003E-4
1-32196651-C-T p.Arg1344Gln missense BAI2 1 79924 1.25119E-5 39962 0 1.45335E-5
1-32196652-G-A p.Arg1344Trp missense BAI2 2 79836 2.50514E-5 39918 0 1.5128E-5
1-32196661-G-A p.Pro1341Ser missense BAI2 3 79988 3.75056E-5 39994 0 1.01237E-5
1-32196666-TCCTCAC-T p.Gly1337_Glu1338del disruptive_inframe_deletion BAI2 1 79846 1.25241E-5 39923 0 NA
1-32196668-C-G p.Glu1338Asp missense BAI2 934 79880 0.0116925 39940 38 0.025682
1-32196673-C-A p.Gly1337Cys missense BAI2 2 79784 2.50677E-5 39892 0 NA
1-32196676-C-T p.Gly1336Ser missense BAI2 6 79824 7.51654E-5 39912 0 5.92513E-5
1-32196679-C-T p.Gly1335Arg missense BAI2 4 79746 5.01593E-5 39873 0 2.76656E-5
1-32196680-A-T p.Gly1334Gly synonymous BAI2 1 79458 1.25853E-5 39729 0 1.6712E-5
1-32196688-C-T p.Gly1332Ser missense BAI2 8 79842 1.00198E-4 39921 0 9.56816E-5
1-32196689-G-A p.Gly1331Gly synonymous BAI2 2 79766 2.50733E-5 39883 0 8.61673E-5
1-32196714-C-T p.Arg1323Gln missense BAI2 1 80248 1.24614E-5 40124 0 1.33106E-4
1-32196745-C-A p.Gly1313Cys missense BAI2 2 80926 2.47139E-5 40463 0 2.24568E-5
1-32196760-G-A p.Arg1308Trp missense BAI2 2 81080 2.4667E-5 40540 0 NA
1-32196783-C-T p.Arg1300Gln missense BAI2 1 81504 1.22693E-5 40752 0 6.37471E-5
1-32196785-C-A p.Leu1299Leu synonymous BAI2 1 81550 1.22624E-5 40775 0 NA
1-32196791-A-G p.Gly1297Gly synonymous BAI2 1 81600 1.22549E-5 40800 0 NA
1-32196795-T-C p.Glu1296Gly missense BAI2 1 81612 1.22531E-5 40806 0 NA
1-32196805-T-C p.Met1293Val missense BAI2 1 81708 1.22387E-5 40854 0 NA
1-32196806-G-A p.Tyr1292Tyr synonymous BAI2 2 81714 2.44756E-5 40857 0 1.70051E-5
1-32196814-G-C p.Pro1290Ala missense BAI2 1 81722 1.22366E-5 40861 0 NA
1-32196819-G-T p.Ala1288Asp missense BAI2 3 81596 3.67665E-5 40798 0 1.45631E-4
1-32196833-C-T p.Pro1283Pro synonymous BAI2 2 81472 2.45483E-5 40736 0 1.49557E-5
1-32196839-C-A p.Glu1281Asp missense BAI2 1 81462 1.22757E-5 40731 0 NA
1-32196842-C-T p.Gly1280Gly synonymous BAI2 2 81492 2.45423E-5 40746 0 6.37471E-5
1-32196857-G-C p.Ala1275Ala synonymous BAI2 1 81304 1.22995E-5 40652 0 NA
1-32196872-C-T p.Leu1270Leu synonymous BAI2 1 81092 1.23317E-5 40546 0 NA
1-32196889-G-A p.Leu1265Leu synonymous BAI2 1636 81036 0.0201886 40518 13 0.0383451
1-32196890-T-C p.Pro1264Pro synonymous BAI2 2 81088 2.46646E-5 40544 0 NA
1-32196916-G-A p.Pro1256Ser missense BAI2 6 81220 7.38734E-5 40610 0 6.25E-4
1-32196922-C-T p.Val1254Met missense BAI2 3 81250 3.69231E-5 40625 0 0.001875
1-32196946-C-A p.Asp1246Tyr missense BAI2 1 81200 1.23153E-5 40600 0 NA
1-32196949-C-T p.Glu1245Lys missense BAI2 1 81162 1.2321E-5 40581 0 4.05147E-6
1-32196963-C-T p.Arg1240His missense BAI2 1 80664 1.23971E-5 40332 0 2.03523E-5
1-32196977-C-T p.Thr1235Thr synonymous BAI2 4 79430 5.03588E-5 39715 0 4.47059E-5
1-32196984-G-GCGGCCTGCTCTACGCCTTTGTGGGCCCTGCAGCCGTCA p.Thr1233fs frameshift BAI2 1 79020 1.2655E-5 39510 0 NA
1-32196995-G-A p.Cys1229Cys synonymous BAI2 4 77576 5.15623E-5 38788 0 9.20764E-5
1-32197012-T-C p.Lys1224Glu missense BAI2 1 75320 1.32767E-5 37660 0 4.37013E-6
1-32197741-C-A p.Lys1212Asn missense BAI2 1 82522 1.2118E-5 41261 0 NA
1-32198133-C-A p.Gly1202Gly synonymous BAI2 1 82446 1.21292E-5 41223 0 NA
1-32198136-G-A p.Asn1201Asn synonymous BAI2 178 82456 0.00215873 41228 2 0.00315347
1-32198145-C-T p.Ser1198Ser synonymous BAI2 1 82496 1.21218E-5 41248 0 4.1716E-5
1-32198146-G-A p.Ser1198Leu missense BAI2 2 82502 2.42418E-5 41251 0 1.99197E-5
1-32198161-T-C p.Glu1193Gly missense BAI2 1 82502 1.21209E-5 41251 0 NA
1-32198162-C-T p.Glu1193Lys missense BAI2 1 82496 1.21218E-5 41248 0 8.35338E-6
1-32198162-C-G p.Glu1193Gln missense BAI2 2 82496 2.42436E-5 41248 0 6.37227E-5
1-32198163-G-A p.Ser1192Ser synonymous BAI2 1 82436 1.21306E-5 41218 0 5.85255E-5
1-32198175-C-T p.Arg1188Arg synonymous BAI2 890 82370 0.0108049 41185 32 0.0211905
1-32198176-C-T p.Arg1188Gln missense BAI2 1 82406 1.2135E-5 41203 0 3.18593E-5
1-32198177-G-A p.Arg1188Trp missense BAI2 3 82362 3.64246E-5 41181 0 5.04278E-5
1-32198181-C-T p.Val1186Val synonymous BAI2 1 82334 1.21457E-5 41167 0 NA
1-32198183-C-G p.Val1186Leu missense BAI2 1 82314 1.21486E-5 41157 0 3.98762E-6
1-32198199-C-T p.Val1180Val synonymous BAI2 1 82042 1.21889E-5 41021 0 NA
1-32198204-C-T p.Val1179Met missense BAI2 2 81922 2.44135E-5 40961 0 7.99424E-6
1-32198211-G-A p.Val1176Val splice_region+synonymous BAI2 1 81662 1.22456E-5 40831 0 8.01083E-6
1-32198577-C-T p.Arg1174Gln missense BAI2 2 80578 2.48207E-5 40289 0 6.29137E-5
1-32198579-G-A p.Arg1173Arg synonymous BAI2 4 80640 4.96032E-5 40320 0 NA
1-32198580-C-T p.Arg1173His missense BAI2 2 80662 2.47948E-5 40331 0 5.31971E-5
1-32198581-G-A p.Arg1173Cys missense BAI2 1 80708 1.23903E-5 40354 0 3.18654E-5
1-32198619-G-A p.Ala1160Val missense BAI2 11 81332 1.35248E-4 40666 0 0.001875
1-32198620-C-T p.Ala1160Thr missense BAI2 1 81338 1.22944E-5 40669 0 3.18674E-5
1-32198621-G-A p.Ser1159Ser synonymous BAI2 17 81370 2.08922E-4 40685 0 2.01906E-4
1-32198631-A-G p.Val1156Ala missense BAI2 3 81444 3.68351E-5 40722 0 3.832E-5
1-32198654-G-T p.Val1148Val synonymous BAI2 3 81520 3.68008E-5 40760 0 1.54158E-5
1-32198656-C-T p.Val1148Ile missense BAI2 3 81498 3.68107E-5 40749 0 3.585E-5
1-32198657-G-T p.Ser1147Ser synonymous BAI2 1 81524 1.22663E-5 40762 0 3.53657E-5
1-32198661-C-T p.Arg1146His missense BAI2 1 81494 1.22708E-5 40747 0 6.37105E-5
1-32198684-G-A p.Ala1138Ala synonymous BAI2 4 81406 4.91364E-5 40703 0 6.39345E-5
1-32198711-G-A p.Pro1129Pro synonymous BAI2 1 81192 1.23165E-5 40596 0 NA
1-32198723-G-A p.Cys1125Cys synonymous BAI2 2 80878 2.47286E-5 40439 0 0.00151976
1-32200788-C-T p.Ala1150Thr missense BAI2 1 48450 2.06398E-5 24225 0 NA
1-32200789-G-A p.Asn1149Asn synonymous BAI2 4 48722 8.20984E-5 24361 0 9.37207E-4
1-32200812-G-A p.Leu1142Phe missense BAI2 1 56276 1.77696E-5 28138 0 NA
1-32200818-G-A p.Pro1140Ser missense BAI2 1 57556 1.73744E-5 28778 0 NA
1-32200828-C-T p.Ala1136Ala synonymous BAI2 2 59066 3.38604E-5 29533 0 NA
1-32200862-G-A p.Ala1125Val missense BAI2 2 66034 3.02874E-5 33017 0 NA
1-32200863-C-G p.Ala1125Pro missense BAI2 6 65936 9.09973E-5 32968 0 1.764E-4
1-32200871-C-T p.Cys1122Tyr missense BAI2 1 66676 1.49979E-5 33338 0 NA
1-32200874-C-T p.Arg1121Gln missense BAI2 3 67134 4.46867E-5 33567 0 6.39427E-5
1-32200879-C-T p.Ser1119Ser synonymous BAI2 1 68346 1.46314E-5 34173 0 2.03169E-5
1-32200880-G-A p.Ser1119Leu missense+splice_region BAI2 1 68796 1.45357E-5 34398 0 1.01213E-4
1-32200886-G-A c.3354-4C>T splice_region BAI2 7 70060 9.99144E-5 35030 0 5.29661E-4
1-32200886-G-C c.3354-4C>G splice_region BAI2 2 70060 2.8547E-5 35030 0 NA
1-32201175-C-G c.3353+6G>C splice_region BAI2 5 82740 6.04303E-5 41370 0 1.59408E-4
1-32201175-C-T c.3353+6G>A splice_region BAI2 4 82740 4.83442E-5 41370 0 NA
1-32201175-C-A c.3353+6G>T splice_region BAI2 5 82740 6.04303E-5 41370 0 6.37633E-5
1-32201176-C-A c.3353+5G>T splice_region BAI2 1 82734 1.20869E-5 41367 0 3.98127E-6
1-32201182-C-T p.Gly1118Arg missense+splice_region BAI2 12 82760 1.44998E-4 41380 0 1.27551E-4
1-32201183-G-A p.Ala1117Ala splice_region+synonymous BAI2 5 82746 6.04259E-5 41373 0 1.99035E-4
1-32201195-C-T p.Lys1113Lys synonymous BAI2 1 82910 1.20613E-5 41455 0 NA
1-32201206-C-T p.Asp1110Asn missense BAI2 3 82928 3.6176E-5 41464 0 1.19456E-5
1-32201207-G-A p.Ser1109Ser synonymous BAI2 1 82912 1.2061E-5 41456 0 3.18796E-5
1-32201209-A-G p.Ser1109Pro missense BAI2 2 82918 2.41202E-5 41459 0 NA
1-32201220-C-T p.Arg1105His missense BAI2 3 82944 3.6169E-5 41472 0 7.97785E-6
1-32201220-C-G p.Arg1105Pro missense BAI2 2 82944 2.41127E-5 41472 0 NA
1-32201221-G-A p.Arg1105Cys missense BAI2 4 82952 4.82207E-5 41476 0 1.67168E-5
1-32201240-G-A p.Val1098Val synonymous BAI2 1 82984 1.20505E-5 41492 0 NA
1-32201243-G-A p.Ile1097Ile synonymous BAI2 1 82952 1.20552E-5 41476 0 2.56665E-5
1-32201245-T-A p.Ile1097Phe missense BAI2 1 82960 1.2054E-5 41480 0 NA
1-32201246-G-A p.Ile1096Ile synonymous BAI2 1 82974 1.2052E-5 41487 0 NA
1-32201250-C-A p.Gly1095Val missense BAI2 1 82958 1.20543E-5 41479 0 NA
1-32201252-G-A p.Ile1094Ile synonymous BAI2 4 82944 4.82253E-5 41472 0 3.18878E-5
1-32201274-C-A c.3268-8G>T splice_region BAI2 1 82820 1.20744E-5 41410 0 7.16163E-5
1-32201439-C-T p.Val1086Ile missense BAI2 198 82428 0.0024021 41214 1 0.00246044
1-32201440-G-A p.Ala1085Ala synonymous BAI2 7 82442 8.49082E-5 41221 0 0.00100806
1-32201461-G-A p.Tyr1078Tyr synonymous BAI2 2 82100 2.43605E-5 41050 0 1.41973E-5
1-32201464-G-A p.Leu1077Leu synonymous BAI2 2 82060 2.43724E-5 41030 0 NA
1-32201470-G-T p.Gly1075Gly synonymous BAI2 1 81854 1.22169E-5 40927 0 4.31365E-6
1-32201470-G-A p.Gly1075Gly synonymous BAI2 1 81854 1.22169E-5 40927 0 NA
1-32201473-G-A p.Gly1074Gly synonymous BAI2 295 81712 0.00361024 40856 1 0.0103693
1-32201502-G-C c.3201-8C>G splice_region BAI2 220 80654 0.0027277 40327 0 0.00442122
1-32201502-G-A c.3201-8C>T splice_region BAI2 1 80674 1.23956E-5 40337 0 NA
1-32201918-G-A c.3200+4C>T splice_region BAI2 3 82580 3.63284E-5 41290 0 7.43777E-5
1-32201925-C-G p.Ser1066Thr missense BAI2 1 82632 1.21018E-5 41316 0 7.96109E-6
1-32201930-T-A p.Thr1064Thr synonymous BAI2 1 82648 1.20995E-5 41324 0 NA
1-32201936-G-A p.Tyr1062Tyr synonymous BAI2 1 82652 1.20989E-5 41326 0 3.30153E-5
1-32201948-T-G p.Arg1058Arg synonymous BAI2 1 82670 1.20963E-5 41335 0 3.9789E-6
1-32201950-G-A p.Arg1058* stop_gained BAI2 4 82682 4.83781E-5 41341 0 NA
1-32201957-G-A p.Gly1055Gly synonymous BAI2 1 82688 1.20937E-5 41344 0 8.253E-6
1-32201968-C-T p.Val1052Met missense BAI2 3 82622 3.63099E-5 41311 0 7.96039E-6
1-32201969-G-A p.Ala1051Ala synonymous BAI2 2 82590 2.4216E-5 41295 0 1.19398E-5
1-32201976-A-C p.Val1049Gly missense BAI2 1 82586 1.21086E-5 41293 0 NA
1-32201987-C-G p.Leu1045Leu synonymous BAI2 6 82520 7.27096E-5 41260 0 6.25E-4
1-32201998-G-A c.3131-7C>T splice_region BAI2 4 82456 4.85107E-5 41228 0 3.98616E-6
1-32202197-T-C p.Lys1036Arg missense BAI2 3 81956 3.6605E-5 40978 0 1.19665E-5
1-32202201-G-A p.Arg1035Cys missense BAI2 2 82002 2.43896E-5 41001 0 1.66811E-5
1-32202204-C-T p.Val1034Ile missense BAI2 2 82050 2.43754E-5 41025 0 5.00325E-5
1-32202205-G-A p.Leu1033Leu synonymous BAI2 1 82092 1.21815E-5 41046 0 3.18552E-5
1-32202210-G-A p.Arg1032Cys missense BAI2 1 82110 1.21788E-5 41055 0 2.39284E-5
1-32202215-C-A p.Arg1030Leu missense BAI2 1 82000 1.21951E-5 41000 0 NA
1-32202222-G-A p.Arg1028Trp missense BAI2 1 82116 1.21779E-5 41058 0 3.98699E-6
1-32202227-A-G p.Ile1026Thr missense BAI2 5 82204 6.08243E-5 41102 0 1.33034E-4
1-32202229-G-A p.Val1025Val synonymous BAI2 5 82260 6.07829E-5 41130 0 6.65126E-5
1-32202239-T-G p.Tyr1022Ser missense BAI2 1 82256 1.21572E-5 41128 0 NA
1-32202256-G-A p.Thr1016Thr synonymous BAI2 1 82294 1.21516E-5 41147 0 3.98502E-6
1-32202274-G-C p.Ser1010Ser synonymous BAI2 1 82186 1.21675E-5 41093 0 1.19547E-5
1-32202304-A-C p.Ala1000Ala synonymous BAI2 1 81580 1.22579E-5 40790 0 NA
1-32202307-C-T p.Thr999Thr synonymous BAI2 1 81400 1.2285E-5 40700 0 1.60018E-5
1-32202321-C-T p.Val995Met missense BAI2 2 80816 2.47476E-5 40408 0 3.57079E-5
1-32202332-G-A c.2980-8C>T splice_region BAI2 1 80098 1.24847E-5 40049 0 7.35673E-5
1-32203026-C-G c.2979+4G>C splice_region BAI2 1 82406 1.2135E-5 41203 0 1.65637E-5
1-32203043-C-CG p.Arg989fs frameshift BAI2 1 82736 1.20866E-5 41368 0 NA
1-32203043-C-T p.Arg989Gln missense BAI2 2 82736 2.41733E-5 41368 0 3.18695E-5
1-32203044-G-A p.Arg989Trp missense BAI2 3 82750 3.62538E-5 41375 0 6.3743E-5
1-32203049-T-C p.Gln987Arg missense BAI2 2 82816 2.41499E-5 41408 0 NA
1-32203056-C-A p.Val985Leu missense BAI2 3 82846 3.62118E-5 41423 0 NA
1-32203056-C-T p.Val985Met missense BAI2 1 82846 1.20706E-5 41423 0 NA
1-32203069-G-A p.Asn980Asn synonymous BAI2 1 82974 1.2052E-5 41487 0 NA
1-32203076-G-A p.Ala978Val missense BAI2 1 82970 1.20525E-5 41485 0 NA
1-32203081-G-A p.Ile976Ile synonymous BAI2 2 83004 2.40952E-5 41502 0 NA
1-32203083-T-C p.Ile976Val missense BAI2 4 82966 4.82125E-5 41483 0 7.42097E-5
1-32203110-T-C p.Ile967Val missense BAI2 2 82912 2.4122E-5 41456 0 NA
1-32203138-G-A c.2877-6C>T splice_region BAI2 6 82594 7.26445E-5 41297 0 3.18695E-5
1-32203140-G-T c.2877-8C>A splice_region BAI2 1 82558 1.21127E-5 41279 0 NA
1-32203267-A-G p.Tyr954Tyr synonymous BAI2 1 79046 1.26509E-5 39523 0 8.3783E-6
1-32203281-G-A p.Leu950Leu synonymous BAI2 5 78264 6.38863E-5 39132 0 1.59286E-4
1-32203290-G-A p.Leu947Leu synonymous BAI2 1 77422 1.29162E-5 38711 0 NA
1-32203300-C-T p.Ser943Ser synonymous BAI2 1 76602 1.30545E-5 38301 0 1.68572E-5
1-32203308-C-T p.Ala941Thr missense BAI2 1 76038 1.31513E-5 38019 0 8.47745E-6
1-32203312-G-A p.Gly939Gly synonymous BAI2 6 75638 7.93252E-5 37819 0 1.69466E-5
1-32203315-G-A p.Ile938Ile synonymous BAI2 9 75272 1.19566E-4 37636 0 0.00100705
1-32203320-C-G p.Val937Leu missense BAI2 1 74920 1.33476E-5 37460 0 NA
1-32203330-C-T p.Ser933Ser synonymous BAI2 2 73294 2.72874E-5 36647 0 6.37633E-5
1-32203333-G-A p.Pro932Pro synonymous BAI2 5 73284 6.82277E-5 36642 0 4.30611E-5
1-32203335-G-A p.Pro932Ser missense BAI2 1 73144 1.36717E-5 36572 0 1.61695E-5
1-32203337-G-A p.Ser931Phe missense BAI2 1 72860 1.3725E-5 36430 0 8.63185E-6
1-32203342-C-T p.Ala929Ala synonymous BAI2 2 72178 2.77093E-5 36089 0 1.61759E-5
1-32203801-C-T p.Leu924Leu splice_region+synonymous BAI2 1 82442 1.21297E-5 41221 0 3.98194E-6
1-32203813-C-T p.Pro920Pro synonymous BAI2 2 82558 2.42254E-5 41279 0 3.82214E-4
1-32203813-C-A p.Pro920Pro synonymous BAI2 1 82558 1.21127E-5 41279 0 3.98127E-6
1-32203814-G-A p.Pro920Leu missense BAI2 6 82534 7.26973E-5 41267 0 5.03525E-4
1-32203815-G-A p.Pro920Ser missense BAI2 1 82576 1.21101E-5 41288 0 3.98038E-6
1-32203821-C-T p.Ala918Thr missense BAI2 1 82630 1.21021E-5 41315 0 8.26624E-6
1-32203840-C-T p.Leu911Leu synonymous BAI2 4 82742 4.8343E-5 41371 0 6.37755E-5
1-32203848-G-C p.Gln847Glu missense+splice_region BAI2 2 82752 2.41686E-5 41376 0 3.19183E-5
1-32203859-C-T p.Arg905His missense BAI2 7 82706 8.46371E-5 41353 0 1.15651E-4
1-32203872-C-T p.Ala901Thr missense BAI2 3 82716 3.62687E-5 41358 0 NA
1-32203878-T-TCGAAC p.Thr899fs frameshift BAI2 1 82694 1.20928E-5 41347 0 NA
1-32203886-G-A p.Thr896Ile missense BAI2 2 82670 2.41926E-5 41335 0 1.19354E-5
1-32203933-G-A c.2646-6C>T splice_region BAI2 1 82360 1.21418E-5 41180 0 NA
1-32204192-T-C p.Arg881Gly missense BAI2 1 81528 1.22657E-5 40764 0 NA
1-32204211-G-A p.Cys874Cys synonymous BAI2 1 81620 1.22519E-5 40810 0 4.58243E-5
1-32204214-A-G p.His873His synonymous BAI2 907 81680 0.0111043 40840 38 0.0254864
1-32204217-G-T p.Pro872Pro synonymous BAI2 3 81728 3.67071E-5 40864 0 2.23209E-5
1-32204221-TC-T p.Asp871fs frameshift BAI2 1 81696 1.22405E-5 40848 0 NA
1-32204223-C-T p.Thr870Thr synonymous BAI2 4 81704 4.89572E-5 40852 0 9.56206E-5
1-32204224-G-A p.Thr870Met missense BAI2 4 81706 4.8956E-5 40853 0 5.46233E-5
1-32204230-C-G p.Gly868Ala missense+splice_region BAI2 12 81730 1.46825E-4 40865 0 3.11493E-4
1-32204237-G-A c.2602-6C>T splice_region BAI2 26 81728 3.18128E-4 40864 0 0.00625
1-32204239-G-A c.2602-8C>T splice_region BAI2 27 81718 3.30405E-4 40859 0 9.56206E-4
1-32204434-T-C p.Asn867Ser missense+splice_region BAI2 5 82028 6.09548E-5 41014 0 1.98891E-5
1-32204441-T-C p.Ile865Val missense BAI2 2 82056 2.43736E-5 41028 0 8.24688E-6
1-32204445-G-A p.Ser863Ser synonymous BAI2 1 82044 1.21886E-5 41022 0 2.47423E-5
1-32204451-C-T p.Glu861Glu synonymous BAI2 19 82030 2.31623E-4 41015 0 5.04032E-4
1-32204471-C-T p.Glu855Lys missense BAI2 3 81932 3.66157E-5 40966 0 NA
1-32204476-G-A p.Pro853Leu missense BAI2 288 81860 0.0035182 40930 1 0.00660451
1-32204515-C-T p.Arg840Gln missense BAI2 1 79916 1.25131E-5 39958 0 0.00100705
1-32204525-C-T p.Val837Ile missense BAI2 1 78964 1.2664E-5 39482 0 5.63507E-5
1-32204526-G-A p.Ala836Ala synonymous BAI2 7 78902 8.87177E-5 39451 0 8.91947E-4
1-32204532-C-T p.Pro834Pro synonymous BAI2 2 77872 2.56832E-5 38936 0 3.44923E-5
1-32204533-G-C p.Pro834Arg missense BAI2 1 77830 1.28485E-5 38915 0 NA
1-32204536-G-A p.Pro833Leu missense+splice_region BAI2 1 77324 1.29326E-5 38662 0 NA
1-32204537-G-C p.Pro833Ala missense+splice_region BAI2 1 77136 1.29641E-5 38568 0 NA
1-32204542-C-T c.2496-4G>A splice_region BAI2 4 76332 5.24027E-5 38166 0 2.87715E-5
1-32204542-C-A c.2496-4G>T splice_region BAI2 1 76332 1.31007E-5 38166 0 NA
1-32204905-T-G c.2495+4A>C splice_region BAI2 1 77986 1.28228E-5 38993 0 NA
1-32204917-C-T p.Pro829Pro synonymous BAI2 1 78344 1.27642E-5 39172 0 3.18512E-5
1-32204918-G-A p.Pro829Leu missense BAI2 2 78466 2.54887E-5 39233 0 NA
1-32204922-G-A p.Leu828Leu synonymous BAI2 1 78746 1.26991E-5 39373 0 NA
1-32204926-G-A p.Leu826Leu synonymous BAI2 2 78912 2.53447E-5 39456 0 NA
1-32204943-A-G p.Tyr821His missense BAI2 1 79456 1.25856E-5 39728 0 NA
1-32204956-G-A p.Ile816Ile synonymous BAI2 300 79890 0.00375516 39945 1 0.00335707
1-32204956-G-C p.Ile816Met missense BAI2 10 79898 1.2516E-4 39949 0 1.01729E-4
1-32204966-T-C p.Tyr813Cys missense BAI2 1 80146 1.24772E-5 40073 0 NA
1-32204976-C-T p.Glu810Lys missense BAI2 2 80428 2.4867E-5 40214 0 NA
1-32204991-G-T p.Pro805Thr missense BAI2 1 80672 1.23959E-5 40336 0 NA
1-32205000-G-A p.Arg802Cys missense BAI2 1 80632 1.2402E-5 40316 0 NA
1-32205013-G-A p.Gly797Gly synonymous BAI2 1 80772 1.23805E-5 40386 0 1.70555E-5
1-32205020-C-A p.Gly795Val missense BAI2 1 80832 1.23713E-5 40416 0 NA
1-32205029-A-C p.Val792Gly missense BAI2 1 80972 1.23499E-5 40486 0 NA
1-32205031-C-T p.Thr791Thr synonymous BAI2 41 81034 5.0596E-4 40517 0 5.98489E-4
1-32205032-G-A p.Thr791Met missense BAI2 2 81048 2.46767E-5 40524 0 1.49068E-5
1-32205040-G-A p.Gly788Gly synonymous BAI2 2 81108 2.46585E-5 40554 0 9.06509E-5
1-32205042-C-T p.Gly788Ser missense BAI2 5 81196 6.15794E-5 40598 0 8.54409E-5
1-32205044-C-T p.Arg787Lys missense BAI2 1 81222 1.23119E-5 40611 0 NA
1-32205049-C-A p.Arg785Ser missense BAI2 2 81230 2.46214E-5 40615 0 NA
1-32205049-C-G p.Arg785Ser missense BAI2 1 81230 1.23107E-5 40615 0 4.46668E-6
1-32205050-C-G p.Arg785Thr missense BAI2 1 81236 1.23098E-5 40618 0 4.46122E-6
1-32205065-G-A p.Ala780Val missense BAI2 1 81216 1.23128E-5 40608 0 NA
1-32205070-C-T p.Gly778Gly synonymous BAI2 12 81246 1.477E-4 40623 0 1.00205E-4
1-32205071-C-A p.Gly778Val missense BAI2 1 81264 1.23056E-5 40632 0 NA
1-32205078-T-C p.Thr776Ala missense BAI2 1 81240 1.23092E-5 40620 0 4.10614E-6
1-32205080-G-C p.Ala775Gly missense BAI2 1 81220 1.23122E-5 40610 0 NA
1-32205091-T-G p.Pro771Pro synonymous BAI2 1 81066 1.23356E-5 40533 0 NA
1-32205091-T-C p.Pro771Pro synonymous BAI2 1 81066 1.23356E-5 40533 0 NA
1-32205092-G-C p.Pro771Arg missense BAI2 1 81082 1.23332E-5 40541 0 4.06868E-6
1-32205097-G-A p.Ser769Ser synonymous BAI2 5 81042 6.16964E-5 40521 0 6.25E-4
1-32205102-G-C p.Leu768Val missense BAI2 25 81032 3.0852E-4 40516 0 0.00100908
1-32205127-G-A p.Leu759Leu synonymous BAI2 1 81294 1.2301E-5 40647 0 2.8211E-5
1-32205131-C-T p.Arg758His missense BAI2 1 81178 1.23186E-5 40589 0 2.23044E-4
1-32205146-C-T p.Arg753Gln missense BAI2 2 81152 2.46451E-5 40576 0 NA
1-32205160-C-T p.Met748Ile missense BAI2 1 81406 1.22841E-5 40703 0 4.04907E-5
1-32205161-A-G p.Met748Thr missense BAI2 1 81348 1.22929E-5 40674 0 1.21433E-5
1-32205178-C-G p.Met742Ile missense BAI2 4 81012 4.93754E-5 40506 0 NA
1-32205179-A-G p.Met742Thr missense BAI2 1 80916 1.23585E-5 40458 0 3.18471E-5
1-32205180-T-A p.Met742Leu missense BAI2 59 81008 7.28323E-4 40504 3 0.00309499
1-32205181-G-C p.Pro741Pro synonymous BAI2 1 81040 1.23396E-5 40520 0 NA
1-32205207-C-T p.Ala733Thr missense BAI2 9 80386 1.1196E-4 40193 0 1.53488E-4
1-32205213-C-T p.Val731Ile missense BAI2 2 80222 2.49308E-5 40111 0 8.65718E-6
1-32205214-G-A p.Pro730Pro synonymous BAI2 2 80236 2.49265E-5 40118 0 3.18431E-5
1-32205229-G-A p.Ser725Ser synonymous BAI2 1 80230 1.24642E-5 40115 0 8.98901E-6
1-32205241-A-G c.2168-5T>C splice_region BAI2 1 80134 1.24791E-5 40067 0 4.68485E-6
1-32205242-G-A c.2168-6C>T splice_region BAI2 1 80154 1.2476E-5 40077 0 NA
1-32205521-T-A c.2167+6A>T splice_region BAI2 1 82698 1.20922E-5 41349 0 NA
1-32205524-T-C c.2167+3A>G splice_region BAI2 2 82758 2.41668E-5 41379 0 NA
1-32205541-AC-A p.Val718fs frameshift BAI2 1 82914 1.20607E-5 41457 0 NA
1-32205548-G-A p.Leu716Leu synonymous BAI2 1 82948 1.20557E-5 41474 0 8.25559E-6
1-32205576-G-A p.Gly706Gly synonymous BAI2 2 82990 2.40993E-5 41495 0 1.19326E-5
1-32205585-G-A p.His703His synonymous BAI2 6 83012 7.22787E-5 41506 0 3.18776E-5
1-32205602-C-T p.Val698Met missense BAI2 1 82962 1.20537E-5 41481 0 5.03525E-4
1-32205603-G-A p.Val697Val synonymous BAI2 50 82954 6.02744E-4 41477 1 4.45456E-4
1-32205607-C-T p.Arg696His missense BAI2 3 82958 3.61629E-5 41479 0 3.97741E-6
1-32205609-G-A p.Leu695Leu synonymous BAI2 1 82934 1.20578E-5 41467 0 NA
1-32205615-G-C p.His693Gln missense BAI2 104 82898 0.00125455 41449 0 0.00302115
1-32205628-G-T p.Pro689His missense BAI2 2 82778 2.4161E-5 41389 0 NA
1-32205628-G-C p.Pro689Arg missense BAI2 2 82778 2.4161E-5 41389 0 NA
1-32205640-G-A c.2059-5C>T splice_region BAI2 1 82678 1.20951E-5 41339 0 3.18796E-5
1-32205706-C-T c.2058+5G>A splice_region BAI2 1 80108 1.24831E-5 40054 0 3.99042E-6
1-32205718-G-A p.Ala684Val missense BAI2 1 79280 1.26135E-5 39640 0 NA
1-32205720-A-G p.Asp683Asp synonymous BAI2 1 79148 1.26346E-5 39574 0 NA
1-32205723-G-A p.Asp682Asp synonymous BAI2 1 78602 1.27223E-5 39301 0 NA
1-32205724-T-A p.Asp682Val missense BAI2 2 78614 2.54408E-5 39307 0 NA
1-32205729-C-T p.Lys680Lys synonymous BAI2 12 78334 1.5319E-4 39167 0 9.59409E-5
1-32205744-C-T p.Ala675Ala synonymous BAI2 3 77334 3.87928E-5 38667 0 0.00100705
1-32205745-G-A p.Ala675Val missense BAI2 3 77208 3.88561E-5 38604 0 0.00100705
1-32205778-C-T p.Arg664His missense+splice_region BAI2 1 76258 1.31134E-5 38129 0 1.65898E-5
1-32205779-G-A p.Arg664Cys missense+splice_region BAI2 1 76254 1.31141E-5 38127 0 4.00702E-6
1-32205941-G-A c.1989+7C>T splice_region BAI2 2 82194 2.43327E-5 41097 0 3.63369E-5
1-32205966-G-T p.Pro657Pro synonymous BAI2 1 82340 1.21448E-5 41170 0 NA
1-32205966-G-A p.Pro657Pro synonymous BAI2 2 82340 2.42895E-5 41170 0 1.60188E-5
1-32205971-C-T p.Val656Met missense BAI2 1 82346 1.21439E-5 41173 0 8.40986E-6
1-32205972-G-A p.Tyr655Tyr synonymous BAI2 1 82324 1.21471E-5 41162 0 2.79915E-5
1-32206010-G-A p.Leu643Leu synonymous BAI2 1 82368 1.21406E-5 41184 0 NA
1-32206044-G-A p.Tyr631Tyr synonymous BAI2 3 82174 3.65079E-5 41087 0 6.36983E-5
1-32206051-C-T p.Arg629His missense BAI2 2 82052 2.43748E-5 41026 0 3.99591E-6
1-32206054-C-T p.Arg628Gln missense BAI2 4 81982 4.87912E-5 40991 0 1.27413E-4
1-32206058-C-T p.Ala627Thr missense BAI2 1 82008 1.21939E-5 41004 0 NA
1-32206062-T-G p.Leu625Leu synonymous BAI2 1 81946 1.22032E-5 40973 0 NA
1-32206069-T-C p.Gln623Arg missense BAI2 2 81862 2.44314E-5 40931 0 NA
1-32206073-G-A p.Leu622Leu synonymous BAI2 2 81764 2.44606E-5 40882 0 NA
1-32206078-C-T p.Arg620His missense BAI2 1 81520 1.22669E-5 40760 0 4.02262E-6
1-32206089-C-T p.Ser616Ser synonymous BAI2 3 81392 3.68587E-5 40696 1 6.25E-4
1-32206098-C-T p.Glu613Glu synonymous BAI2 4 81300 4.92005E-5 40650 0 6.25E-4
1-32206101-G-A p.Gly612Gly synonymous BAI2 2 81102 2.46603E-5 40551 0 1.61683E-5
1-32206134-C-T p.Glu601Glu synonymous BAI2 2 79844 2.50488E-5 39922 0 2.27233E-4
1-32206149-G-A c.1795-7C>T splice_region BAI2 2 79064 2.5296E-5 39532 0 1.22733E-5
1-32206966-G-A c.1794+8C>T splice_region BAI2 1 80036 1.24944E-5 40018 0 4.53659E-5
1-32206967-C-T c.1794+7G>A splice_region BAI2 1 80058 1.24909E-5 40029 0 NA
1-32206985-G-A p.Leu595Leu synonymous BAI2 1 80664 1.23971E-5 40332 0 NA
1-32206990-C-T p.Arg593His missense BAI2 1 80770 1.23808E-5 40385 0 1.75457E-5
1-32207011-C-T p.Arg586His missense BAI2 1 81080 1.23335E-5 40540 0 1.55178E-5
1-32207012-G-A p.Arg586Cys missense BAI2 1 81152 1.23226E-5 40576 0 NA
1-32207028-C-T p.Gly580Gly synonymous BAI2 2 81350 2.45851E-5 40675 0 6.37918E-5
1-32207028-C-G p.Gly580Gly synonymous BAI2 2 81350 2.45851E-5 40675 0 NA
1-32207037-C-T p.Ala577Ala synonymous BAI2 3 81400 3.6855E-5 40700 0 6.25E-4
1-32207042-C-T p.Val576Met missense BAI2 2 81500 2.45399E-5 40750 0 4.84982E-5
1-32207043-G-A p.Gly575Gly synonymous BAI2 7 81496 8.58938E-5 40748 0 0.0020202
1-32207050-G-A p.Ala573Val missense BAI2 1 81576 1.22585E-5 40788 0 NA
1-32207073-G-C p.Ala565Ala synonymous BAI2 1 81196 1.23159E-5 40598 0 6.38203E-5
1-32207079-C-G p.Gly563Gly splice_region+synonymous BAI2 1 81068 1.23353E-5 40534 0 NA
1-32207087-G-T c.1688-7C>A splice_region BAI2 1 81156 1.23219E-5 40578 0 NA
1-32207217-C-T c.1687+8G>A splice_region BAI2 2 82192 2.43333E-5 41096 0 NA
1-32207235-C-CG p.Asn560fs frameshift BAI2 1 82442 1.21297E-5 41221 0 2.50238E-5
1-32207236-G-A p.Pro559Leu missense BAI2 1 82450 1.21286E-5 41225 0 2.49896E-5
1-32207237-G-A p.Pro559Ser missense BAI2 1 82530 1.21168E-5 41265 0 3.19244E-5
1-32207262-G-A p.Gly550Gly synonymous BAI2 13 82744 1.57111E-4 41372 0 5.972E-5
1-32207269-G-A p.Ala548Val missense BAI2 3 82836 3.62161E-5 41418 0 5.03525E-4
1-32207283-C-G p.Thr543Thr synonymous BAI2 2 82872 2.41336E-5 41436 0 6.25E-4
1-32207283-C-T p.Thr543Thr synonymous BAI2 1 82872 1.20668E-5 41436 0 NA
1-32207284-G-A p.Thr543Met missense BAI2 1 82886 1.20648E-5 41443 0 5.97048E-5
1-32207294-T-A p.Met540Leu missense BAI2 3 82970 3.61576E-5 41485 0 NA
1-32207298-G-A p.Tyr538Tyr synonymous BAI2 1 82960 1.2054E-5 41480 0 8.26692E-6
1-32207300-A-G p.Tyr538His missense BAI2 1 82966 1.20531E-5 41483 0 8.26952E-6
1-32207326-GCTGTGGGTGCAGGGGTAAGGTTCAGCTGGGTCCACACATGGGGCCCCCAGCCCCCAGGGTCATTAGGGCAGTAC-G c.1585+1_1586-1delGTACTGCCCTAATGACCCTGGGGGCTGGGGGCCCCATGTGTGGACCCAGCTGAACCTTACCCCTGCACCCACAG splice_acceptor BAI2 2 82984 2.4101E-5 41492 1 NA
1-32207333-G-A c.1586-7C>T splice_region BAI2 2 82982 2.41016E-5 41491 1 NA
1-32207394-G-C c.1585+7C>G splice_region BAI2 1 82960 1.2054E-5 41480 0 6.38651E-5
1-32207417-A-G p.Ser523Ser synonymous BAI2 2 82930 2.41167E-5 41465 0 3.43065E-5
1-32207420-A-G p.Cys522Cys synonymous BAI2 1 82926 1.20589E-5 41463 0 NA
1-32207440-C-T p.Gly516Arg missense BAI2 3 82774 3.62433E-5 41387 0 5.98137E-5
1-32207441-G-A p.Thr515Thr synonymous BAI2 3 82750 3.62538E-5 41375 0 8.53271E-6
1-32207450-G-A p.Cys512Cys synonymous BAI2 2 82720 2.41779E-5 41360 0 6.25E-4
1-32207465-C-T p.Thr507Thr synonymous BAI2 1 82596 1.21071E-5 41298 0 8.01841E-5
1-32207465-C-A p.Thr507Thr synonymous BAI2 1 82596 1.21071E-5 41298 0 3.18857E-5
1-32207466-G-A p.Thr507Met missense BAI2 1 82608 1.21054E-5 41304 0 1.68543E-5
1-32207468-G-A p.Gly506Gly synonymous BAI2 2 82626 2.42055E-5 41313 0 8.4202E-6
1-32207471-C-T p.Thr505Thr synonymous BAI2 1 82620 1.21036E-5 41310 0 5.0466E-5
1-32207472-G-A p.Thr505Met missense BAI2 3 82588 3.63249E-5 41294 0 1.20073E-5
1-32207494-G-A p.Arg498Cys missense BAI2 1 82460 1.21271E-5 41230 0 NA
1-32207496-C-T p.Arg497His missense BAI2 2 82464 2.4253E-5 41232 0 6.72303E-5
1-32207508-G-A p.Thr493Ile missense BAI2 4 82554 4.84531E-5 41277 0 4.00218E-6
1-32207516-C-T p.Thr490Thr synonymous BAI2 3 82542 3.63451E-5 41271 0 6.37633E-5
1-32207537-C-T p.Ala483Ala synonymous BAI2 2 82376 2.42789E-5 41188 0 6.11706E-5
1-32207546-T-G p.Pro480Pro synonymous BAI2 8 82316 9.71865E-5 41158 0 4.13298E-5
1-32207575-G-A c.1418-7C>T splice_region BAI2 2 81940 2.44081E-5 40970 0 4.26185E-6
1-32207648-A-G c.1417+6T>C splice_region BAI2 1 80880 1.2364E-5 40440 0 NA
1-32207656-G-A p.Pro472Leu missense+splice_region BAI2 3 80522 3.72569E-5 40261 0 NA
1-32207663-C-T p.Glu470Lys missense BAI2 2 80054 2.49831E-5 40027 0 1.73871E-5
1-32207664-G-A p.Leu469Leu synonymous BAI2 1 80118 1.24816E-5 40059 0 NA
1-32207678-C-T p.Glu465Lys missense BAI2 1 79360 1.26008E-5 39680 0 4.04652E-6
1-32207691-G-A p.Leu460Leu synonymous BAI2 1 78538 1.27327E-5 39269 0 NA
1-32207697-A-G p.Gly458Gly synonymous BAI2 2 77232 2.5896E-5 38616 0 3.19632E-5
1-32207700-C-G p.Thr457Thr synonymous BAI2 1 77510 1.29016E-5 38755 0 1.70602E-5
1-32207701-G-A p.Thr457Met missense BAI2 2 77798 2.57076E-5 38899 0 3.40977E-5
1-32207702-T-A p.Thr457Ser missense BAI2 1 77822 1.28498E-5 38911 0 NA
1-32207705-A-C p.Cys456Gly missense BAI2 1 77826 1.28492E-5 38913 0 NA
1-32207717-C-G p.Ala452Pro missense BAI2 1 77192 1.29547E-5 38596 0 2.56542E-5
1-32207720-G-A p.Pro451Ser missense BAI2 12 77482 1.54875E-4 38741 0 2.55265E-4
1-32207729-C-T p.Val448Met missense BAI2 14 78362 1.78658E-4 39181 0 1.28694E-4
1-32207730-G-T p.Ser447Arg missense BAI2 1 78390 1.27567E-5 39195 0 NA
1-32207730-G-A n.418C>T splice_region BAI2 1 78392 1.27564E-5 39196 0 1.20602E-5
1-32207761-T-C p.Asn437Ser missense BAI2 3 78882 3.80315E-5 39441 0 NA
1-32207762-T-A p.Asn437Tyr missense BAI2 1 78874 1.26784E-5 39437 0 NA
1-32207764-G-A p.Ala436Val missense BAI2 2 78810 2.53775E-5 39405 0 2.55737E-5
1-32207772-C-T p.Thr433Thr synonymous BAI2 1 78698 1.27068E-5 39349 0 8.05841E-6
1-32207773-G-A p.Thr433Met missense BAI2 3 78706 3.81165E-5 39353 0 6.37511E-5
1-32207778-G-A p.Cys431Cys synonymous BAI2 2 78620 2.54388E-5 39310 0 NA
1-32207782-G-A p.Pro430Leu missense BAI2 12 78496 1.52874E-4 39248 0 1.21141E-4
1-32207785-C-T p.Gly429Asp missense BAI2 1 78330 1.27665E-5 39165 0 4.07963E-6
1-32207790-G-A p.Pro427Pro synonymous BAI2 2 78254 2.55578E-5 39127 0 4.07481E-6
1-32207800-T-C p.Glu424Gly missense BAI2 1 77812 1.28515E-5 38906 0 NA
1-32207804-A-G p.Leu423Leu synonymous BAI2 1 77488 1.29052E-5 38744 0 NA
1-32208493-C-G p.Ala400Pro missense BAI2 1 50200 1.99203E-5 25100 0 NA
1-32208507-T-TG p.Gln395fs frameshift BAI2 1 47816 2.09135E-5 23908 0 8.18331E-5
1-32208508-G-C p.Gln395Glu missense BAI2 3 47666 6.29379E-5 23833 0 NA
1-32208509-G-A p.Pro394Pro synonymous BAI2 1 47674 2.09758E-5 23837 0 NA
1-32208524-C-T p.Arg389Arg synonymous BAI2 1 45686 2.18885E-5 22843 0 NA
1-32208530-C-A p.Arg387Arg synonymous BAI2 1 45012 2.22163E-5 22506 0 NA
1-32208551-G-A p.Cys380Cys synonymous BAI2 21 43204 4.86066E-4 21602 0 6.31313E-4
1-32208563-G-A p.Cys376Cys synonymous BAI2 1 42422 2.35727E-5 21211 0 2.28078E-5
1-32208570-C-T p.Ser374Asn missense BAI2 1 42034 2.37903E-5 21017 0 NA
1-32208578-C-A p.Gly371Gly synonymous BAI2 7 41612 1.68221E-4 20806 0 3.51685E-4
1-32208594-A-ACGC p.Gly365dup conservative_inframe_insertion BAI2 1 40600 2.46305E-5 20300 0 3.20431E-5
1-32208599-G-A p.His364His synonymous BAI2 2 40138 4.98281E-5 20069 0 0.00129702
1-32208600-T-G p.His364Pro missense BAI2 1 40116 2.49277E-5 20058 0 NA
1-32208602-C-T p.Val363Val splice_region+synonymous BAI2 3 39938 7.51164E-5 19969 0 3.19509E-5
1-32209807-T-A p.Ser358Ser synonymous BAI2 1 80394 1.24387E-5 40197 0 6.82566E-6
1-32209810-A-G p.Asn357Asn synonymous BAI2 3 80472 3.728E-5 40236 0 NA
1-32209821-G-A p.Pro354Ser missense BAI2 4 80464 4.97117E-5 40232 0 2.00541E-4
1-32209832-C-T p.Arg350Gln missense BAI2 4 80642 4.96019E-5 40321 0 9.83284E-5
1-32209834-C-T p.Leu349Leu synonymous BAI2 2 80652 2.47979E-5 40326 0 1.9706E-5
1-32209840-C-T p.Gly347Gly synonymous BAI2 1 80640 1.24008E-5 40320 0 NA
1-32209842-C-A p.Gly347Trp missense BAI2 2 80626 2.48059E-5 40313 0 0.00173611
1-32209842-C-T p.Gly347Arg missense BAI2 1 80626 1.24029E-5 40313 0 3.19224E-5
1-32209847-C-G p.Cys345Ser missense BAI2 2 80680 2.47893E-5 40340 0 9.56999E-5
1-32209852-G-A p.Thr343Thr synonymous BAI2 1 80736 1.2386E-5 40368 0 6.44828E-6
1-32209852-G-C p.Thr343Thr synonymous BAI2 2 80736 2.47721E-5 40368 0 NA
1-32209860-A-G p.Tyr341His missense BAI2 2 80776 2.47598E-5 40388 0 NA
1-32209862-G-T p.Pro340His missense BAI2 4 80776 4.95197E-5 40388 0 1.27641E-4
1-32209862-G-A p.Pro340Leu missense BAI2 1 80776 1.23799E-5 40388 0 6.42211E-6
1-32209862-G-C p.Pro340Arg missense BAI2 2 80774 2.47604E-5 40387 0 3.19101E-5
1-32209869-A-G p.Ser338Pro missense BAI2 5 80788 6.18904E-5 40394 0 4.86287E-5
1-32209881-G-A p.Arg334Cys missense BAI2 1 80780 1.23793E-5 40390 0 1.28347E-5
1-32209882-G-A p.Thr333Thr synonymous BAI2 2 80798 2.47531E-5 40399 0 8.97896E-5
1-32209902-G-T p.Gln327Lys missense BAI2 2 80754 2.47666E-5 40377 0 NA
1-32209909-C-T p.Thr324Thr synonymous BAI2 25 80714 3.09736E-4 40357 0 0.00467152
1-32209910-G-A p.Thr324Met missense BAI2 13 80676 1.61138E-4 40338 0 1.59479E-4
1-32209923-C-T p.Val320Met missense BAI2 2 80558 2.48268E-5 40279 0 5.78592E-5
1-32209924-G-A p.Ser319Ser synonymous BAI2 2 80506 2.48429E-5 40253 0 NA
1-32209939-C-T p.Glu314Glu synonymous BAI2 1 80122 1.2481E-5 40061 0 1.29157E-5
1-32209942-C-T p.Glu313Glu synonymous BAI2 1 80114 1.24822E-5 40057 0 6.45453E-6
1-32209949-G-A p.Ala311Val missense BAI2 121 79582 0.00152044 39791 1 0.00204724
1-32209951-C-T p.Pro310Pro synonymous BAI2 4 79498 5.03157E-5 39749 0 1.94265E-5
1-32209951-C-G p.Pro310Pro synonymous BAI2 1 79498 1.25789E-5 39749 0 6.47551E-6
1-32209955-TCGCCTACGAGAGAGGGA-T p.Gly308del splice_acceptor BAI2 1 79290 1.26119E-5 39645 0 NA
1-32209957-G-A p.Gly308Gly splice_region+synonymous BAI2 2 79014 2.5312E-5 39507 0 NA
1-32209962-C-T c.923-4G>A splice_region BAI2 1 78730 1.27016E-5 39365 0 NA
1-32209963-G-A c.923-5C>T splice_region BAI2 5 78642 6.35793E-5 39321 0 1.61516E-4
1-32210242-G-A c.922+7C>T splice_region BAI2 6 82400 7.28155E-5 41200 0 3.99329E-5
1-32210256-C-T p.Ala305Ala synonymous BAI2 2 82756 2.41674E-5 41378 0 1.67985E-5
1-32210258-C-A p.Ala305Ser missense BAI2 6 82804 7.24603E-5 41402 0 NA
1-32210261-T-C p.Met1? start_lost BAI2 1 82874 1.20665E-5 41437 0 8.34711E-6
1-32210289-C-T p.Pro294Pro synonymous BAI2 45 83082 5.41634E-4 41541 0 0.00151057
1-32210290-G-A p.Pro294Leu missense BAI2 1 83068 1.20383E-5 41534 0 3.18613E-5
1-32210311-G-A p.Pro287Leu missense BAI2 38 83110 4.57225E-4 41555 0 2.78432E-4
1-32210312-G-C p.Pro287Ala missense BAI2 10 83118 1.20311E-4 41559 0 5.09716E-4
1-32210322-C-T p.Pro283Pro synonymous BAI2 2 83082 2.40726E-5 41541 0 2.38703E-5
1-32210323-G-A p.Pro283Leu missense BAI2 1 83064 1.20389E-5 41532 0 2.48595E-5
1-32210325-C-T p.Glu282Glu synonymous BAI2 1 83084 1.2036E-5 41542 0 1.6584E-5
1-32221601-A-G p.Tyr279Tyr splice_region+synonymous BAI2 2 79602 2.5125E-5 39801 0 3.18735E-5
1-32221605-C-T p.Arg278Lys missense BAI2 1 79720 1.25439E-5 39860 0 NA
1-32221610-C-T p.Glu276Glu synonymous BAI2 1 79778 1.25348E-5 39889 0 NA
1-32221617-G-T p.Thr274Lys missense BAI2 2 80026 2.49919E-5 40013 0 3.18573E-5
1-32221629-T-C p.Asn270Ser missense BAI2 1 80524 1.24187E-5 40262 0 NA
1-32221636-T-C p.Ser268Gly missense BAI2 2 80602 2.48133E-5 40301 0 8.30951E-6
1-32221640-C-T p.Ser266Ser synonymous BAI2 2 80754 2.47666E-5 40377 0 6.25E-4
1-32221641-G-A p.Ser266Leu missense BAI2 1 80768 1.23811E-5 40384 0 4.00853E-6
1-32221651-C-T p.Asp263Asn missense BAI2 1 81108 1.23292E-5 40554 0 3.18634E-5
1-32221655-C-T p.Glu261Glu synonymous BAI2 1 81180 1.23183E-5 40590 0 4.00192E-6
1-32221665-G-A p.Pro258Leu missense BAI2 1 81248 1.2308E-5 40624 0 NA
1-32221666-G-A p.Pro258Ser missense BAI2 3 81240 3.69276E-5 40620 0 3.7203E-4
1-32221667-G-A p.Ala257Ala synonymous BAI2 1 81196 1.23159E-5 40598 0 8.29311E-6
1-32221667-G-C p.Ala257Ala synonymous BAI2 1 81196 1.23159E-5 40598 0 NA
1-32221673-G-A p.Gly255Gly synonymous BAI2 1 81048 1.23384E-5 40524 0 NA
1-32221674-C-T p.Gly255Asp missense BAI2 7 81040 8.63771E-5 40520 0 4.00426E-6
1-32221675-C-T p.Gly255Ser missense BAI2 1 81094 1.23314E-5 40547 0 NA
1-32221676-C-T p.Gly254Gly synonymous BAI2 1 81124 1.23268E-5 40562 0 4.00022E-6
1-32221678-C-T p.Gly254Arg missense BAI2 2 81146 2.46469E-5 40573 0 9.56389E-5
1-32221679-G-A p.Pro253Pro synonymous BAI2 5 81080 6.16675E-5 40540 0 2.49149E-5
1-32221685-C-T p.Leu251Leu synonymous BAI2 1 81172 1.23195E-5 40586 0 1.2001E-5
1-32221686-A-C p.Leu251Arg missense BAI2 1 81202 1.2315E-5 40601 0 NA
1-32221727-TGTG-T p.Thr237del disruptive_inframe_deletion BAI2 2 78486 2.54823E-5 39243 0 8.37703E-6
1-32221731-G-C p.Thr236Ser missense BAI2 4 78086 5.12256E-5 39043 1 1.67985E-5
1-32221744-C-T p.Gly232Ser missense BAI2 2 74628 2.67996E-5 37314 0 1.24128E-5
1-32221745-G-A p.Ala231Ala synonymous BAI2 1 75024 1.33291E-5 37512 0 1.64366E-4
1-32221746-G-A p.Ala231Val missense BAI2 1 73698 1.35689E-5 36849 0 6.41272E-5
1-32221751-C-T p.Ala229Ala synonymous BAI2 3 78416 3.82575E-5 39208 0 3.18674E-5
1-32221752-G-A p.Ala229Val missense BAI2 6 78056 7.68679E-5 39028 0 6.37714E-5
1-32221755-T-C p.Glu228Gly missense BAI2 8 77956 1.02622E-4 38978 0 9.57488E-5
1-32221760-A-T p.Pro226Pro synonymous BAI2 1 77760 1.28601E-5 38880 0 1.70596E-5
1-32221782-G-A p.Ala219Val missense BAI2 1 75692 1.32114E-5 37846 0 1.71494E-5
1-32221783-C-T p.Ala219Thr missense BAI2 3 75672 3.96448E-5 37836 0 8.57192E-6
1-32221787-G-T p.Gly217Gly synonymous BAI2 1 75062 1.33223E-5 37531 0 NA
1-32221790-G-A p.Cys216Cys synonymous BAI2 4 74306 5.38315E-5 37153 0 4.09997E-5
1-32221798-T-G p.Arg214Arg synonymous BAI2 14 75394 1.85691E-4 37697 0 2.86843E-4
1-32221801-C-T p.Gly213Ser missense BAI2 1 75020 1.33298E-5 37510 0 NA
1-32221802-G-A p.Ala212Ala synonymous BAI2 13 75060 1.73195E-4 37530 0 1.19487E-4
1-32221808-G-A p.Arg210Arg synonymous BAI2 3 74068 4.05033E-5 37034 0 5.03525E-4
1-32221811-G-A p.Gly209Gly synonymous BAI2 16 73634 2.17291E-4 36817 0 2.98101E-4
1-32221820-C-A p.Glu206Asp missense BAI2 4 73276 5.45881E-5 36638 0 6.80921E-5
1-32221830-C-T p.Arg203His missense BAI2 2 72202 2.77001E-5 36101 0 8.50977E-6
1-32221830-C-A p.Arg203Leu missense BAI2 3 72202 4.15501E-5 36101 0 NA
1-32221846-A-T p.Cys198Ser missense BAI2 1 71294 1.40264E-5 35647 0 NA
1-32221850-G-A p.Phe196Phe synonymous BAI2 1 71112 1.40623E-5 35556 0 NA
1-32221856-G-A p.Ser194Ser synonymous BAI2 1 70804 1.41235E-5 35402 0 NA
1-32221857-C-A p.Ser194Ile missense BAI2 1 70822 1.41199E-5 35411 0 NA
1-32221861-AGTT-A p.Asn192del conservative_inframe_deletion BAI2 3 70716 4.24232E-5 35358 0 3.18532E-5
1-32221876-T-C p.Ile188Val missense BAI2 4 70554 5.66942E-5 35277 0 NA
1-32221877-G-T p.Leu187Leu synonymous BAI2 2 70554 2.83471E-5 35277 0 NA
1-32221889-G-A p.Val183Val synonymous BAI2 1 70384 1.42078E-5 35192 0 3.41956E-5
1-32221896-C-T p.Arg181His missense BAI2 2 70172 2.85014E-5 35086 0 1.27372E-4
1-32221897-G-A p.Arg181Cys missense BAI2 2 70364 2.84236E-5 35182 0 8.56032E-6
1-32221913-G-A p.Pro175Pro synonymous BAI2 8573 70362 0.121841 35181 645 0.175625
1-32221916-C-T p.Ala174Ala synonymous BAI2 8 70544 1.13404E-4 35272 0 0.00159246
1-32221917-G-A p.Ala174Val missense BAI2 2 70778 2.82574E-5 35389 0 4.30315E-5
1-32221918-C-A p.Ala174Ser missense BAI2 1 70902 1.4104E-5 35451 0 4.09373E-6
1-32221925-G-T p.Arg171Arg synonymous BAI2 3 71318 4.20651E-5 35659 0 1.72313E-5
1-32221928-C-T p.Pro170Pro synonymous BAI2 3 71234 4.21147E-5 35617 0 8.62664E-5
1-32221929-G-A p.Pro170Leu missense BAI2 11 71358 1.54152E-4 35679 0 0.00375
1-32221937-G-A p.Ser167Ser synonymous BAI2 2 71736 2.788E-5 35868 0 0.00100705
1-32221950-G-A p.Ser163Leu missense BAI2 1 72626 1.37692E-5 36313 0 8.64783E-6
1-32221967-G-A p.Phe157Phe synonymous BAI2 1 73878 1.35358E-5 36939 0 1.21751E-5
1-32221979-G-C p.Phe153Leu missense BAI2 1 74536 1.34163E-5 37268 0 3.18512E-5
1-32221994-A-G p.Phe148Phe synonymous BAI2 1 75402 1.32622E-5 37701 0 NA
1-32221999-G-C p.Pro147Ala missense BAI2 5 75366 6.63429E-5 37683 0 2.3957E-4
1-32222009-G-A p.Ser143Ser synonymous BAI2 5 76104 6.56996E-5 38052 0 4.48591E-5
1-32222021-C-T p.Leu139Leu synonymous BAI2 3 77010 3.8956E-5 38505 0 0.00125156
1-32222024-C-A p.Gly138Gly synonymous BAI2 75 77298 9.70271E-4 38649 0 0.00175126
1-32222025-C-A p.Gly138Val missense BAI2 1 77340 1.29299E-5 38670 0 NA
1-32222027-C-T p.Ala137Ala synonymous BAI2 6 77470 7.74493E-5 38735 0 4.10738E-5
1-32222033-C-T p.Ala135Ala synonymous BAI2 3 78004 3.84596E-5 39002 0 2.87618E-5
1-32222034-G-GCCTCTGCCT p.Glu132_Glu134dup conservative_inframe_insertion BAI2 1 77892 1.28383E-5 38946 0 2.7786E-5
1-32222042-C-T p.Glu132Glu synonymous BAI2 3 78686 3.81262E-5 39343 0 4.63487E-5
1-32222057-C-T p.Arg127Arg synonymous BAI2 1 79110 1.26406E-5 39555 0 NA
1-32222059-G-C p.Arg127Gly missense BAI2 1 79120 1.2639E-5 39560 0 9.42863E-6
1-32222075-C-T p.Ala121Ala synonymous BAI2 41 79952 5.12808E-4 39976 0 0.00156041
1-32222087-C-T p.Ala117Ala synonymous BAI2 3 80444 3.7293E-5 40222 0 1.48718E-4
1-32222088-G-A p.Ala117Val missense BAI2 21 80424 2.61116E-4 40212 0 5.05561E-4
1-32222095-C-T p.Glu115Lys missense BAI2 1 80692 1.23928E-5 40346 0 4.08287E-6
1-32222096-G-T p.Pro114Pro synonymous BAI2 123 80644 0.00152522 40322 1 0.00331252
1-32222096-G-C p.Pro114Pro synonymous BAI2 4 80652 4.95958E-5 40326 0 5.29994E-5
1-32222096-G-A p.Pro114Pro synonymous BAI2 1 80652 1.23989E-5 40326 0 3.67694E-5
1-32222106-C-T p.Arg111Gln missense BAI2 1 80916 1.23585E-5 40458 0 1.21735E-5
1-32222107-G-A p.Arg111Trp missense BAI2 1 80924 1.23573E-5 40462 0 4.06233E-6
1-32222132-G-A p.His102His synonymous BAI2 2 81592 2.45122E-5 40796 0 NA
1-32222143-G-A p.Pro99Ser missense BAI2 2 81790 2.44529E-5 40895 0 8.8308E-6
1-32222167-C-T p.Ala91Thr missense BAI2 20 82148 2.43463E-4 41074 0 6.25E-4
1-32222168-G-A p.Cys90Cys synonymous BAI2 3 82172 3.65088E-5 41086 0 4.45482E-5
1-32222171-C-T p.Val89Val synonymous BAI2 1 82268 1.21554E-5 41134 0 NA
1-32222213-G-T p.Thr75Thr synonymous BAI2 2 82428 2.42636E-5 41214 0 2.75103E-5
1-32222231-C-G p.Leu69Leu synonymous BAI2 1 82414 1.21339E-5 41207 0 NA
1-32222249-C-T p.Ser63Ser synonymous BAI2 2 82390 2.42748E-5 41195 0 0.00100908
1-32222250-G-A p.Ser63Leu missense BAI2 6 82400 7.28155E-5 41200 0 3.18573E-5
1-32222253-G-A p.Ala62Val missense BAI2 1 82394 1.21368E-5 41197 0 NA
1-32222254-C-T p.Ala62Thr missense BAI2 1 82368 1.21406E-5 41184 0 3.18573E-5
1-32222291-G-A p.Tyr49Tyr synonymous BAI2 3 82052 3.65622E-5 41026 0 1.67718E-5
1-32222301-C-T p.Gly46Asp missense BAI2 2 81900 2.442E-5 40950 0 3.56566E-5
1-32222311-G-A p.Leu43Leu synonymous BAI2 2 81780 2.44559E-5 40890 0 NA
1-32222332-C-T p.Ala36Thr missense BAI2 2 81450 2.45549E-5 40725 0 0.00202429
1-32222333-G-A p.Pro35Pro synonymous BAI2 1 81552 1.22621E-5 40776 0 9.89883E-6
1-32222344-C-T p.Ala32Thr missense BAI2 1 81212 1.23135E-5 40606 0 4.45474E-5
1-32222345-G-A p.Thr31Thr synonymous BAI2 1 81226 1.23113E-5 40613 0 2.26429E-5
1-32222347-T-C p.Thr31Ala missense BAI2 83 81178 0.00102244 40589 1 0.00143513
1-32222355-C-T p.Arg28His missense BAI2 3 80896 3.70847E-5 40448 0 1.20322E-4
1-32222356-G-A p.Arg28Cys missense BAI2 1 80898 1.23612E-5 40449 0 6.19042E-5
1-32222359-G-A p.Leu27Leu synonymous BAI2 3 80868 3.70975E-5 40434 0 6.37267E-5
1-32222361-G-A p.Ser26Phe missense BAI2 1 80760 1.23824E-5 40380 0 NA
1-32222377-G-A p.Leu21Leu synonymous BAI2 2 80292 2.49091E-5 40146 0 NA
1-32222385-G-A p.Pro18Leu missense BAI2 1 79898 1.2516E-5 39949 0 3.18532E-5
1-32222397-G-T p.Thr14Asn missense BAI2 1 79308 1.26091E-5 39654 0 NA
1-32222420-T-C c.22-4A>G splice_region BAI2 2 78520 2.54712E-5 39260 0 3.18837E-5
1-32222810-C-T p.Gly5Ser missense BAI2 1 83104 1.20331E-5 41552 0 NA
1-32222812-G-A p.Thr4Ile missense BAI2 8 83102 9.62672E-5 41551 0 2.6494E-4
1-32222862-G-C c.-40C>G 5_prime_UTR_premature_start_codon_gain BAI2 1 82890 1.20642E-5 41445 0 NA
1-32222877-G-A c.-55C>T 5_prime_UTR_premature_start_codon_gain BAI2 1 82696 1.20925E-5 41348 0 6.25E-4
1-32222885-G-C c.-60-3C>G splice_region BAI2 1 82568 1.21112E-5 41284 0 NA
1-32222887-G-A c.-60-5C>T splice_region BAI2 3 82516 3.63566E-5 41258 0 NA
1-32222980-CACTT-C c.-62_-61+2delAAGT splice_donor BAI2 41 68626 5.97441E-4 34313 0 3.82141E-4
1-32222984-T-C c.-62A>G splice_region BAI2 1 67314 1.48558E-5 33657 0 NA
1-32223056-T-G c.-134A>C 5_prime_UTR_premature_start_codon_gain BAI2 1 31902 3.1346E-5 15951 0 NA
1-32223086-G-A c.-164C>T 5_prime_UTR_premature_start_codon_gain BAI2 1 22036 4.53803E-5 11018 0 3.18613E-5
1-32224921-CAT-C p.His10fs frameshift BAI2 4 52614 7.60254E-5 26307 0 2.07005E-5
1-32224946-C-T p.Leu2Leu synonymous BAI2 1 52612 1.90071E-5 26306 0 8.69082E-6
1-32229536-C-A c.-242G>T 5_prime_UTR_premature_start_codon_gain BAI2 13 29026 4.47874E-4 14513 0 NA
1-32229586-T-C c.-292A>G 5_prime_UTR_premature_start_codon_gain BAI2 1 29070 3.43997E-5 14535 0 3.45853E-5
1-32229590-T-C c.-296A>G 5_prime_UTR_premature_start_codon_gain BAI2 1 28988 3.4497E-5 14494 0 NA
1-32229629-C-A c.-335G>T 5_prime_UTR_premature_start_codon_gain BAI2 2 28046 7.13114E-5 14023 0 4.48138E-4
1-32229811-G-A c.-342C>T 5_prime_UTR_premature_start_codon_gain BAI2 1 4332 2.3084E-4 2166 0 4.26694E-5
1-32229817-C-A c.-348G>T 5_prime_UTR_premature_start_codon_gain BAI2 1 4330 2.30947E-4 2165 0 NA
1-32229913-C-A c.-444G>T 5_prime_UTR_premature_start_codon_gain BAI2 1 3338 2.99581E-4 1669 0 NA
1-32230280-C-T c.123+1G>A splice_donor BAI2 3790 71888 0.0527209 35944 187 0.0867117
1-32230284-C-T p.Gly40Gly synonymous BAI2 1 72382 1.38156E-5 36191 0 NA
1-32230286-C-A p.Gly40Trp missense BAI2 3 72668 4.12836E-5 36334 0 NA
1-32230289-G-A p.His39Tyr missense BAI2 1 72584 1.37771E-5 36292 0 NA
1-32230293-A-T p.Asn37Lys missense BAI2 1 72870 1.37231E-5 36435 0 NA
1-32230298-A-C p.Cys36Gly missense BAI2 1 73174 1.36661E-5 36587 0 NA
1-32230303-G-T p.Ala34Glu missense BAI2 1 73378 1.36281E-5 36689 0 1.76196E-5
1-32230319-G-T p.His29Asn missense BAI2 1 73498 1.36058E-5 36749 0 NA
1-32230327-C-T p.Trp26* stop_gained BAI2 1 73614 1.35844E-5 36807 0 1.30719E-4
1-32230331-C-A p.Asp25Tyr missense BAI2 2 73716 2.71312E-5 36858 0 NA
1-32230337-C-A p.Ala23Ser missense BAI2 2 73750 2.71186E-5 36875 0 1.70161E-5
1-32230351-T-C p.Tyr18Cys missense BAI2 1 73864 1.35384E-5 36932 0 NA
1-32230358-A-G p.Tyr16His missense BAI2 1 73666 1.35748E-5 36833 0 1.79314E-5
1-32230359-C-T p.Leu15Leu synonymous BAI2 2 73526 2.72013E-5 36763 0 NA
1-32230360-A-G p.Leu15Pro missense BAI2 1 73250 1.36519E-5 36625 0 NA
1-32230376-C-T p.Ala10Thr missense BAI2 5 73050 6.84463E-5 36525 0 1.63613E-4
1-32230402-A-C p.Met1? start_lost BAI2 1 72478 1.37973E-5 36239 0 2.64971E-4
1-32230403-T-C p.Met1? start_lost BAI2 2 72476 2.75953E-5 36238 0 1.36616E-5
1-32230424-C-G c.-21G>C 5_prime_UTR_premature_start_codon_gain BAI2 1 72026 1.38839E-5 36013 0 NA