Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
8-143545440-T-A c.-120T>A 5_prime_UTR_premature_start_codon_gain BAI1 2 20380 9.81354E-5 10190 0 NA
8-143545463-C-T c.-97C>T 5_prime_UTR_premature_start_codon_gain BAI1 2 26188 7.63709E-5 13094 0 9.60922E-5
8-143545484-C-T c.-76C>T 5_prime_UTR_premature_start_codon_gain BAI1 2 28632 6.98519E-5 14316 0 2.25211E-4
8-143545571-G-T p.Gln4His missense BAI1 1 32648 3.06297E-5 16324 0 NA
8-143545597-T-A p.Ile13Asn missense BAI1 1 35222 2.83913E-5 17611 0 NA
8-143545613-ACTG-A p.Leu24del conservative_inframe_deletion BAI1 39 35478 0.00109927 17739 0 0.175
8-143545613-A-G p.Leu18Leu synonymous BAI1 4 36380 1.09951E-4 18190 0 3.25288E-5
8-143545613-A-ACTG p.Leu24dup conservative_inframe_insertion BAI1 1 36380 2.74876E-5 18190 0 NA
8-143545626-C-T p.Leu23Leu synonymous BAI1 3 37606 7.97745E-5 18803 0 2.24359E-4
8-143545627-T-C p.Leu23Pro missense BAI1 1 37660 2.65534E-5 18830 0 NA
8-143545629-C-G p.Leu24Val missense BAI1 2 37694 5.30588E-5 18847 0 NA
8-143545642-C-T p.Ala28Val missense BAI1 4 38142 1.04871E-4 19071 0 0.002
8-143545644-C-T p.Arg29Trp missense BAI1 2 38208 5.23451E-5 19104 0 NA
8-143545648-C-T p.Ala30Val missense BAI1 1 38458 2.60024E-5 19229 0 0.0011655
8-143545653-G-A p.Ala32Thr missense BAI1 1 39334 2.54233E-5 19667 0 NA
8-143545655-C-T p.Ala32Ala synonymous BAI1 3 39640 7.56811E-5 19820 0 6.41684E-5
8-143545659-G-A p.Ala34Thr missense BAI1 1 40532 2.46719E-5 20266 0 3.20595E-5
8-143545660-C-A p.Ala34Glu missense BAI1 1 40576 2.46451E-5 20288 0 NA
8-143545664-C-T p.Asp35Asp synonymous BAI1 1 41046 2.43629E-5 20523 0 4.12848E-5
8-143545666-C-G p.Ala36Gly missense BAI1 2 41194 4.85508E-5 20597 0 NA
8-143545672-C-T p.Pro38Leu missense BAI1 1 42210 2.36911E-5 21105 0 3.20965E-5
8-143545673-C-T p.Pro38Pro synonymous BAI1 1 42314 2.36328E-5 21157 0 NA
8-143545679-C-T p.Pro40Pro synonymous BAI1 1 43580 2.29463E-5 21790 0 NA
8-143545690-C-A p.Ala44Asp missense BAI1 3 45238 6.63159E-5 22619 0 1.6002E-4
8-143545702-A-G p.Gln48Arg missense BAI1 1 47426 2.10855E-5 23713 0 3.19898E-5
8-143545739-G-A p.Val60Val synonymous BAI1 2 50766 3.93964E-5 25383 0 NA
8-143545744-C-A p.Pro62Gln missense BAI1 2 51074 3.91589E-5 25537 0 0.00158228
8-143545746-G-A p.Ala63Thr missense BAI1 3 51058 5.87567E-5 25529 0 0.00474684
8-143545747-C-T p.Ala63Val missense BAI1 1 51052 1.95879E-5 25526 0 NA
8-143545751-C-A p.Asn64Lys missense BAI1 6 51322 1.16909E-4 25661 0 2.49771E-5
8-143545751-C-T p.Asn64Asn synonymous BAI1 6 51322 1.16909E-4 25661 0 5.58659E-4
8-143545757-G-A p.Ser66Ser synonymous BAI1 3 50920 5.89159E-5 25460 0 9.58589E-5
8-143545769-G-A p.Trp70* stop_gained BAI1 1 52010 1.92271E-5 26005 0 NA
8-143545780-A-C p.Asn74Thr missense BAI1 1 52012 1.92263E-5 26006 0 NA
8-143545803-C-G p.Leu82Val missense BAI1 2 53746 3.72121E-5 26873 0 NA
8-143545805-C-T p.Leu82Leu synonymous BAI1 1 53850 1.85701E-5 26925 0 5.55846E-6
8-143545823-G-C p.Lys88Asn missense BAI1 3 55302 5.42476E-5 27651 0 NA
8-143545832-G-T p.Val91Val synonymous BAI1 13 57094 2.27695E-4 28547 0 0.00122962
8-143545841-C-T p.Ser94Ser synonymous BAI1 1 58382 1.71286E-5 29191 0 5.24334E-6
8-143545847-C-T p.Pro96Pro synonymous BAI1 1 59618 1.67735E-5 29809 0 0.0010101
8-143545847-C-A p.Pro96Pro synonymous BAI1 2 59618 3.35469E-5 29809 0 5.24929E-6
8-143545851-C-G p.Arg98Gly missense BAI1 1 60578 1.65076E-5 30289 0 6.39468E-5
8-143545853-C-T p.Arg98Arg synonymous BAI1 9 60908 1.47764E-4 30454 0 0.00202224
8-143545867-A-T p.Gln103Leu missense BAI1 1 63610 1.57208E-5 31805 0 NA
8-143545877-C-T p.Ser106Ser synonymous BAI1 1 65042 1.53747E-5 32521 0 1.07036E-4
8-143545880-C-T p.Phe107Phe synonymous BAI1 2 65296 3.06297E-5 32648 0 5.05561E-4
8-143545881-C-G p.Leu108Val missense BAI1 2 65396 3.05829E-5 32698 0 NA
8-143545890-A-G p.Thr111Ala missense BAI1 2 65796 3.0397E-5 32898 0 7.91828E-5
8-143545901-C-T p.Tyr114Tyr synonymous BAI1 1 66224 1.51003E-5 33112 0 4.36834E-5
8-143545922-C-T p.Asp121Asp synonymous BAI1 3 65312 4.59334E-5 32656 0 6.92233E-6
8-143545925-G-A p.Glu122Glu synonymous BAI1 1 65152 1.53487E-5 32576 0 1.38717E-5
8-143545928-G-T p.Val123Val synonymous BAI1 1 64556 1.54904E-5 32278 0 6.5445E-5
8-143545943-C-T p.Asp128Asp synonymous BAI1 14 63208 2.21491E-4 31604 1 6.08117E-4
8-143545948-C-T p.Ser130Phe missense BAI1 1 62622 1.59688E-5 31311 0 3.19795E-5
8-143545949-C-T p.Ser130Ser synonymous BAI1 2 62326 3.20893E-5 31163 0 8.3724E-5
8-143545949-C-A p.Ser130Ser synonymous BAI1 1 62326 1.60447E-5 31163 0 NA
8-143545950-G-A p.Ala131Thr missense BAI1 15 61644 2.43333E-4 30822 0 4.16506E-4
8-143545961-C-T p.Ala134Ala synonymous BAI1 3 60272 4.97744E-5 30136 0 0.00211864
8-143545965-C-T p.Leu136Leu synonymous BAI1 1 59516 1.68022E-5 29758 0 1.27984E-4
8-143545985-C-G p.Phe142Leu missense BAI1 1 55476 1.80258E-5 27738 0 NA
8-143545988-G-A p.Leu143Leu synonymous BAI1 1 54754 1.82635E-5 27377 0 NA
8-143545995-C-A p.Arg146Arg synonymous BAI1 2 53120 3.76506E-5 26560 0 5.16538E-5
8-143545999-G-A p.Arg147His missense BAI1 1 52030 1.92197E-5 26015 0 2.59592E-5
8-143546003-G-C p.Gln148His missense BAI1 2 51848 3.85743E-5 25924 0 NA
8-143546008-C-T p.Pro150Leu missense BAI1 1 51504 1.9416E-5 25752 0 8.6097E-6
8-143546018-C-T p.His153His synonymous BAI1 4 50754 7.88115E-5 25377 0 8.51861E-6
8-143546019-G-C p.Asp154His missense BAI1 3 50734 5.91319E-5 25367 0 8.55578E-6
8-143546021-C-G p.Asp154Glu missense BAI1 1 50446 1.98232E-5 25223 0 NA
8-143546023-G-C p.Gly155Ala missense BAI1 1 50390 1.98452E-5 25195 0 NA
8-143546027-C-G p.Leu156Leu synonymous BAI1 1 50162 1.99354E-5 25081 0 1.6895E-5
8-143546031-C-T p.Pro158Ser missense BAI1 1 49906 2.00377E-5 24953 0 NA
8-143546032-C-T p.Pro158Leu missense BAI1 1 50162 1.99354E-5 25081 0 NA
8-143546034-C-G p.Arg159Gly missense BAI1 2 50026 3.99792E-5 25013 0 NA
8-143546035-G-C p.Arg159Pro missense BAI1 176 50134 0.00351059 25067 2 0.00706941
8-143546035-G-A p.Arg159Gln missense BAI1 3 50142 5.98301E-5 25071 0 5.94884E-4
8-143546045-G-A p.Pro162Pro synonymous BAI1 1 49910 2.00361E-5 24955 0 4.90268E-5
8-143546049-G-A p.Gly164Ser missense BAI1 1 50182 1.99275E-5 25091 0 NA
8-143546089-G-A p.Gly177Glu missense BAI1 2 51136 3.91114E-5 25568 0 3.19734E-5
8-143546097-A-T p.Asn180Tyr missense BAI1 6 51256 1.17059E-4 25628 0 4.58947E-5
8-143546098-A-T p.Asn180Ile missense BAI1 1 51128 1.95588E-5 25564 0 NA
8-143546098-A-G p.Asn180Ser missense BAI1 1 51128 1.95588E-5 25564 0 3.20904E-5
8-143546154-G-A p.Gly199Ser missense BAI1 2 50016 3.99872E-5 25008 0 7.91766E-5
8-143546168-G-C p.Ser203Ser synonymous BAI1 3 49194 6.0983E-5 24597 0 6.39754E-5
8-143546198-C-T p.Cys213Cys synonymous BAI1 1 49218 2.03178E-5 24609 0 1.9173E-4
8-143546206-T-C p.Leu216Pro missense BAI1 6 50018 1.19957E-4 25009 0 0.00105708
8-143546210-C-T p.Gly217Gly synonymous BAI1 2 50210 3.98327E-5 25105 0 2.99812E-4
8-143546214-G-A p.Glu219Lys missense BAI1 4 50426 7.93242E-5 25213 0 5.16903E-5
8-143546215-A-G p.Glu219Gly missense BAI1 4 50276 7.95608E-5 25138 0 3.1998E-5
8-143546218-C-T p.Ala220Val missense BAI1 6 50186 1.19555E-4 25093 0 3.48815E-5
8-143546219-G-T p.Ala220Ala synonymous BAI1 2 50458 3.96369E-5 25229 1 NA
8-143546223-G-A p.Gly222Ser missense BAI1 1 50288 1.98855E-5 25144 0 NA
8-143546231-C-T p.Ala224Ala synonymous BAI1 1 51178 1.95396E-5 25589 0 1.25376E-4
8-143546233-C-T p.Ala225Val missense BAI1 3 51080 5.87314E-5 25540 0 NA
8-143546234-G-A p.Ala225Ala synonymous BAI1 1 51146 1.95519E-5 25573 0 8.67363E-6
8-143546241-C-T p.Leu228Leu synonymous BAI1 1 51714 1.93371E-5 25857 0 NA
8-143546244-G-C p.Ala229Pro missense BAI1 39 51658 7.54965E-4 25829 0 0.00391389
8-143546250-C-A p.Arg231Ser missense BAI1 1 52014 1.92256E-5 26007 0 NA
8-143546284-G-C p.Gly242Ala missense BAI1 3 52378 5.7276E-5 26189 0 3.19632E-5
8-143546315-C-G p.Thr252Thr synonymous BAI1 179 48402 0.00369819 24201 2 0.00987306
8-143546323-G-A p.Arg255Gln missense BAI1 1 47056 2.12513E-5 23528 0 1.59388E-4
8-143546330-G-C p.Gly257Gly synonymous BAI1 18 45466 3.959E-4 22733 0 3.5191E-4
8-143546332-A-C p.His258Pro missense BAI1 1 45054 2.21956E-5 22527 0 NA
8-143546333-C-T p.His258His synonymous BAI1 4 44770 8.93455E-5 22385 0 2.84565E-4
8-143546334-G-A p.Gly259Ser missense BAI1 2 44646 4.47968E-5 22323 0 1.00632E-5
8-143546336-C-T p.Gly259Gly synonymous BAI1 1 44068 2.26922E-5 22034 0 3.20492E-5
8-143546348-G-C c.784+5G>C splice_region BAI1 1 42618 2.34643E-5 21309 0 NA
8-143556831-C-G c.785-4C>G splice_region BAI1 2 63848 3.13244E-5 31924 0 NA
8-143556832-C-G c.785-3C>G splice_region BAI1 1 63768 1.56818E-5 31884 0 2.20916E-5
8-143556854-C-T p.Ser268Ser synonymous BAI1 1 61260 1.63239E-5 30630 0 3.18695E-5
8-143556872-G-C p.Thr274Thr synonymous BAI1 6 56704 1.05813E-4 28352 0 0.00152749
8-143556878-C-G p.Asp276Glu missense BAI1 37 54932 6.7356E-4 27466 0 5.35071E-4
8-143556905-G-A p.Thr285Thr synonymous BAI1 1 46678 2.14234E-5 23339 0 0.00153689
8-143556925-C-G p.Pro292Arg missense BAI1 3 43062 6.9667E-5 21531 0 6.4658E-5
8-143556926-G-A p.Pro292Pro synonymous BAI1 8 43272 1.84877E-4 21636 0 5.61924E-4
8-143556928-G-T p.Gly293Val missense BAI1 1 42946 2.32851E-5 21473 0 NA
8-143556929-C-T p.Gly293Gly synonymous BAI1 1 42512 2.35228E-5 21256 0 NA
8-143556935-G-C p.Glu295Asp missense BAI1 3 41966 7.14864E-5 20983 0 1.2996E-4
8-143556941-C-T p.Gly297Gly synonymous BAI1 1 40234 2.48546E-5 20117 0 NA
8-143556950-G-A p.Glu300Glu synonymous BAI1 3 38958 7.7006E-5 19479 0 NA
8-143556981-C-T p.Arg311Cys missense BAI1 1 34426 2.90478E-5 17213 0 3.19652E-5
8-143556982-G-C p.Arg311Pro missense BAI1 1 34308 2.91477E-5 17154 0 NA
8-143556983-C-T p.Arg311Arg synonymous BAI1 2 34074 5.86958E-5 17037 0 NA
8-143556989-C-T p.Ala313Ala synonymous BAI1 1 33702 2.96718E-5 16851 0 NA
8-143557947-C-T p.Pro316Pro splice_region+synonymous BAI1 1 72170 1.38562E-5 36085 0 3.39766E-5
8-143557948-G-A p.Ala317Thr missense+splice_region BAI1 26 72172 3.60251E-4 36086 0 0.00286807
8-143557955-G-A p.Arg319His missense BAI1 2 72148 2.77208E-5 36074 0 NA
8-143557978-C-G p.Leu327Val missense BAI1 1 72140 1.38619E-5 36070 0 1.35676E-5
8-143557987-A-G p.Thr330Ala missense BAI1 1 71694 1.39482E-5 35847 0 NA
8-143557996-C-T p.Arg333Trp missense BAI1 1 70870 1.41103E-5 35435 0 2.04566E-5
8-143557997-G-A p.Arg333Gln missense BAI1 1 70928 1.40988E-5 35464 0 NA
8-143558000-G-A p.Arg334Gln missense BAI1 11 70228 1.56633E-4 35114 0 4.9815E-4
8-143558003-G-A p.Arg335His missense BAI1 2 69848 2.86336E-5 34924 0 1.36558E-5
8-143558004-C-T p.Arg335Arg synonymous BAI1 2 69680 2.87026E-5 34840 0 6.82715E-6
8-143558005-G-A p.Glu336Lys missense BAI1 1 69794 1.43279E-5 34897 0 NA
8-143558006-A-T p.Glu336Val missense BAI1 1 69684 1.43505E-5 34842 0 3.18695E-5
8-143558010-G-T p.Glu337Asp missense BAI1 3 69382 4.32389E-5 34691 0 1.36685E-5
8-143558020-G-A p.Glu341Lys missense BAI1 1 68132 1.46774E-5 34066 0 6.84706E-6
8-143558046-C-T p.Ala349Ala synonymous BAI1 1 64472 1.55106E-5 32236 0 NA
8-143558048-C-A p.Pro350His missense BAI1 4 64234 6.22723E-5 32117 0 6.26566E-4
8-143558049-C-G p.Pro350Pro synonymous BAI1 1 64148 1.5589E-5 32074 0 NA
8-143558050-C-A p.Gln351Lys missense BAI1 2 64094 3.12042E-5 32047 0 NA
8-143558050-C-G p.Gln351Glu missense BAI1 1 64094 1.56021E-5 32047 0 NA
8-143558471-G-T c.1058-4G>T splice_region BAI1 1 63848 1.56622E-5 31924 0 NA
8-143558482-A-C p.Pro355Pro synonymous BAI1 1 64470 1.55111E-5 32235 0 NA
8-143558524-C-T p.Thr369Thr synonymous BAI1 2 64722 3.09014E-5 32361 0 4.47559E-6
8-143558527-C-T p.Cys370Cys synonymous BAI1 5 64180 7.79059E-5 32090 0 9.58099E-5
8-143558531-G-A p.Glu372Lys missense BAI1 1 64140 1.55909E-5 32070 0 NA
8-143558551-G-A p.Thr378Thr synonymous BAI1 1 63456 1.5759E-5 31728 0 NA
8-143558568-C-T p.Ser384Phe missense BAI1 2 64588 3.09655E-5 32294 0 9.46289E-6
8-143558590-C-A p.Ser391Arg missense BAI1 1 64748 1.54445E-5 32374 0 NA
8-143558602-C-T p.Arg395Arg synonymous BAI1 12 66328 1.80919E-4 33164 0 3.19877E-5
8-143558629-C-T p.Ala404Ala synonymous BAI1 10 70036 1.42784E-4 35018 0 1.5705E-4
8-143558632-G-A p.Val405Val synonymous BAI1 1 70460 1.41924E-5 35230 0 NA
8-143558760-G-A p.Asp413Asn missense BAI1 1 81446 1.22781E-5 40723 0 3.19898E-5
8-143558771-G-A p.Ser416Ser synonymous BAI1 21 81578 2.57422E-4 40789 0 9.62094E-5
8-143558780-C-T p.Ser419Ser synonymous BAI1 2 81848 2.44355E-5 40924 0 NA
8-143558807-C-A p.Gly428Gly synonymous BAI1 1 82036 1.21898E-5 41018 0 8.4185E-6
8-143558812-G-A p.Arg430Gln missense BAI1 1 82048 1.2188E-5 41024 0 NA
8-143558822-G-A p.Thr433Thr synonymous BAI1 1 82060 1.21862E-5 41030 0 8.86846E-5
8-143558828-C-G p.Thr435Thr synonymous BAI1 1 82128 1.21761E-5 41064 0 NA
8-143558831-C-T p.Cys436Cys synonymous BAI1 6 82138 7.30478E-5 41069 0 9.26889E-5
8-143558834-G-GC p.Gln440fs frameshift BAI1 1 82128 1.21761E-5 41064 0 0.00100705
8-143558836-C-A p.Pro438His missense BAI1 2 82126 2.43528E-5 41063 0 NA
8-143558840-C-T p.Pro439Pro synonymous BAI1 2 82142 2.43481E-5 41071 0 5.03525E-4
8-143558840-C-G p.Pro439Pro synonymous BAI1 2 82142 2.43481E-5 41071 0 3.18674E-5
8-143558849-G-C p.Gly442Gly synonymous BAI1 1 82148 1.21732E-5 41074 0 NA
8-143558854-A-G p.Asn444Ser missense BAI1 4 82158 4.86867E-5 41079 0 1.09154E-4
8-143558897-T-A p.Ile458Ile synonymous BAI1 13 82106 1.58332E-4 41053 0 5.62443E-4
8-143559543-C-G c.1388-5C>G splice_region BAI1 1 80956 1.23524E-5 40478 0 NA
8-143559545-C-T c.1388-3C>T splice_region BAI1 8 80990 9.87776E-5 40495 0 1.18647E-4
8-143559546-G-A c.1388-2G>A splice_acceptor BAI1 1 81020 1.23426E-5 40510 0 3.861E-5
8-143559546-G-T c.1388-2G>T splice_acceptor BAI1 2 81020 2.46853E-5 40510 0 4.41653E-6
8-143559550-C-T p.Arg464Trp missense+splice_region BAI1 1 81050 1.23381E-5 40525 0 3.64458E-5
8-143559558-G-A p.Val466Val synonymous BAI1 6 81198 7.38934E-5 40599 0 1.62143E-5
8-143559561-T-C p.Asp467Asp synonymous BAI1 2638 81158 0.0325045 40579 49 0.0422061
8-143559567-C-T p.Asn469Asn synonymous BAI1 1 81226 1.23113E-5 40613 0 3.19326E-5
8-143559582-G-A p.Ser474Ser synonymous BAI1 4 81218 4.92502E-5 40609 0 6.38407E-5
8-143559592-G-A p.Ala478Thr missense BAI1 4 81152 4.92902E-5 40576 0 2.69092E-5
8-143559600-C-T p.Ser480Ser synonymous BAI1 119 81212 0.0014653 40606 2 0.0026173
8-143559601-G-A p.Ala481Thr missense BAI1 3 81204 3.6944E-5 40602 0 5.14655E-5
8-143559609-C-T p.Cys483Cys synonymous BAI1 2 81236 2.46196E-5 40618 0 3.19101E-5
8-143559619-C-G p.Arg487Gly missense BAI1 1 81200 1.23153E-5 40600 0 2.40581E-5
8-143559620-G-A p.Arg487Gln missense BAI1 4 81198 4.92623E-5 40599 0 4.17446E-5
8-143559626-A-G p.Gln489Arg missense BAI1 1 81204 1.23147E-5 40602 0 1.16648E-5
8-143559629-G-A p.Arg490His missense BAI1 1 81154 1.23223E-5 40577 0 NA
8-143559632-C-T p.Thr491Met missense BAI1 2 81172 2.4639E-5 40586 0 NA
8-143559639-A-G p.Glu493Glu synonymous BAI1 1 81122 1.23271E-5 40561 0 NA
8-143559645-C-T p.Asn495Asn synonymous BAI1 2 81046 2.46773E-5 40523 0 5.04541E-4
8-143559660-G-C p.Gly500Gly synonymous BAI1 4 80700 4.95663E-5 40350 0 4.15131E-6
8-143559666-G-A p.Ala502Ala synonymous BAI1 5 80532 6.20871E-5 40266 0 9.57916E-5
8-143559693-C-T p.Thr511Thr synonymous BAI1 1 79854 1.25229E-5 39927 0 4.22383E-6
8-143559695-G-A p.Arg512Gln missense BAI1 3 79802 3.7593E-5 39901 0 9.65927E-5
8-143559698-A-T p.Asp513Val missense BAI1 1 79750 1.25392E-5 39875 0 4.23962E-6
8-143559717-C-T p.Cys519Cys synonymous BAI1 17 78940 2.15353E-4 39470 0 0.00109665
8-143559727-G-A c.1561+6G>A splice_region BAI1 1 78460 1.27453E-5 39230 0 4.60202E-6
8-143559729-G-A c.1561+8G>A splice_region BAI1 1 78274 1.27756E-5 39137 0 NA
8-143560675-G-GC c.1562-5dupC splice_region BAI1 1 64508 1.5502E-5 32254 0 NA
8-143560679-C-T c.1562-5C>T splice_region BAI1 7 66270 1.05628E-4 33135 0 1.20893E-4
8-143560694-G-A p.Lys524Lys synonymous BAI1 1 69802 1.43262E-5 34901 0 1.17869E-5
8-143560707-G-A p.Ala529Thr missense BAI1 2 71692 2.78971E-5 35846 0 5.55556E-5
8-143560709-G-A p.Ala529Ala synonymous BAI1 2 71940 2.78009E-5 35970 0 5.06073E-4
8-143560728-G-A p.Val536Ile missense BAI1 3 75182 3.99032E-5 37591 0 6.25E-4
8-143560732-C-T p.Thr537Met missense BAI1 1 75870 1.31804E-5 37935 0 NA
8-143560733-G-A p.Thr537Thr synonymous BAI1 12 76080 1.57729E-4 38040 0 1.59591E-4
8-143560742-T-A p.Ala540Ala synonymous BAI1 1 77078 1.29739E-5 38539 0 NA
8-143560765-T-C p.Val548Ala missense BAI1 3 79500 3.77358E-5 39750 0 4.14929E-5
8-143560775-G-A p.Gly551Gly synonymous BAI1 1 80092 1.24856E-5 40046 0 NA
8-143560784-C-T p.Phe554Phe synonymous BAI1 3 80308 3.73562E-5 40154 0 3.19122E-5
8-143560812-G-C p.Asp564His missense BAI1 1 80898 1.23612E-5 40449 0 NA
8-143560822-G-A p.Arg567Gln missense BAI1 4 80866 4.94645E-5 40433 0 0.00101112
8-143560823-G-A p.Arg567Arg synonymous BAI1 1 80878 1.23643E-5 40439 0 6.25782E-4
8-143560830-G-A p.Gly570Ser missense BAI1 3 80818 3.71204E-5 40409 0 7.19295E-5
8-143560834-C-T p.Thr571Ile missense BAI1 5 80832 6.18567E-5 40416 0 2.25956E-5
8-143560839-C-T p.Arg573Trp missense BAI1 3 80742 3.71554E-5 40371 0 3.19224E-5
8-143560840-G-A p.Arg573Gln missense BAI1 2 80730 2.47739E-5 40365 0 3.19101E-5
8-143560847-C-T p.Pro575Pro splice_region+synonymous BAI1 313 80688 0.00387914 40344 2 0.00523732
8-143560847-C-G p.Pro575Pro splice_region+synonymous BAI1 3 80692 3.71784E-5 40346 0 1.27273E-5
8-143560848-G-A p.Glu576Lys missense+splice_region BAI1 1 80682 1.23943E-5 40341 0 0.00203046
8-143561049-G-T c.1727-5G>T splice_region BAI1 1 82234 1.21604E-5 41117 0 NA
8-143561050-G-A c.1727-4G>A splice_region BAI1 1 82236 1.21601E-5 41118 0 NA
8-143561061-T-C p.His578His synonymous BAI1 2 82258 2.43137E-5 41129 0 2.09289E-4
8-143561074-G-A p.Glu583Lys missense BAI1 1 82340 1.21448E-5 41170 0 4.02143E-6
8-143561090-C-T p.Ala588Val missense BAI1 1 82354 1.21427E-5 41177 0 8.32612E-6
8-143561090-C-A p.Ala588Asp missense BAI1 2 82354 2.42854E-5 41177 1 NA
8-143561114-C-G p.Ala596Gly missense BAI1 2 82314 2.42972E-5 41157 0 1.20559E-5
8-143561114-C-T p.Ala596Val missense BAI1 2 82314 2.42972E-5 41157 0 2.49792E-5
8-143561135-G-A p.Arg603Gln missense BAI1 9 82184 1.0951E-4 41092 0 6.44086E-5
8-143561143-C-T p.Arg606Cys missense BAI1 1 82108 1.21791E-5 41054 0 NA
8-143561143-C-A p.Arg606Ser missense BAI1 1 82108 1.21791E-5 41054 0 4.03223E-6
8-143561144-G-A p.Arg606His missense BAI1 8 82070 9.74778E-5 41035 0 5.04541E-4
8-143561148-C-T p.Asn607Asn synonymous BAI1 5 82044 6.09429E-5 41022 0 3.36061E-5
8-143561149-G-A p.Ala608Thr missense BAI1 1 82014 1.2193E-5 41007 0 8.40576E-6
8-143561161-G-A c.1828+6G>A splice_region BAI1 2 81854 2.44337E-5 40927 0 1.21696E-5
8-143561162-G-A c.1828+7G>A splice_region BAI1 1 81812 1.22231E-5 40906 0 4.05656E-6
8-143562609-C-T c.1829-6C>T splice_region BAI1 1 81992 1.21963E-5 40996 0 NA
8-143562611-C-T c.1829-4C>T splice_region BAI1 16 82022 1.9507E-4 41011 0 5.41505E-4
8-143562626-C-A p.Arg614Arg synonymous BAI1 1 82224 1.21619E-5 41112 0 NA
8-143562630-G-A p.Arg615Gln missense BAI1 1 82260 1.21566E-5 41130 0 8.30013E-6
8-143562631-G-C p.Arg615Arg synonymous BAI1 1 82280 1.21536E-5 41140 0 3.61133E-5
8-143562644-G-A p.Glu620Lys missense BAI1 8 82306 9.71983E-5 41153 1 6.37552E-5
8-143562655-C-T p.Ile623Ile synonymous BAI1 1 82326 1.21468E-5 41163 0 3.31796E-5
8-143562668-C-T p.Pro628Ser missense BAI1 10 82334 1.21457E-4 41167 0 8.02459E-5
8-143562669-C-T p.Pro628Leu missense BAI1 2 82330 2.42925E-5 41165 0 NA
8-143562671-C-T p.Pro629Ser missense BAI1 19 82344 2.30739E-4 41172 0 1.88554E-4
8-143562673-C-T p.Pro629Pro synonymous BAI1 1 82338 1.21451E-5 41169 0 1.20357E-5
8-143562696-T-C p.Ile637Thr missense BAI1 1 82324 1.21471E-5 41162 0 8.29779E-6
8-143562712-C-T p.Ile642Ile synonymous BAI1 1 82266 1.21557E-5 41133 0 3.18593E-5
8-143562871-TC-T c.1936-6delC splice_region BAI1 2 81156 2.46439E-5 40578 0 1.00509E-5
8-143562874-G-A c.1936-4G>A splice_region BAI1 19 81168 2.34082E-4 40584 0 1.96417E-4
8-143562874-G-T c.1936-4G>T splice_region BAI1 2 81168 2.46403E-5 40584 0 3.19061E-5
8-143562880-C-T p.Thr646Thr splice_region+synonymous BAI1 2 81306 2.45984E-5 40653 0 1.93162E-5
8-143562886-G-A p.Glu648Glu synonymous BAI1 12 81378 1.4746E-4 40689 0 2.87045E-4
8-143562892-G-A p.Leu650Leu synonymous BAI1 1 81484 1.22723E-5 40742 0 NA
8-143562901-T-C p.Ala653Ala synonymous BAI1 8 81590 9.80512E-5 40795 0 8.95031E-5
8-143562926-G-T p.Val662Phe missense BAI1 1 81754 1.22318E-5 40877 0 NA
8-143562930-C-T p.Ser663Leu missense BAI1 1 81792 1.22261E-5 40896 0 NA
8-143562931-G-A p.Ser663Ser synonymous BAI1 1 81794 1.22258E-5 40897 0 6.3804E-5
8-143562950-G-C p.Val670Leu missense BAI1 1 81976 1.21987E-5 40988 0 3.18857E-5
8-143562956-A-G p.Ile672Val missense BAI1 1 81984 1.21975E-5 40992 0 4.34314E-6
8-143562956-A-T p.Ile672Phe missense BAI1 1 81984 1.21975E-5 40992 0 NA
8-143562967-C-T p.Asp675Asp synonymous BAI1 6 82060 7.31172E-5 41030 0 1.27527E-4
8-143562968-G-A p.Gly676Arg missense BAI1 1 82060 1.21862E-5 41030 0 6.37796E-5
8-143562994-G-A p.Leu684Leu synonymous BAI1 1 82158 1.21717E-5 41079 0 4.20805E-6
8-143563003-C-T p.Ile687Ile synonymous BAI1 1 82182 1.21681E-5 41091 0 1.6263E-4
8-143563004-G-A p.Asp688Asn missense BAI1 1 82180 1.21684E-5 41090 0 4.99039E-5
8-143563034-C-T p.Arg698Trp missense BAI1 1 82110 1.21788E-5 41055 0 1.21619E-5
8-143563035-G-A p.Arg698Gln missense BAI1 1 82106 1.21794E-5 41053 0 2.43445E-5
8-143563041-C-T p.Ala700Val missense BAI1 1 82026 1.21913E-5 41013 0 1.28352E-5
8-143563066-C-T p.Asp708Asp synonymous BAI1 2 81702 2.44792E-5 40851 0 3.94249E-5
8-143563067-G-A p.Val709Ile missense BAI1 5 81652 6.12355E-5 40826 0 6.63288E-5
8-143563078-C-T c.2130+6C>T splice_region BAI1 4 81340 4.91763E-5 40670 0 1.63322E-5
8-143565368-G-T p.Ala721Ser missense BAI1 7 82232 8.5125E-5 41116 0 3.1839E-5
8-143565373-G-A p.Glu722Glu synonymous BAI1 1 82218 1.21628E-5 41109 0 3.18329E-5
8-143565382-G-C p.Arg725Arg synonymous BAI1 5 82174 6.08465E-5 41087 0 0.001875
8-143565382-G-A p.Arg725Arg synonymous BAI1 2 82174 2.43386E-5 41087 0 5.03525E-4
8-143565403-G-C p.Gln732His missense BAI1 1 81880 1.2213E-5 40940 0 4.04793E-6
8-143565410-G-C c.2199+4G>C splice_region BAI1 1 81736 1.22345E-5 40868 0 NA
8-143566012-T-G c.2200-5T>G splice_region BAI1 2 78630 2.54356E-5 39315 0 3.18654E-5
8-143566018-C-T p.Ala734Val missense+splice_region BAI1 10 78652 1.27142E-4 39326 0 0.00311526
8-143566019-G-A p.Ala734Ala splice_region+synonymous BAI1 1 78656 1.27136E-5 39328 0 6.25E-4
8-143566028-C-T p.Asn737Asn synonymous BAI1 11 78690 1.39789E-4 39345 0 6.37064E-5
8-143566028-C-A p.Asn737Lys missense BAI1 1 78692 1.27078E-5 39346 0 4.19259E-6
8-143566029-G-A p.Ala738Thr missense BAI1 1 78664 1.27123E-5 39332 0 6.9904E-5
8-143566040-G-C p.Leu741Leu synonymous BAI1 1 78778 1.26939E-5 39389 0 4.15062E-6
8-143566044-C-T p.Arg743Trp missense BAI1 4 78784 5.07717E-5 39392 0 3.18552E-5
8-143566045-G-A p.Arg743Gln missense BAI1 1 78788 1.26923E-5 39394 0 6.37267E-5
8-143566052-G-C p.Val745Val synonymous BAI1 1 78794 1.26913E-5 39397 0 NA
8-143566071-A-G p.Ile752Val missense BAI1 11 78772 1.39644E-4 39386 0 2.54956E-4
8-143566073-C-T p.Ile752Ile synonymous BAI1 2 78742 2.53994E-5 39371 0 0.00207254
8-143566074-G-A p.Gly753Ser missense BAI1 1 78738 1.27003E-5 39369 0 3.20554E-5
8-143566083-A-C p.Met756Leu missense BAI1 13 78676 1.65235E-4 39338 0 2.86789E-4
8-143566092-C-T p.Leu759Leu synonymous BAI1 1 78632 1.27175E-5 39316 0 NA
8-143566098-G-A p.Asp761Asn missense BAI1 2 78616 2.54401E-5 39308 0 NA
8-143566106-C-T p.Tyr763Tyr synonymous BAI1 1 78478 1.27424E-5 39239 0 NA
8-143566131-C-G c.2308+6C>G splice_region BAI1 56 78086 7.17158E-4 39043 0 8.43789E-4
8-143566131-C-T c.2308+6C>T splice_region BAI1 1 78088 1.28061E-5 39044 0 9.64692E-5
8-143569718-C-T c.2309-7C>T splice_region BAI1 1 82286 1.21527E-5 41143 0 3.34465E-5
8-143569721-C-T c.2309-4C>T splice_region BAI1 1 82294 1.21516E-5 41147 0 4.0244E-6
8-143569731-G-A p.Ser772Asn missense BAI1 1 82268 1.21554E-5 41134 0 NA
8-143569744-C-T p.Leu776Leu synonymous BAI1 3 82338 3.64352E-5 41169 0 4.82614E-5
8-143569753-C-T p.Ser779Ser synonymous BAI1 3 82306 3.64493E-5 41153 0 6.36983E-5
8-143569759-C-T p.Ala781Ala synonymous BAI1 63 82420 7.64378E-4 41210 0 8.67216E-4
8-143569776-C-T p.Pro787Leu missense BAI1 2 82378 2.42783E-5 41189 0 NA
8-143569789-G-A p.Trp791* stop_gained BAI1 1 82342 1.21445E-5 41171 0 NA
8-143569790-C-T p.Arg792Trp missense BAI1 2 82334 2.42913E-5 41167 0 NA
8-143569797-C-T p.Thr794Met missense BAI1 1 82330 1.21462E-5 41165 0 8.04544E-6
8-143569798-G-A p.Thr794Thr synonymous BAI1 3 82314 3.64458E-5 41157 0 8.35059E-6
8-143569804-C-T p.Asp796Asp synonymous BAI1 1 82324 1.21471E-5 41162 0 1.67048E-5
8-143569833-C-T p.Thr806Ile missense BAI1 1 82280 1.21536E-5 41140 0 3.18593E-5
8-143569857-C-T p.Thr814Met missense BAI1 2 82166 2.4341E-5 41083 0 2.42299E-5
8-143569858-G-A p.Thr814Thr synonymous BAI1 1 82170 1.21699E-5 41085 0 6.37064E-5
8-143569861-G-T p.Gly815Gly synonymous BAI1 1 82140 1.21743E-5 41070 0 NA
8-143569871-G-A c.2452+3G>A splice_region BAI1 10 82046 1.21883E-4 41023 0 2.23029E-4
8-143569873-G-A c.2452+5G>A splice_region BAI1 1 82032 1.21904E-5 41016 0 4.04826E-6
8-143570398-G-A p.Ala819Thr missense+splice_region BAI1 1 82032 1.21904E-5 41016 0 NA
8-143570400-C-T p.Ala819Ala synonymous BAI1 2 82038 2.43789E-5 41019 0 6.92247E-5
8-143570401-G-A p.Asp820Asn missense BAI1 3 82066 3.65559E-5 41033 0 9.8742E-5
8-143570403-T-C p.Asp820Asp synonymous BAI1 4 82064 4.87424E-5 41032 0 3.18796E-5
8-143570454-C-G p.Ser837Arg missense BAI1 1 81984 1.21975E-5 40992 0 NA
8-143570464-C-G p.Leu841Val missense BAI1 4 81896 4.88424E-5 40948 0 3.18735E-5
8-143570466-G-A p.Leu841Leu synonymous BAI1 1 81868 1.22148E-5 40934 0 4.25362E-6
8-143570702-C-T p.Thr845Met missense BAI1 5 82192 6.08332E-5 41096 0 6.25E-4
8-143570703-G-A p.Thr845Thr synonymous BAI1 186 82170 0.0022636 41085 3 0.00370252
8-143570707-G-A p.Val847Ile missense BAI1 3 82208 3.64928E-5 41104 0 6.69198E-5
8-143570722-G-C p.Val852Leu missense BAI1 1 82244 1.21589E-5 41122 0 4.02104E-6
8-143570727-C-T p.Ile853Ile synonymous BAI1 1 82252 1.21578E-5 41126 0 NA
8-143570730-C-T p.Ser854Ser synonymous BAI1 1 82230 1.2161E-5 41115 0 1.67029E-5
8-143570747-C-T p.Pro860Leu missense BAI1 1 82274 1.21545E-5 41137 0 3.18898E-5
8-143570748-G-A p.Pro860Pro synonymous BAI1 3 82260 3.64697E-5 41130 0 1.27608E-4
8-143570753-G-T p.Arg862Leu missense BAI1 1 82250 1.21581E-5 41125 0 1.66964E-5
8-143570762-G-A p.Arg865His missense BAI1 1 82216 1.21631E-5 41108 0 3.33996E-5
8-143570766-A-G p.Thr866Thr synonymous BAI1 6 82228 7.29678E-5 41114 0 9.58344E-5
8-143570781-G-A p.Glu871Glu synonymous BAI1 1 82132 1.21755E-5 41066 0 3.18817E-5
8-143570790-C-T p.His874His synonymous BAI1 1 82090 1.21818E-5 41045 0 NA
8-143570791-A-G p.Met875Val missense BAI1 1 82078 1.21835E-5 41039 0 NA
8-143570799-T-C p.Asn877Asn splice_region+synonymous BAI1 1 82010 1.21936E-5 41005 0 9.56694E-5
8-143570800-G-GGCACCACCAACCAGACC c.2631+1_2631+2insGCACCACCAACCAGACC splice_donor BAI1 1 81986 1.21972E-5 40993 0 NA
8-143572125-T-G c.2632-8T>G splice_region BAI1 1 81744 1.22333E-5 40872 0 NA
8-143572156-C-T p.Ile885Ile synonymous BAI1 1 81956 1.22017E-5 40978 0 NA
8-143572170-C-T p.Thr890Met missense BAI1 1 81908 1.22088E-5 40954 0 2.91206E-5
8-143572171-G-A p.Thr890Thr synonymous BAI1 1 81914 1.22079E-5 40957 0 9.56755E-5
8-143572182-T-C c.2675+6T>C splice_region BAI1 2 81828 2.44415E-5 40914 0 NA
8-143592285-G-C c.2676-8G>C splice_region BAI1 26 26634 9.76196E-4 13317 0 0.00544366
8-143592288-C-T c.2676-5C>T splice_region BAI1 1 30766 3.25034E-5 15383 0 NA
8-143592290-CAGA-C p.Ser894fs frameshift BAI1 4 31056 1.288E-4 15528 0 1.95603E-4
8-143592291-A-C c.2676-2A>C splice_acceptor BAI1 8 29920 2.6738E-4 14960 0 0.00120909
8-143592291-AG-A c.2676-1delG splice_acceptor BAI1 1 29968 3.33689E-5 14984 0 1.72726E-4
8-143592292-G-C c.2676-1G>C splice_acceptor BAI1 7 30618 2.28624E-4 15309 0 3.92839E-4
8-143592293-A-ACCCCCC p.Pro893_Ser894insProPro conservative_inframe_insertion BAI1 1 30284 3.30207E-5 15142 0 NA
8-143592293-A-ACCCCCCCC p.Ser894fs frameshift BAI1 1 30282 3.30229E-5 15141 0 NA
8-143592296-C-T p.Pro893Pro synonymous BAI1 1 32418 3.08471E-5 16209 0 NA
8-143592296-CT-C p.Ser894fs frameshift BAI1 1 32416 3.0849E-5 16208 0 4.61681E-5
8-143592297-T-C p.Ser894Pro missense BAI1 4 31982 1.2507E-4 15991 0 5.13084E-4
8-143592297-T-A p.Ser894Thr missense BAI1 1 32004 3.12461E-5 16002 0 NA
8-143592300-T-C p.Ser895Pro missense BAI1 3 32492 9.23304E-5 16246 0 2.25493E-4
8-143592301-C-T p.Ser895Phe missense BAI1 24 33112 7.24813E-4 16556 0 0.00617284
8-143592303-T-C p.Ser896Pro missense BAI1 2 32906 6.07792E-5 16453 0 1.47743E-4
8-143592306-G-C p.Ala897Pro missense BAI1 1 33022 3.02828E-5 16511 0 1.80318E-4
8-143592309-C-T p.Pro898Ser missense BAI1 18 33902 5.30942E-4 16951 0 3.92355E-4
8-143592312-C-G p.Pro899Ala missense BAI1 1 34218 2.92244E-5 17109 0 NA
8-143592320-C-T p.Leu901Leu synonymous BAI1 1 35314 2.83174E-5 17657 0 NA
8-143592325-C-A p.Pro903His missense BAI1 1 35834 2.79065E-5 17917 0 3.75573E-4
8-143592349-C-T p.Thr911Met missense BAI1 1 36572 2.73433E-5 18286 0 NA
8-143592355-C-G p.Pro913Arg missense BAI1 1 36790 2.71813E-5 18395 0 4.52419E-4
8-143592365-C-T p.Ala916Ala synonymous BAI1 1 36984 2.70387E-5 18492 0 2.58819E-5
8-143592367-T-A p.Leu917His missense BAI1 1 36818 2.71606E-5 18409 0 4.85909E-4
8-143592377-C-A p.Arg920Arg synonymous BAI1 1 37134 2.69295E-5 18567 0 NA
8-143592398-C-T p.Ser927Ser synonymous BAI1 1 37046 2.69935E-5 18523 0 NA
8-143592426-G-A p.Ala937Thr missense BAI1 1 33756 2.96244E-5 16878 0 NA
8-143599510-G-A p.Lys943Lys synonymous BAI1 1 81850 1.22175E-5 40925 0 1.20308E-5
8-143599512-C-T p.Ala944Val missense BAI1 21 81850 2.56567E-4 40925 0 2.87045E-4
8-143599512-C-A p.Ala944Glu missense BAI1 1 81850 1.22175E-5 40925 0 3.18939E-5
8-143599522-G-A p.Pro947Pro synonymous BAI1 2 81998 2.43908E-5 40999 0 1.27575E-4
8-143599523-T-A p.Ser948Thr missense BAI1 1 82022 1.21919E-5 41011 0 NA
8-143599531-G-A p.Thr950Thr synonymous BAI1 2 82048 2.4376E-5 41024 0 3.81192E-4
8-143599534-C-A p.Leu951Leu synonymous BAI1 1 82096 1.21809E-5 41048 0 NA
8-143599535-A-G p.Ile952Val missense BAI1 1 82096 1.21809E-5 41048 0 NA
8-143599537-C-T p.Ile952Ile synonymous BAI1 2 82118 2.43552E-5 41059 0 8.28624E-6
8-143599538-G-C p.Val953Leu missense BAI1 1 82126 1.21764E-5 41063 0 NA
8-143599549-C-T p.Gly956Gly synonymous BAI1 2 82124 2.43534E-5 41062 0 3.18857E-5
8-143599550-G-T p.Val957Leu missense BAI1 1 82124 1.21767E-5 41062 0 2.48579E-5
8-143599550-G-A p.Val957Met missense BAI1 6 82126 7.30585E-5 41063 0 4.00558E-6
8-143599551-T-C p.Val957Ala missense BAI1 1 82118 1.21776E-5 41059 0 4.00545E-6
8-143599554-C-G p.Ser958Cys missense BAI1 1 82146 1.21734E-5 41073 0 NA
8-143599558-T-C p.Ser959Ser synonymous BAI1 1 82148 1.21732E-5 41074 0 NA
8-143599570-C-T p.Leu963Leu synonymous BAI1 59 82170 7.18024E-4 41085 0 5.97242E-4
8-143599579-C-T p.Val966Val synonymous BAI1 1 82160 1.21714E-5 41080 0 4.00847E-6
8-143599588-C-T p.Tyr969Tyr synonymous BAI1 6 82148 7.30389E-5 41074 0 6.25E-4
8-143599594-C-T p.Ser971Ser synonymous BAI1 1200 82054 0.0146245 41027 32 0.0278681
8-143599595-G-A p.Val972Met missense BAI1 2 82068 2.437E-5 41034 0 9.56633E-5
8-143599595-G-C p.Val972Leu missense BAI1 1 82068 1.2185E-5 41034 0 1.40941E-4
8-143602208-C-T p.Val982Val synonymous BAI1 1 82362 1.21415E-5 41181 0 2.00636E-5
8-143602240-C-T p.Ser993Phe missense BAI1 1 82346 1.21439E-5 41173 0 NA
8-143602262-C-T p.Ile1000Ile synonymous BAI1 13 82196 1.58159E-4 41098 0 1.24552E-4
8-143602271-C-G p.Thr1003Thr synonymous BAI1 5 82114 6.0891E-5 41057 0 3.19E-5
8-143602279-G-A p.Arg1006His missense BAI1 2 82016 2.43855E-5 41008 0 1.16619E-4
8-143602280-C-A p.Arg1006Arg synonymous BAI1 3 82020 3.65764E-5 41010 0 4.02029E-6
8-143602290-G-C c.3024+4G>C splice_region BAI1 2 81900 2.442E-5 40950 0 1.67129E-5
8-143603318-C-T c.3025-8C>T splice_region BAI1 52287 76972 0.679299 38486 18651 0.747926
8-143603346-C-T p.Ala1015Ala synonymous BAI1 1 81074 1.23344E-5 40537 0 3.19203E-5
8-143603361-C-T p.Phe1020Phe synonymous BAI1 1 81362 1.22908E-5 40681 0 2.50998E-5
8-143603374-T-C p.Ser1025Pro missense BAI1 1 81468 1.22748E-5 40734 0 NA
8-143603379-C-T p.Phe1026Phe synonymous BAI1 51 81498 6.25782E-4 40749 0 0.00178708
8-143603391-C-T p.Leu1030Leu synonymous BAI1 1 81526 1.2266E-5 40763 0 6.3857E-5
8-143603394-C-T p.Thr1031Thr synonymous BAI1 3 81536 3.67936E-5 40768 0 3.24125E-5
8-143603394-C-G p.Thr1031Thr synonymous BAI1 1 81536 1.22645E-5 40768 0 NA
8-143603406-G-A p.Gln1035Gln synonymous BAI1 1 81618 1.22522E-5 40809 0 NA
8-143603418-G-C p.Ala1039Ala synonymous BAI1 77023 81152 0.94912 40576 36713 0.962453
8-143603423-C-T p.Thr1041Met missense BAI1 11 81560 1.3487E-4 40780 0 0.00159612
8-143603424-G-A p.Thr1041Thr synonymous BAI1 5 81598 6.1276E-5 40799 0 5.05561E-4
8-143603435-G-A p.Arg1045Gln missense BAI1 1 81560 1.22609E-5 40780 0 3.19122E-5
8-143603437-A-G p.Asn1046Asp missense BAI1 1 81590 1.22564E-5 40795 0 NA
8-143603439-C-T p.Asn1046Asn synonymous BAI1 3 81658 3.67386E-5 40829 0 NA
8-143603440-C-T p.Arg1047Cys missense BAI1 1 81670 1.22444E-5 40835 0 3.19183E-5
8-143603441-G-A p.Arg1047His missense BAI1 1 81644 1.22483E-5 40822 0 1.21689E-5
8-143603483-C-T c.3175+7C>T splice_region BAI1 1 81460 1.2276E-5 40730 0 3.19428E-5
8-143603483-C-G c.3175+7C>G splice_region BAI1 1 81460 1.2276E-5 40730 0 NA
8-143603484-G-T c.3175+8G>T splice_region BAI1 10 81440 1.2279E-4 40720 0 2.47082E-4
8-143604012-A-G p.Ala1062Ala synonymous BAI1 1 81198 1.23156E-5 40599 0 5.60281E-6
8-143604025-A-G p.Ile1067Val missense BAI1 1 81222 1.23119E-5 40611 0 NA
8-143604065-T-C p.Met1080Thr missense BAI1 1 81024 1.2342E-5 40512 0 NA
8-143604078-C-T c.3245+7C>T splice_region BAI1 3 80822 3.71186E-5 40411 0 7.84929E-5
8-143604079-G-A c.3245+8G>A splice_region BAI1 3 80786 3.71351E-5 40393 0 6.25E-4
8-143605593-C-T c.3246-6C>T splice_region BAI1 1 81124 1.23268E-5 40562 0 3.19061E-5
8-143605608-C-T p.Leu1085Leu synonymous BAI1 1 81142 1.23241E-5 40571 0 NA
8-143605618-G-C p.Gly1089Arg missense BAI1 1 81162 1.2321E-5 40581 0 1.08134E-5
8-143605619-G-A p.Gly1089Glu missense BAI1 1 81152 1.23226E-5 40576 0 4.26712E-6
8-143605622-G-T p.Gly1090Val missense BAI1 1 81126 1.23265E-5 40563 0 4.27504E-6
8-143605629-C-G p.Leu1092Leu synonymous BAI1 2 81114 2.46567E-5 40557 0 1.28653E-5
8-143605650-C-T p.Ala1099Ala synonymous BAI1 1685 81128 0.0207696 40564 26 0.0271429
8-143605656-C-T p.Ala1101Ala synonymous BAI1 20 81136 2.465E-4 40568 0 3.19183E-4
8-143605657-G-A p.Val1102Ile missense BAI1 4 81118 4.93109E-5 40559 0 4.70444E-5
8-143605662-G-A p.Val1103Val synonymous BAI1 2 81064 2.46719E-5 40532 0 1.21631E-5
8-143607897-CGG-TGC c.3313-6_3313-4delCGGinsTGC splice_region BAI1 19 76670 2.47815E-4 38335 0 NA
8-143607897-C-T c.3313-6C>T splice_region BAI1 5 76670 6.52146E-5 38335 0 3.54039E-4
8-143607898-G-C c.3313-5G>C splice_region BAI1 2 76384 2.61835E-5 38192 0 4.72233E-6
8-143607899-G-C c.3313-4G>C splice_region BAI1 3 77082 3.89196E-5 38541 0 3.55205E-4
8-143607944-G-A p.Val1118Val synonymous BAI1 24 80380 2.98582E-4 40190 0 0.001056
8-143607946-C-T p.Ser1119Phe missense BAI1 2 80424 2.48682E-5 40212 0 NA
8-143607953-C-T p.Asp1121Asp synonymous BAI1 1 80388 1.24397E-5 40194 0 5.06586E-4
8-143607954-G-A p.Gly1122Ser missense BAI1 2 80390 2.48787E-5 40195 0 3.19775E-5
8-143607962-G-A p.Thr1124Thr synonymous BAI1 1 80256 1.24601E-5 40128 0 5.26726E-5
8-143607972-C-T p.Leu1128Leu synonymous BAI1 1 80108 1.24831E-5 40054 0 1.23264E-5
8-143607981-C-T p.Arg1131Trp missense BAI1 1 79598 1.25631E-5 39799 0 NA
8-143607987-G-A p.Gly1133Arg missense+splice_region BAI1 1 79440 1.25881E-5 39720 0 NA
8-143607996-C-T c.3398+8C>T splice_region BAI1 2 79072 2.52934E-5 39536 0 1.27925E-5
8-143614659-C-T p.Leu1106Phe missense BAI1 1 77338 1.29303E-5 38669 0 6.59178E-6
8-143614689-G-A p.Ala1116Thr missense BAI1 2 79856 2.50451E-5 39928 0 1.07166E-4
8-143614698-G-A p.Ala1119Thr missense BAI1 486 80372 0.00604688 40186 7 0.0121335
8-143614713-G-A p.Gly1124Ser missense BAI1 2 80846 2.47384E-5 40423 0 6.25E-4
8-143614726-G-A p.Val1157Ile missense BAI1 3 81172 3.69586E-5 40586 0 3.19285E-5
8-143614731-C-T p.Arg1130* stop_gained BAI1 1 81260 1.23062E-5 40630 0 1.46864E-5
8-143614736-G-A p.Arg1160His missense BAI1 1 81468 1.22748E-5 40734 0 NA
8-143614743-C-A p.Arg1134Ser missense BAI1 15 81630 1.83756E-4 40815 0 2.87301E-4
8-143614744-G-A p.Ala1163Thr missense BAI1 3 81628 3.67521E-5 40814 0 4.18244E-5
8-143614774-G-A p.Asp1173Asn missense BAI1 6 81914 7.32476E-5 40957 0 6.25E-4
8-143614791-C-T p.Arg1150Cys missense BAI1 2 81932 2.44105E-5 40966 0 1.70558E-5
8-143614795-A-G p.Ile1180Val missense BAI1 2 81938 2.44087E-5 40969 0 NA
8-143614798-G-A p.Val1181Ile missense BAI1 1 81942 1.22038E-5 40971 0 8.52355E-6
8-143614801-A-G p.Met1182Val missense BAI1 3 81934 3.66148E-5 40967 0 2.01815E-5
8-143614808-A-G p.His1184Arg missense BAI1 1 81878 1.22133E-5 40939 0 NA
8-143614815-C-T p.Pro1158Ser missense BAI1 5 81852 6.10859E-5 40926 0 2.58456E-5
8-143618356-C-T p.Asp1193Asp synonymous BAI1 2 81120 2.46548E-5 40560 0 9.03587E-5
8-143618358-C-T p.Ala1194Val missense BAI1 1 81144 1.23238E-5 40572 0 NA
8-143618365-A-G p.Lys1196Lys synonymous BAI1 1 81200 1.23153E-5 40600 0 2.01062E-5
8-143618370-G-A p.Arg1198His missense BAI1 7 81234 8.61708E-5 40617 0 5.87448E-5
8-143618382-G-A p.Arg1202Gln missense BAI1 5 81216 6.15642E-5 40608 0 1.98513E-4
8-143618382-G-C p.Arg1202Pro missense BAI1 11 81216 1.35441E-4 40608 0 6.25E-4
8-143618407-A-G p.Ser1210Ser synonymous BAI1 3 81176 3.69567E-5 40588 0 2.35838E-5
8-143618409-G-T p.Gly1211Val missense BAI1 1 81176 1.23189E-5 40588 0 3.57551E-5
8-143618433-C-T p.Ala1219Val missense BAI1 1 80916 1.23585E-5 40458 0 NA
8-143620729-C-T c.3667-6C>T splice_region BAI1 3 81896 3.66318E-5 40948 0 4.8614E-6
8-143620740-C-A p.Asp1224Glu missense BAI1 2 81968 2.43998E-5 40984 0 4.61136E-6
8-143620743-C-T p.Phe1225Phe synonymous BAI1 23 81966 2.80604E-4 40983 0 0.0025
8-143620752-C-T p.Asp1228Asp synonymous BAI1 5 82026 6.09563E-5 41013 0 6.37552E-5
8-143620777-G-A c.3706+3G>A splice_region BAI1 5 81926 6.10307E-5 40963 0 6.87569E-5
8-143620780-C-T c.3706+6C>T splice_region BAI1 3 81840 3.66569E-5 40920 0 1.54443E-4
8-143620781-G-A c.3706+7G>A splice_region BAI1 1 81824 1.22214E-5 40912 0 NA
8-143623318-C-T p.Ile1241Ile synonymous BAI1 4 74824 5.34588E-5 37412 0 1.44279E-4
8-143623319-G-A p.Ala1242Thr missense BAI1 1 74946 1.33429E-5 37473 0 1.87645E-5
8-143623320-C-T p.Ala1242Val missense BAI1 1 75172 1.33028E-5 37586 0 2.02922E-4
8-143623321-G-A p.Ala1242Ala synonymous BAI1 1 75518 1.32419E-5 37759 0 6.08354E-6
8-143623327-C-T p.Cys1244Cys synonymous BAI1 4 76586 5.22289E-5 38293 0 2.30229E-4
8-143623336-C-T p.Ala1247Ala synonymous BAI1 1 77792 1.28548E-5 38896 0 5.37646E-6
8-143623340-A-G p.Ile1249Val missense BAI1 1 78010 1.28189E-5 39005 0 NA
8-143623345-G-A p.Thr1250Thr synonymous BAI1 1 78216 1.27851E-5 39108 0 5.13405E-6
8-143623358-C-T p.Arg1255Trp missense BAI1 2 78832 2.53704E-5 39416 0 3.18837E-5
8-143623359-G-A p.Arg1255Gln missense BAI1 4 79074 5.05855E-5 39537 0 1.27575E-4
8-143623362-C-T p.Pro1256Leu missense BAI1 14 79348 1.76438E-4 39674 0 3.18878E-5
8-143623363-G-A p.Pro1256Pro synonymous BAI1 5 79532 6.28678E-5 39766 0 9.56511E-5
8-143623366-T-C p.Ser1257Ser synonymous BAI1 1 79734 1.25417E-5 39867 0 NA
8-143623372-C-A p.Pro1259Pro synonymous BAI1 1641 79802 0.0205634 39901 52 0.0518209
8-143623372-C-T p.Pro1259Pro synonymous BAI1 21 79942 2.6269E-4 39971 0 5.61237E-4
8-143623373-G-A p.Glu1260Lys missense BAI1 2 80036 2.49888E-5 40018 0 1.96843E-5
8-143623375-G-A p.Glu1260Glu synonymous BAI1 1 80216 1.24663E-5 40108 0 1.84911E-4
8-143623397-C-T p.His1268Tyr missense BAI1 1 80868 1.23658E-5 40434 0 NA
8-143623410-C-T p.Pro1272Leu missense BAI1 5 81108 6.16462E-5 40554 0 5.07841E-5
8-143623410-C-G p.Pro1272Arg missense BAI1 1 81108 1.23292E-5 40554 0 4.08407E-6
8-143623411-G-A p.Pro1272Pro synonymous BAI1 1 81024 1.2342E-5 40512 0 3.9921E-5
8-143623414-C-T p.Pro1273Pro synonymous BAI1 1 81436 1.22796E-5 40718 0 5.04032E-4
8-143623417-C-A p.Thr1274Thr synonymous BAI1 287 81516 0.00352078 40758 0 0.00809949
8-143623425-A-G p.Asn1277Ser missense BAI1 2 81656 2.4493E-5 40828 0 3.19183E-5
8-143623431-T-A p.Leu1279Gln missense BAI1 1 81714 1.22378E-5 40857 0 NA
8-143623435-G-A p.Pro1280Pro synonymous BAI1 8 81738 9.78737E-5 40869 0 3.03151E-4
8-143623441-C-T p.Asn1282Asn synonymous BAI1 2 81836 2.44391E-5 40918 0 2.5733E-5
8-143623459-G-T p.Leu1288Leu synonymous BAI1 10625 81580 0.13024 40790 751 0.147167
8-143623461-A-G p.His1289Arg missense BAI1 15 81938 1.83065E-4 40969 0 3.19061E-5
8-143623462-C-T p.His1289His synonymous BAI1 1 81962 1.22008E-5 40981 0 2.82015E-5
8-143623472-C-G p.Arg1293Gly missense BAI1 2 81986 2.43944E-5 40993 0 NA
8-143623473-G-A p.Arg1293His missense BAI1 2 81962 2.44016E-5 40981 0 6.38121E-5
8-143623474-C-T p.Arg1293Arg synonymous BAI1 3 81976 3.65961E-5 40988 0 NA
8-143623478-C-G p.Pro1295Ala missense BAI1 17 82002 2.07312E-4 41001 0 5.88403E-5
8-143623480-C-T p.Pro1295Pro synonymous BAI1 129 81980 0.00157355 40990 0 0.004375
8-143623481-G-A p.Gly1296Ser missense BAI1 1 81934 1.22049E-5 40967 0 1.20882E-5
8-143623484-G-A p.Gly1297Arg missense BAI1 3 81956 3.6605E-5 40978 0 4.02787E-5
8-143623486-G-T p.Gly1297Gly synonymous BAI1 1 81940 1.22041E-5 40970 0 NA
8-143623495-C-T p.Pro1300Pro synonymous BAI1 10 81932 1.22052E-4 40966 0 1.276E-4
8-143623496-G-A p.Asp1301Asn missense BAI1 2 81842 2.44373E-5 40921 0 8.3804E-6
8-143623496-G-C p.Asp1301His missense BAI1 1 81842 1.22187E-5 40921 0 NA
8-143623504-C-T p.Pro1303Pro synonymous BAI1 1 81936 1.22046E-5 40968 0 NA
8-143623507-C-G p.Asn1304Lys missense BAI1 1 81934 1.22049E-5 40967 0 1.20764E-5
8-143623514-C-A p.Leu1307Met missense BAI1 1 81852 1.22172E-5 40926 0 8.36512E-6
8-143623524-A-T p.Lys1310Met missense BAI1 1 81734 1.22348E-5 40867 0 NA
8-143623531-C-A p.Asp1312Glu missense BAI1 2 81718 2.44744E-5 40859 0 NA
8-143623536-C-T p.Ala1314Val missense BAI1 198 81598 0.00242653 40799 1 0.00118376
8-143623536-C-A p.Ala1314Glu missense BAI1 1 81602 1.22546E-5 40801 0 NA
8-143623537-G-A p.Ala1314Ala synonymous BAI1 1 81572 1.22591E-5 40786 0 1.20813E-5
8-143623546-C-T p.Ser1317Ser synonymous BAI1 1 81586 1.2257E-5 40793 0 3.18756E-5
8-143623548-CCTT-C p.Phe1319del conservative_inframe_deletion BAI1 1 81582 1.22576E-5 40791 0 3.18735E-5
8-143623551-T-C p.Phe1319Ser missense BAI1 1 81604 1.22543E-5 40802 0 NA
8-143623552-C-T p.Phe1319Phe synonymous BAI1 10 81584 1.22573E-4 40792 0 1.25378E-4
8-143623555-C-T p.Val1320Val synonymous BAI1 7 81592 8.57927E-5 40796 0 6.68527E-5
8-143623561-C-T p.Asp1322Asp synonymous BAI1 6 81716 7.3425E-5 40858 0 6.3804E-5
8-143623562-G-A p.Gly1323Arg missense BAI1 1 81710 1.22384E-5 40855 0 2.50702E-5
8-143623562-G-C p.Gly1323Arg missense BAI1 1 81710 1.22384E-5 40855 0 NA
8-143623570-C-A p.Ile1325Ile synonymous BAI1 1 81736 1.22345E-5 40868 0 0.00151057
8-143623573-C-T p.Phe1326Phe synonymous BAI1 1 81764 1.22303E-5 40882 0 2.50694E-5
8-143623594-G-C p.Leu1333Leu synonymous BAI1 10 81818 1.22222E-4 40909 0 0.00125
8-143623598-C-T p.Arg1335Trp missense BAI1 4 81800 4.88998E-5 40900 0 1.60961E-5
8-143623599-G-A p.Arg1335Gln missense BAI1 2 81798 2.44505E-5 40899 0 2.50979E-5
8-143623616-C-A p.Leu1341Met missense BAI1 3 81852 3.66515E-5 40926 0 3.1904E-5
8-143623624-G-A p.Thr1343Thr synonymous BAI1 2 81828 2.44415E-5 40914 0 1.67619E-5
8-143623624-G-T p.Thr1343Thr synonymous BAI1 2 81828 2.44415E-5 40914 0 8.38097E-6
8-143623630-C-T p.Tyr1345Tyr synonymous BAI1 1 81760 1.22309E-5 40880 0 8.38785E-6
8-143623640-C-CCCACGG p.Ala1353_Thr1354dup conservative_inframe_insertion BAI1 1 81686 1.2242E-5 40843 0 2.81801E-5
8-143623640-C-T p.Pro1349Ser missense BAI1 1 81686 1.2242E-5 40843 0 1.68257E-5
8-143623643-A-G p.Thr1350Ala missense BAI1 1 81640 1.22489E-5 40820 0 NA
8-143623644-C-T p.Thr1350Met missense BAI1 3 81626 3.6753E-5 40813 0 1.20904E-5
8-143623645-G-A p.Thr1350Thr synonymous BAI1 1 81618 1.22522E-5 40809 0 2.53259E-5
8-143623650-C-T p.Thr1352Met missense BAI1 1 81588 1.22567E-5 40794 0 5.07125E-5
8-143623653-C-T p.Ala1353Val missense BAI1 1 81538 1.22642E-5 40769 0 3.19163E-5
8-143623656-C-T p.Thr1354Met missense BAI1 6 81478 7.36395E-5 40739 0 5.10239E-5
8-143623657-G-A p.Thr1354Thr synonymous BAI1 3 81414 3.68487E-5 40707 0 6.38855E-5
8-143623658-C-T p.Leu1355Leu synonymous BAI1 1 81404 1.22844E-5 40702 0 NA
8-143623661-C-T p.Arg1356Trp missense BAI1 2 81312 2.45966E-5 40656 0 3.1953E-5
8-143623668-A-C p.Lys1358Thr missense BAI1 2 81256 2.46136E-5 40628 0 8.66566E-6
8-143623668-A-G p.Lys1358Arg missense BAI1 1 81256 1.23068E-5 40628 0 NA
8-143623678-G-A p.Glu1361Glu synonymous BAI1 7 81098 8.63153E-5 40549 0 1.59795E-4
8-143623683-C-T p.Pro1363Leu missense BAI1 1 80946 1.23539E-5 40473 0 9.06454E-6
8-143623696-C-G p.Ile1367Met missense BAI1 1 80554 1.2414E-5 40277 0 9.6123E-5
8-143623696-C-A p.Ile1367Ile synonymous BAI1 1 80554 1.2414E-5 40277 0 NA
8-143623714-G-A p.Pro1373Pro synonymous BAI1 1 78916 1.26717E-5 39458 0 1.14098E-5
8-143623720-C-T p.Thr1375Thr synonymous BAI1 1 80462 1.24282E-5 40231 0 NA
8-143623740-C-T p.Thr1382Met missense BAI1 5 79244 6.30963E-5 39622 0 5.23807E-5
8-143623742-G-A p.Ala1383Thr missense BAI1 7 78862 8.87627E-5 39431 0 9.5039E-5
8-143623747-C-T p.Pro1384Pro synonymous BAI1 3 78392 3.82692E-5 39196 0 1.10165E-4
8-143623748-G-A p.Glu1385Lys missense BAI1 1 78164 1.27936E-5 39082 0 1.23672E-5
8-143623754-A-T p.Ser1387Cys missense BAI1 1 77580 1.28899E-5 38790 0 NA
8-143623754-A-G p.Ser1387Gly missense BAI1 1 77580 1.28899E-5 38790 0 6.51738E-6
8-143623758-T-TC p.Ala1390fs frameshift BAI1 3 77018 3.89519E-5 38509 0 1.03792E-4
8-143623762-C-T p.Pro1389Pro synonymous BAI1 18 76732 2.34583E-4 38366 0 1.1909E-4
8-143623762-C-A p.Pro1389Pro synonymous BAI1 1 76732 1.30324E-5 38366 0 NA
8-143623763-G-C p.Ala1390Pro missense BAI1 1 74592 1.34063E-5 37296 0 5.96529E-4
8-143623763-G-A p.Ala1390Thr missense BAI1 1 76120 1.31372E-5 38060 0 6.96156E-6
8-143623766-C-T p.Arg1391Cys missense BAI1 5 75904 6.58727E-5 37952 0 2.08102E-5
8-143623767-G-C p.Arg1391Pro missense BAI1 1 74180 1.34807E-5 37090 0 3.0447E-4
8-143623767-G-A p.Arg1391His missense BAI1 2 75420 2.65182E-5 37710 0 6.72947E-5
8-143623768-CAG-C p.Ser1392fs frameshift BAI1 12 75330 1.59299E-4 37665 0 NA
8-143623770-G-C p.Ser1392Thr missense BAI1 1 74294 1.346E-5 37147 0 1.88622E-4
8-143623773-C-T p.Pro1393Leu missense BAI1 2 74852 2.67194E-5 37426 0 3.56186E-5
8-143623774-G-A p.Pro1393Pro synonymous BAI1 2 74270 2.69288E-5 37135 0 8.12612E-5
8-143623777-C-T p.Pro1394Pro synonymous BAI1 1 74182 1.34804E-5 37091 0 1.4332E-5
8-143623778-T-C p.Ser1395Pro missense BAI1 1 72652 1.37642E-5 36326 0 0.0141844
8-143623781-C-T p.Arg1396Cys missense BAI1 3 73564 4.07808E-5 36782 0 1.44563E-5
8-143623784-CAG-C p.Gln1397fs frameshift BAI1 2 72910 2.74311E-5 36455 0 NA
8-143623787-C-T p.Pro1398Ser missense BAI1 6 72476 8.2786E-5 36238 0 1.48458E-5
8-143623787-C-A p.Pro1398Thr missense BAI1 1 72476 1.37977E-5 36238 0 NA
8-143623791-C-T p.Pro1399Leu missense BAI1 1 72098 1.387E-5 36049 0 3.465E-5
8-143623792-CAGCGGCGGG-C p.Ser1400_Gly1402del conservative_inframe_deletion BAI1 4 71798 5.57119E-5 35899 0 NA
8-143623792-CAG-C p.Ser1400fs frameshift BAI1 1 71966 1.38955E-5 35983 0 NA
8-143623795-C-T p.Ser1400Ser synonymous BAI1 3 70888 4.23203E-5 35444 0 3.57859E-5
8-143623795-CGGCGGG-C p.Gly1401_Gly1402del conservative_inframe_deletion BAI1 1 70878 1.41088E-5 35439 0 NA
8-143623799-G-A p.Gly1402Arg missense BAI1 1 69726 1.43419E-5 34863 0 NA
8-143623805-C-A p.Pro1404Thr missense BAI1 1 68812 1.45323E-5 34406 0 7.14439E-5
8-143623807-C-T p.Pro1404Pro synonymous BAI1 12 68454 1.753E-4 34227 0 1.92331E-4
8-143623816-C-T p.Pro1407Pro synonymous BAI1 1 66978 1.49303E-5 33489 0 3.53657E-5
8-143623820-G-A p.Ala1409Thr missense BAI1 8 66404 1.20475E-4 33202 0 0.00470219
8-143623824-AGCCCCCACCGCCTCC-A p.Pro1415_Pro1419del disruptive_inframe_deletion BAI1 2 66156 3.02316E-5 33078 0 1.26646E-4
8-143623833-C-T p.Pro1413Leu missense BAI1 2 65090 3.07267E-5 32545 0 NA
8-143623834-G-A p.Pro1413Pro synonymous BAI1 64 64656 9.89854E-4 32328 0 0.00692695
8-143623834-G-T p.Pro1413Pro synonymous BAI1 1 64680 1.54607E-5 32340 0 NA
8-143623837-TCCGCCCCCA-T p.Pro1417_Pro1419del disruptive_inframe_deletion BAI1 2 64642 3.09396E-5 32321 0 NA
8-143623839-C-T p.Pro1415Leu missense BAI1 4 64696 6.18276E-5 32348 0 6.85542E-5
8-143623840-G-A p.Pro1415Pro synonymous BAI1 2 64044 3.12285E-5 32022 0 6.37255E-4
8-143623840-G-GCCCCCACCGCCACCA p.Pro1417_Pro1421dup disruptive_inframe_insertion BAI1 2 64044 3.12285E-5 32022 0 NA
8-143623848-C-T p.Pro1418Leu missense BAI1 4 63840 6.26566E-5 31920 0 0.00139665
8-143623849-G-A p.Pro1418Pro synonymous BAI1 2 63008 3.1742E-5 31504 0 7.12758E-5
8-143623852-A-C p.Pro1419Pro synonymous BAI1 3 63226 4.74488E-5 31613 0 2.94334E-4
8-143623861-C-T p.Pro1422Pro synonymous BAI1 12 63906 1.87776E-4 31953 0 0.00560224
8-143623870-C-T p.Pro1425Pro synonymous BAI1 2 63228 3.16316E-5 31614 0 NA
8-143623874-C-T p.Pro1427Ser missense BAI1 1 62584 1.59785E-5 31292 0 NA
8-143623881-C-T p.Pro1429Leu missense BAI1 6 62054 9.669E-5 31027 0 4.5045E-4
8-143623882-G-T p.Pro1429Pro synonymous BAI1 29 61366 4.72574E-4 30683 0 0.00189394
8-143623882-G-A p.Pro1429Pro synonymous BAI1 2 61374 3.25871E-5 30687 0 3.32171E-5
8-143623888-T-G p.Asn1431Lys missense BAI1 1 61584 1.6238E-5 30792 0 NA
8-143623890-T-A p.Leu1432Gln missense BAI1 1 61804 1.61802E-5 30902 0 5.9312E-4
8-143623891-G-A p.Leu1432Leu synonymous BAI1 1 61928 1.61478E-5 30964 0 NA
8-143623896-C-T p.Pro1434Leu missense BAI1 2 61126 3.27193E-5 30563 0 6.52358E-5
8-143623897-G-A p.Pro1434Pro synonymous BAI1 2 60936 3.28213E-5 30468 0 3.30841E-5
8-143623901-C-A p.Pro1436Thr missense BAI1 3 60842 4.9308E-5 30421 0 NA
8-143623906-C-A p.Pro1437Pro synonymous BAI1 1 60874 1.64274E-5 30437 0 6.25782E-4
8-143623906-C-T p.Pro1437Pro synonymous BAI1 1 60876 1.64268E-5 30438 0 6.34317E-4
8-143623921-C-G p.Pro1442Pro synonymous BAI1 1 59928 1.66867E-5 29964 0 6.25782E-4
8-143623922-G-A p.Gly1443Arg missense BAI1 1 60040 1.66556E-5 30020 0 1.08178E-4
8-143623927-G-A p.Glu1444Glu synonymous BAI1 60 59486 0.00100864 29743 0 0.00248179
8-143623933-C-T p.Ala1446Ala synonymous BAI1 2 58672 3.40878E-5 29336 0 9.33184E-5
8-143623934-G-A p.Ala1447Thr missense BAI1 9 58650 1.53453E-4 29325 0 6.25E-4
8-143623938-A-C p.His1448Pro missense BAI1 2 58614 3.41215E-5 29307 0 NA
8-143623939-T-C p.His1448His synonymous BAI1 2 58314 3.42971E-5 29157 0 3.73235E-5
8-143623941-C-T p.Pro1449Leu missense BAI1 2 57956 3.45089E-5 28978 0 1.48359E-5
8-143623942-G-A p.Pro1449Pro synonymous BAI1 1 58106 1.72099E-5 29053 0 3.22061E-5
8-143623943-G-A p.Gly1450Arg missense BAI1 1 57910 1.72682E-5 28955 0 3.21481E-5
8-143623953-C-T p.Thr1453Met missense BAI1 1 56126 1.78171E-5 28063 0 6.42674E-5
8-143623954-G-A p.Thr1453Thr synonymous BAI1 1 55846 1.79064E-5 27923 0 2.97333E-4
8-143623958-C-T p.Pro1455Ser missense BAI1 1 55098 1.81495E-5 27549 0 2.76022E-5
8-143623986-C-A p.Thr1464Asn missense BAI1 1 48426 2.06501E-5 24213 0 NA
8-143624001-C-T p.Ser1469Phe missense BAI1 2 45234 4.42145E-5 22617 0 6.88639E-6
8-143624010-T-G c.4413+2T>G splice_donor BAI1 1 43860 2.27998E-5 21930 0 NA
8-143624012-AG-A c.4413+5delG splice_region BAI1 2 43702 4.57645E-5 21851 0 6.42013E-5
8-143624015-GGGGCAGGGGTGGGCCACACCCCAGCCAGCGA-G c.4413+8_4413+38delGGGCAGGGGTGGGCCACACCCCAGCCAGCGA splice_region BAI1 2 43500 4.5977E-5 21750 0 NA
8-143624757-C-T c.4414-7C>T splice_region BAI1 1 82272 1.21548E-5 41136 0 NA
8-143624760-G-A c.4414-4G>A splice_region BAI1 1 82252 1.21578E-5 41126 0 NA
8-143624765-G-A p.Arg1472Gln missense+splice_region BAI1 2 82258 2.43137E-5 41129 0 5.03525E-4
8-143624767-C-T p.Arg1473Trp missense BAI1 3 82268 3.64662E-5 41134 0 3.19E-5
8-143624772-G-A p.Lys1474Lys synonymous BAI1 3 82238 3.64795E-5 41119 0 8.54978E-6
8-143624775-G-A p.Ser1475Ser synonymous BAI1 3 82222 3.64866E-5 41111 0 2.01348E-5
8-143624954-G-A c.4450-8G>A splice_region BAI1 47 81440 5.77112E-4 40720 1 0.00115104
8-143624967-C-A p.Ile1485Ile synonymous BAI1 1 81554 1.22618E-5 40777 0 5.43679E-6
8-143624978-G-A p.Arg1489Gln missense BAI1 1 81508 1.22687E-5 40754 0 NA
8-143624989-C-A p.Gln1493Lys missense BAI1 28 81466 3.43702E-4 40733 0 7.31368E-4
8-143625012-C-T p.Asn1500Asn synonymous BAI1 1 81238 1.23095E-5 40619 0 5.51791E-6
8-143625021-G-T p.Leu1503Leu synonymous BAI1 1 81138 1.23247E-5 40569 0 3.20533E-5
8-143625028-G-A p.Ala1506Thr missense BAI1 2 80920 2.47158E-5 40460 0 0.00101523
8-143625032-C-T p.Ala1507Val missense BAI1 527 80658 0.00653376 40329 8 0.0140345
8-143625033-G-C p.Ala1507Ala synonymous BAI1 4 80732 4.95466E-5 40366 0 1.23681E-4
8-143625033-G-A p.Ala1507Ala synonymous BAI1 3 80732 3.716E-5 40366 0 5.81247E-6
8-143625043-A-C p.Lys1511Gln missense BAI1 1 80368 1.24428E-5 40184 0 NA
8-143625054-G-A p.Leu1514Leu synonymous BAI1 2 79784 2.50677E-5 39892 0 6.4E-5
8-143625059-C-T p.Pro1516Leu missense BAI1 1 78828 1.26858E-5 39414 0 2.2898E-4
8-143625060-G-A p.Pro1516Pro synonymous BAI1 2 79108 2.52819E-5 39554 0 6.4917E-4
8-143625063-C-T p.Asp1517Asp synonymous BAI1 10 78784 1.26929E-4 39392 0 6.24033E-5
8-143625583-G-A p.Pro1520Pro splice_region+synonymous BAI1 8 59100 1.35364E-4 29550 0 0.00121655
8-143625586-A-G p.Glu1521Glu synonymous BAI1 1 59780 1.6728E-5 29890 0 NA
8-143625626-C-G p.Arg1535Gly missense BAI1 6 62024 9.67367E-5 31012 0 2.10644E-4
8-143625627-G-A p.Arg1535Gln missense BAI1 1 62134 1.60942E-5 31067 0 NA
8-143625632-G-C p.Ala1537Pro missense BAI1 1 62404 1.60246E-5 31202 0 NA
8-143625633-C-T p.Ala1537Val missense BAI1 1 62482 1.60046E-5 31241 0 NA
8-143625637-C-T p.His1538His synonymous BAI1 1 62512 1.59969E-5 31256 0 6.7981E-6
8-143625642-C-T p.Thr1540Met missense BAI1 3 62350 4.81155E-5 31175 0 1.80007E-4
8-143625643-G-A p.Thr1540Thr synonymous BAI1 4 62284 6.4222E-5 31142 0 0.001875
8-143625649-G-A p.Thr1542Thr synonymous BAI1 1 62778 1.59291E-5 31389 0 3.18796E-5
8-143625672-C-T p.Pro1550Leu missense BAI1 4 64458 6.20559E-5 32229 0 3.19326E-5
8-143625682-G-A p.Pro1553Pro synonymous BAI1 15 64996 2.30783E-4 32498 0 6.06061E-4
8-143625685-G-A p.Ser1554Ser synonymous BAI1 4 65044 6.14968E-5 32522 0 3.18918E-5
8-143625685-G-C p.Ser1554Ser synonymous BAI1 1 65044 1.53742E-5 32522 0 3.18918E-5
8-143625687-C-T p.Pro1555Leu missense BAI1 1 65280 1.53186E-5 32640 0 6.38081E-5
8-143625689-C-T p.Leu1556Leu synonymous BAI1 2 65588 3.04934E-5 32794 0 NA
8-143625693-A-G p.Glu1557Gly missense BAI1 1 65658 1.52304E-5 32829 0 NA
8-143625699-G-A p.Arg1559His missense BAI1 2 65422 3.05708E-5 32711 0 NA
8-143625701-A-G p.Ser1560Gly missense BAI1 3 65574 4.57498E-5 32787 0 2.09176E-4
8-143625703-C-T p.Ser1560Ser synonymous BAI1 171 65462 0.0026122 32731 0 0.00293423
8-143625720-C-T p.Ser1566Leu missense BAI1 21 65162 3.22274E-4 32581 0 0.00268584
8-143625721-G-A p.Ser1566Ser synonymous BAI1 27 65158 4.14377E-4 32579 0 0.0014992
8-143625723-G-C p.Gly1567Ala missense BAI1 1 65108 1.53591E-5 32554 0 NA
8-143625724-C-T p.Gly1567Gly synonymous BAI1 1 64924 1.54026E-5 32462 0 6.25E-4
8-143625725-G-T p.Ala1568Ser missense BAI1 1 64726 1.54497E-5 32363 0 NA
8-143625725-G-A p.Ala1568Thr missense BAI1 2 64726 3.08995E-5 32363 0 NA
8-143625729-C-T p.Thr1569Met missense BAI1 2 64894 3.08195E-5 32447 0 NA
8-143625730-G-A p.Thr1569Thr synonymous BAI1 1 64980 1.53894E-5 32490 0 NA
8-143625733-C-A p.Ile1570Ile synonymous BAI1 1 65166 1.53454E-5 32583 0 NA
8-143625754-C-T p.Ile1577Ile synonymous BAI1 2 63862 3.13175E-5 31931 0 NA
8-143625761-C-T p.Leu1580Phe missense BAI1 1 62494 1.60015E-5 31247 0 NA
8-143625769-C-A p.Thr1582Thr synonymous BAI1 1 60946 1.6408E-5 30473 0 1.01206E-5
8-143625777-G-A p.Ter1585Ter stop_retained BAI1 1 59622 1.67723E-5 29811 0 3.18878E-5
8-143626044-G-A n.672G>A splice_region BAI1 1 36474 2.74168E-5 18237 0 6.37836E-5
8-143626368-A-G c.*590A>G splice_region BAI1 41 41938 9.77634E-4 20969 0 3.83044E-4