Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
10-111767738-C-T c.-349C>T 5_prime_UTR_premature_start_codon_gain ADD3 1 7400 1.35135E-4 3700 0 NA
10-111860376-A-T c.-29-7A>T splice_region ADD3 5 80108 6.24157E-5 40054 0 1.27405E-4
10-111860383-AT-TC c.-29_-28delATinsTC splice_region ADD3 1 80826 1.23723E-5 40413 0 NA
10-111860419-C-T p.Ser3Leu missense ADD3 3 83108 3.60976E-5 41554 0 9.55597E-5
10-111860426-C-T p.Ala5Ala synonymous ADD3 1 83170 1.20236E-5 41585 0 1.63099E-5
10-111860431-A-G p.Gln7Arg missense ADD3 2 83206 2.40367E-5 41603 0 8.49776E-5
10-111860433-G-A p.Gly8Ser missense ADD3 3 83220 3.6049E-5 41610 0 4.03998E-6
10-111860434-G-A n.110+1G>A splice_donor ADD3 2 83218 2.40333E-5 41609 0 4.84492E-5
10-111860434-G-C n.110+1G>C splice_donor ADD3 1 83220 1.20163E-5 41610 0 NA
10-111860435-C-T n.110+2C>T splice_donor ADD3 2 83212 2.4035E-5 41606 0 6.36983E-5
10-111860445-ACTC-A p.Pro16del disruptive_inframe_deletion ADD3 1 83258 1.20109E-5 41629 0 4.45272E-5
10-111860454-C-T p.Pro15Ser missense ADD3 1 83282 1.20074E-5 41641 0 8.31131E-6
10-111860462-C-T n.229C>T splice_region ADD3 1 83292 1.2006E-5 41646 0 1.19691E-5
10-111860465-G-A p.Met18Ile missense ADD3 4 83292 4.80238E-5 41646 0 6.37024E-5
10-111860481-T-G p.Tyr24Asp missense ADD3 3 83318 3.60066E-5 41659 0 NA
10-111860483-T-C p.Tyr24Tyr synonymous ADD3 2 83320 2.40038E-5 41660 0 3.98178E-6
10-111860487-G-A p.Asp26Asn missense ADD3 1 83310 1.20034E-5 41655 0 NA
10-111860490-C-T p.Arg27Cys missense ADD3 8 83310 9.60269E-5 41655 0 1.65276E-5
10-111860491-G-A p.Arg27His missense ADD3 2 83308 2.40073E-5 41654 0 3.18593E-5
10-111860497-A-G p.Asn29Ser missense ADD3 4 83316 4.801E-5 41658 0 5.03525E-4
10-111860531-C-A p.Asn40Lys missense ADD3 2 83280 2.40154E-5 41640 0 NA
10-111860535-T-A p.Ser42Thr missense ADD3 1 83266 1.20097E-5 41633 0 NA
10-111860544-C-A p.Leu45Ile missense ADD3 6 83258 7.20651E-5 41629 0 7.43384E-5
10-111860558-C-T p.Phe49Phe synonymous ADD3 3 83230 3.60447E-5 41615 0 8.01025E-6
10-111860565-A-G p.Met52Val missense ADD3 1 83208 1.20181E-5 41604 0 4.01162E-6
10-111860570-G-C p.Glu53Asp missense ADD3 1 83202 1.20189E-5 41601 0 NA
10-111860573-G-A p.Gln54Gln synonymous ADD3 1 83186 1.20213E-5 41593 0 8.32002E-6
10-111860582-A-G p.Arg57Arg synonymous ADD3 1 83106 1.20328E-5 41553 0 NA
10-111860585-T-C p.Val58Val synonymous ADD3 1 83094 1.20346E-5 41547 0 8.37114E-6
10-111860589-C-G p.Gln60Glu missense ADD3 1 83056 1.20401E-5 41528 0 8.41666E-6
10-111860599-A-G p.Gln63Arg missense ADD3 1 82840 1.20715E-5 41420 0 8.3689E-6
10-111872542-G-A p.Arg68Gln missense ADD3 3 83270 3.60274E-5 41635 0 3.99799E-6
10-111872557-G-A p.Cys73Tyr missense ADD3 2 83296 2.40108E-5 41648 0 8.25764E-6
10-111872567-A-G p.Gln76Gln synonymous ADD3 1 83286 1.20068E-5 41643 0 1.27413E-4
10-111872568-G-A p.Glu77Lys missense ADD3 1 83286 1.20068E-5 41643 0 NA
10-111872575-T-C p.Met79Thr missense ADD3 1 83294 1.20057E-5 41647 0 1.98931E-5
10-111872584-G-A p.Gly82Asp missense ADD3 9 83288 1.08059E-4 41644 0 1.43215E-4
10-111872593-C-T p.Pro85Leu missense ADD3 1 83314 1.20028E-5 41657 0 NA
10-111872608-C-T p.Ala90Val missense ADD3 1 83308 1.20036E-5 41654 0 NA
10-111872617-A-G p.Gln93Arg missense ADD3 1 83306 1.20039E-5 41653 0 8.24049E-6
10-111872633-C-T p.Ile98Ile synonymous ADD3 4 83296 4.80215E-5 41648 0 NA
10-111872643-T-C p.Ser102Pro missense ADD3 520 83302 0.00624235 41651 8 0.0108266
10-111872650-C-T p.Ser104Leu missense ADD3 19 83308 2.28069E-4 41654 0 3.82117E-4
10-111872651-G-A n.556G>A splice_region ADD3 11 83302 1.3205E-4 41651 0 1.47637E-4
10-111872664-C-T p.Pro109Ser missense ADD3 1 83284 1.20071E-5 41642 0 3.18471E-5
10-111872671-T-C p.Leu111Pro missense+splice_region ADD3 1 83278 1.2008E-5 41639 0 4.00484E-6
10-111876007-GCT-G c.335-9_335-8delCT splice_region ADD3 1 83214 1.20172E-5 41607 0 NA
10-111876022-G-T p.Gly114Cys missense ADD3 8 83240 9.61076E-5 41620 0 1.91241E-4
10-111876025-A-G p.Met115Val missense ADD3 1 83256 1.20111E-5 41628 0 NA
10-111876032-C-T p.Thr117Ile missense ADD3 1 83248 1.20123E-5 41624 0 NA
10-111876034-C-T p.Pro118Ser missense ADD3 4 83252 4.80469E-5 41626 0 NA
10-111876041-A-G p.Asn120Ser missense ADD3 4 83258 4.80434E-5 41629 0 2.47333E-5
10-111876046-C-T p.Leu122Phe missense ADD3 1 83264 1.201E-5 41632 0 3.97905E-6
10-111876056-C-T p.Ala125Val missense ADD3 2 83276 2.40165E-5 41638 0 NA
10-111876057-A-G p.Ala125Ala synonymous ADD3 1 83274 1.20085E-5 41637 0 NA
10-111876062-C-T p.Thr127Ile missense ADD3 5 83280 6.00384E-5 41640 0 NA
10-111876088-C-T p.Leu136Phe missense ADD3 6 83264 7.206E-5 41632 0 3.18431E-5
10-111876101-A-T p.Lys140Ile missense ADD3 3 83244 3.60386E-5 41622 0 1.98899E-5
10-111876131-T-C p.Leu150Ser missense ADD3 1 83210 1.20178E-5 41605 0 8.24008E-6
10-111876139-T-G p.Trp153Gly missense ADD3 2 83198 2.4039E-5 41599 0 NA
10-111876146-A-G p.His155Arg missense ADD3 1 83188 1.2021E-5 41594 0 NA
10-111876164-T-C p.Ile161Thr missense ADD3 1 83110 1.20322E-5 41555 0 9.0801E-5
10-111877093-T-C c.487-7T>C splice_region ADD3 1 81884 1.22124E-5 40942 0 1.23341E-5
10-111877101-T-G p.Val163Gly missense+splice_region ADD3 1 82258 1.21569E-5 41129 0 3.31087E-5
10-111877102-A-G p.Val163Val splice_region+synonymous ADD3 380 82164 0.0046249 41082 3 0.00606961
10-111877104-G-A p.Arg164Lys missense ADD3 1 82440 1.213E-5 41220 0 5.79183E-5
10-111877126-C-T p.His171His synonymous ADD3 7 82820 8.45206E-5 41410 0 6.25782E-4
10-111877127-A-G p.Ile172Val missense ADD3 1 82826 1.20735E-5 41413 0 NA
10-111877152-C-A p.Ser180Tyr missense ADD3 1 82842 1.20712E-5 41421 0 1.65826E-5
10-111877166-A-G p.Thr185Ala missense ADD3 1 82780 1.20802E-5 41390 0 3.98556E-6
10-111877169-G-A p.Ala186Thr missense ADD3 1 82750 1.20846E-5 41375 0 1.67532E-5
10-111877186-A-G c.567+6A>G splice_region ADD3 1 82498 1.21215E-5 41249 0 3.99814E-6
10-111878341-C-G c.568-4C>G splice_region ADD3 1 83150 1.20265E-5 41575 0 3.18918E-5
10-111878347-G-T p.Val190Val splice_region+synonymous ADD3 1 83180 1.20221E-5 41590 0 7.96204E-6
10-111878369-G-A p.Val198Met missense ADD3 1 83222 1.20161E-5 41611 0 3.1839E-5
10-111878385-G-A p.Ser203Asn missense ADD3 1 83216 1.20169E-5 41608 0 1.19349E-5
10-111878386-T-C n.761T>C splice_region ADD3 13 83216 1.5622E-4 41608 0 5.73285E-4
10-111878389-C-T p.Thr204Thr synonymous ADD3 1 83212 1.20175E-5 41606 0 NA
10-111878391-A-G p.Asn205Ser missense ADD3 1 83216 1.20169E-5 41608 0 6.36943E-5
10-111878393-T-C p.Leu206Leu synonymous ADD3 3 83214 3.60516E-5 41607 0 3.97817E-6
10-111878400-T-C p.Ile208Thr missense ADD3 6 83194 7.21206E-5 41597 0 1.2738E-4
10-111878401-T-A p.Ile208Ile synonymous ADD3 1 83192 1.20204E-5 41596 0 NA
10-111878406-A-G p.His210Arg missense ADD3 3 83180 3.60664E-5 41590 0 3.97855E-6
10-111878412-G-T p.Gly212Val missense ADD3 2 83168 2.40477E-5 41584 0 3.18512E-5
10-111878432-A-G p.Ile219Val missense ADD3 3 83104 3.60993E-5 41552 0 6.36821E-5
10-111878441-A-G p.Thr222Ala missense ADD3 2 83060 2.4079E-5 41530 0 8.25164E-6
10-111878443-A-T p.Thr222Thr synonymous ADD3 1 83064 1.20389E-5 41532 0 NA
10-111878465-A-C p.Ile230Leu missense ADD3 1 82972 1.20523E-5 41486 0 3.98241E-6
10-111878473-C-A p.Ile232Ile synonymous ADD3 1 82924 1.20592E-5 41462 0 NA
10-111878478-C-T p.Thr234Ile missense ADD3 1 82896 1.20633E-5 41448 0 NA
10-111878479-C-A p.Thr234Thr synonymous ADD3 4 82882 4.82614E-5 41441 0 3.98626E-6
10-111878486-A-G p.Thr237Ala missense ADD3 1 82836 1.2072E-5 41418 0 NA
10-111878962-C-A c.718-7C>A splice_region ADD3 2 83220 2.40327E-5 41610 0 7.96991E-6
10-111878966-T-C c.718-3T>C splice_region ADD3 11 83224 1.32173E-4 41612 0 2.86569E-4
10-111878988-G-T p.Gly246Val missense ADD3 2 83250 2.4024E-5 41625 0 3.97975E-6
10-111878998-A-C p.Pro249Pro synonymous ADD3 31 83260 3.72328E-4 41630 1 6.25E-4
10-111879003-C-G p.Ser251Cys missense ADD3 1 83258 1.20109E-5 41629 0 NA
10-111879010-G-A p.Glu253Glu synonymous ADD3 1 83256 1.20111E-5 41628 0 5.17294E-5
10-111879027-A-G p.Asp259Gly missense ADD3 98 83280 0.00117675 41640 0 7.59866E-4
10-111879027-A-T p.Asp259Val missense ADD3 1 83284 1.20071E-5 41642 0 4.12092E-5
10-111879032-G-T p.Ala261Ser missense ADD3 5 83300 6.0024E-5 41650 0 6.59326E-5
10-111879039-A-G p.Tyr263Cys missense ADD3 4 83312 4.80123E-5 41656 0 9.55536E-5
10-111879040-T-C p.Tyr263Tyr synonymous ADD3 1 83312 1.20031E-5 41656 0 3.18431E-5
10-111879042-A-T p.Asp264Val missense ADD3 5 83312 6.00154E-5 41656 0 0.0025
10-111879049-A-C p.Gln266His missense ADD3 1 83326 1.20011E-5 41663 0 NA
10-111879051-G-C p.Gly267Ala missense ADD3 1 83326 1.20011E-5 41663 0 8.24008E-6
10-111879071-G-A p.Glu274Lys missense ADD3 1 83350 1.19976E-5 41675 0 NA
10-111879071-G-C p.Glu274Gln missense ADD3 4 83350 4.79904E-5 41675 0 NA
10-111879098-G-A p.Gly283Arg missense ADD3 4 83348 4.79916E-5 41674 0 NA
10-111879105-G-C p.Ser285Thr missense ADD3 2 83356 2.39935E-5 41678 0 NA
10-111879110-AAGGTATGTAGTAGAGTTTGTCTAAGGAGCTATTTTTGTTGCTGCTGCTGTTGATGAAAACAGTGTGAGCTATGCCAGTTATTTCAAGTGATTGCTGTGGGCATTCTATTTT-A p.Lys287fs frameshift ADD3 1 83352 1.19973E-5 41676 0 NA
10-111879115-A-G c.861+3A>G splice_region ADD3 8 83340 9.59923E-5 41670 0 2.90596E-4
10-111879237-G-A p.Arg292Lys missense ADD3 1 83360 1.19962E-5 41680 0 NA
10-111879246-G-A p.Gly295Asp missense ADD3 1 83360 1.19962E-5 41680 0 3.97766E-6
10-111879251-G-A p.Val297Ile missense ADD3 2 83360 2.39923E-5 41680 0 2.47101E-5
10-111879257-C-G p.Leu299Val missense ADD3 7 83356 8.39772E-5 41678 0 1.59185E-4
10-111879279-C-A p.Ala306Asp missense ADD3 1 83348 1.19979E-5 41674 0 NA
10-111879296-A-G p.Asn312Asp missense ADD3 1 83324 1.20013E-5 41662 0 4.94307E-5
10-111879318-T-C p.Ile319Thr missense ADD3 1 83300 1.20048E-5 41650 0 NA
10-111879447-A-AATGTTTCTC n.264_265insATGTTTCTC splice_region ADD3 1 68988 1.44953E-5 34494 0 NA
10-111881879-A-G p.Leu324Leu synonymous ADD3 4 83284 4.80284E-5 41642 0 1.64984E-5
10-111881902-A-G p.Asn332Ser missense ADD3 60 83346 7.19891E-4 41673 0 6.64804E-4
10-111881918-C-T p.Asp337Asp synonymous ADD3 1 83362 1.19959E-5 41681 0 5.9692E-5
10-111881927-G-A p.Lys340Lys synonymous ADD3 1 83376 1.19939E-5 41688 0 3.1835E-5
10-111881930-T-C p.Tyr341Tyr synonymous ADD3 2 83380 2.39866E-5 41690 0 1.98927E-5
10-111881931-A-G p.Lys342Glu missense ADD3 1 83378 1.19936E-5 41689 0 3.58041E-5
10-111881933-A-T p.Lys342Asn missense ADD3 1 83380 1.19933E-5 41690 0 3.97852E-6
10-111881939-C-T p.Phe344Phe synonymous ADD3 2 83376 2.39877E-5 41688 0 6.37024E-5
10-111881956-C-T p.Ala350Val missense ADD3 3 83388 3.59764E-5 41694 0 1.89481E-4
10-111881957-G-A p.Ala350Ala synonymous ADD3 2 83390 2.39837E-5 41695 0 9.55353E-5
10-111881963-T-TGGA p.Gly355dup disruptive_inframe_insertion ADD3 1 83398 1.19907E-5 41699 0 5.1708E-5
10-111881963-TGGA-T n.111-2_111delAGG splice_acceptor ADD3 1 83398 1.19907E-5 41699 0 8.23778E-6
10-111881967-G-C p.Gly354Arg missense ADD3 31 83396 3.7172E-4 41698 0 8.91379E-4
10-111881971-G-T p.Gly355Val missense ADD3 3 83392 3.59747E-5 41696 0 2.47113E-5
10-111881975-G-A p.Val356Val synonymous ADD3 1 83398 1.19907E-5 41699 0 NA
10-111881977-A-G p.Asn357Ser missense ADD3 1 83394 1.19913E-5 41697 0 NA
10-111881985-T-G p.Ser360Ala missense ADD3 2 83392 2.39831E-5 41696 0 8.23791E-6
10-111881991-C-G p.Gln362Glu missense ADD3 1 83388 1.19921E-5 41694 0 NA
10-111882004-T-C p.Val366Ala missense ADD3 2 83396 2.3982E-5 41698 0 3.18552E-5
10-111882007-G-A p.Gly367Asp missense ADD3 2 83394 2.39825E-5 41697 0 1.19326E-5
10-111882027-C-T p.Leu374Phe missense ADD3 1 83382 1.1993E-5 41691 0 NA
10-111882028-T-G p.Leu374Arg missense ADD3 1 83382 1.1993E-5 41691 0 3.97956E-6
10-111882031-T-C p.Met375Thr missense ADD3 2 83374 2.39883E-5 41687 0 NA
10-111882035-G-A p.Arg376Arg synonymous ADD3 1 83360 1.19962E-5 41680 0 3.98645E-5
10-111882049-T-C p.Leu381Ser missense+splice_region ADD3 1 83294 1.20057E-5 41647 0 5.03525E-4
10-111883769-C-T c.1144-6C>T splice_region ADD3 2 82910 2.41225E-5 41455 0 1.6524E-5
10-111883770-C-A c.1144-5C>A splice_region ADD3 1 82914 1.20607E-5 41457 0 NA
10-111883784-A-G p.Thr385Ala missense ADD3 4 82962 4.82148E-5 41481 0 3.18431E-5
10-111883791-A-G p.Tyr387Cys missense ADD3 2 82966 2.41063E-5 41483 0 4.12106E-5
10-111883794-C-T p.Ala388Val missense ADD3 2 82982 2.41016E-5 41491 0 8.24185E-6
10-111883808-C-A p.Leu393Ile missense ADD3 1 82990 1.20496E-5 41495 0 1.99013E-5
10-111883815-G-A p.Arg395Gln missense ADD3 2 82996 2.40975E-5 41498 0 8.23968E-6
10-111883828-G-A p.Arg399Arg synonymous ADD3 1 82968 1.20528E-5 41484 0 7.96045E-6
10-111883833-A-G p.Lys401Arg missense ADD3 1 82976 1.20517E-5 41488 0 NA
10-111883847-A-G p.Ile406Val missense ADD3 6 82982 7.23048E-5 41491 0 9.55536E-5
10-111883872-C-T p.Ser414Phe missense ADD3 1 83014 1.20462E-5 41507 0 3.97991E-5
10-111883880-G-A p.Asp417Asn missense ADD3 2 83006 2.40946E-5 41503 0 NA
10-111883881-A-G p.Asp417Gly missense ADD3 1 83006 1.20473E-5 41503 0 NA
10-111883882-C-T p.Asp417Asp synonymous ADD3 11 83016 1.32505E-4 41508 0 6.37146E-5
10-111883883-G-A p.Asp418Asn missense ADD3 1 83044 1.20418E-5 41522 0 3.18634E-5
10-111883911-A-G p.Tyr427Cys missense ADD3 1 83126 1.20299E-5 41563 0 NA
10-111883921-G-A p.Gln430Gln synonymous ADD3 3 83132 3.60872E-5 41566 0 3.9788E-6
10-111883932-G-A p.Arg434His missense ADD3 1 83126 1.20299E-5 41563 0 1.19362E-5
10-111883961-A-C p.Asn444His missense ADD3 1 83140 1.20279E-5 41570 0 NA
10-111883970-A-G p.Met447Val missense ADD3 1 83142 1.20276E-5 41571 0 3.18552E-5
10-111883977-T-C p.Val449Ala missense ADD3 1 83140 1.20279E-5 41570 0 3.97855E-6
10-111883997-C-T p.Arg456Trp missense ADD3 1 83106 1.20328E-5 41553 0 6.59554E-5
10-111883998-G-A p.Arg456Gln missense ADD3 1 83102 1.20334E-5 41551 0 1.64891E-5
10-111884000-A-G p.Asn457Asp missense ADD3 1 83100 1.20337E-5 41550 0 NA
10-111884002-C-T p.Asn457Asn synonymous ADD3 1 83080 1.20366E-5 41540 0 3.1839E-5
10-111884003-G-A p.Gly458Arg missense ADD3 8 83072 9.6302E-5 41536 0 0.00100705
10-111884019-G-A p.Arg463Gln missense ADD3 2 82920 2.41196E-5 41460 0 3.18532E-5
10-111884023-C-G p.Thr464Thr synonymous ADD3 2 82870 2.41342E-5 41435 0 1.65317E-5
10-111884031-C-T p.Thr467Met missense+splice_region ADD3 1 82774 1.20811E-5 41387 0 NA
10-111884040-A-G c.1401+8A>G splice_region ADD3 1 82538 1.21156E-5 41269 0 8.32861E-6
10-111885581-T-C c.1402-3T>C splice_region ADD3 1 82152 1.21726E-5 41076 0 NA
10-111885601-C-T p.Asp473Asp synonymous ADD3 25 82666 3.02422E-4 41333 0 1.91058E-4
10-111885603-C-T p.Ser474Leu missense ADD3 3 82782 3.62398E-5 41391 0 8.27321E-6
10-111885608-A-G p.Lys476Glu missense ADD3 1 82808 1.20761E-5 41404 0 8.26597E-6
10-111885615-G-A p.Ser478Asn missense ADD3 1 82852 1.20697E-5 41426 0 NA
10-111885652-G-A p.Gln490Gln synonymous ADD3 2 83032 2.40871E-5 41516 0 NA
10-111885675-C-T p.Pro498Leu missense ADD3 2 82884 2.41301E-5 41442 0 7.42819E-5
10-111885676-G-A p.Pro498Pro synonymous ADD3 1 82904 1.20621E-5 41452 0 4.95229E-5
10-111885711-A-G c.1521+8A>G splice_region ADD3 2 82594 2.42148E-5 41297 0 6.37349E-5
10-111886178-C-T p.Arg509Trp missense ADD3 1 83118 1.20311E-5 41559 0 3.31175E-5
10-111886179-G-A p.Arg509Gln missense ADD3 1 83122 1.20305E-5 41561 0 1.65525E-5
10-111886180-G-A p.Arg509Arg synonymous ADD3 1 83130 1.20294E-5 41565 0 NA
10-111886189-T-C p.Asn512Asn synonymous ADD3 3 83184 3.60646E-5 41592 0 5.03525E-4
10-111886195-T-C p.Tyr514Tyr synonymous ADD3 1 83200 1.20192E-5 41600 0 8.256E-6
10-111886195-T-G p.Tyr514* stop_gained ADD3 1 83198 1.20195E-5 41599 0 NA
10-111886213-A-G p.Gly520Gly synonymous ADD3 9 83244 1.08116E-4 41622 0 3.98178E-5
10-111886219-A-G p.Gln522Gln synonymous ADD3 1 83246 1.20126E-5 41623 0 6.25E-4
10-111886239-T-C p.Ile529Thr missense ADD3 1 83258 1.20109E-5 41629 0 NA
10-111886241-G-A p.Val530Ile missense ADD3 4 83250 4.8048E-5 41625 0 6.36902E-5
10-111886249-T-A p.Asp532Glu missense ADD3 245 83224 0.00294386 41612 3 0.023125
10-111890116-G-C c.1609-5G>C splice_region ADD3 1 83004 1.20476E-5 41502 0 NA
10-111890124-A-G p.Met538Val missense ADD3 3 83128 3.60889E-5 41564 0 3.18492E-5
10-111890124-A-C p.Met538Leu missense ADD3 2 83128 2.40593E-5 41564 0 1.65618E-5
10-111890129-A-G p.Gln539Gln synonymous ADD3 6 83164 7.21466E-5 41582 0 1.27416E-4
10-111890146-A-G p.His545Arg missense ADD3 1 83220 1.20163E-5 41610 0 3.30267E-5
10-111890149-G-A p.Gly546Asp missense ADD3 1 83224 1.20158E-5 41612 0 NA
10-111890151-C-T p.Pro547Ser missense ADD3 118 83236 0.00141766 41618 0 0.00125
10-111890154-C-T p.Pro548Ser missense ADD3 1 83248 1.20123E-5 41624 0 NA
10-111890169-C-G p.Pro553Ala missense ADD3 1 83268 1.20094E-5 41634 0 3.97817E-6
10-111890185-CAGA-C p.Glu559del disruptive_inframe_deletion ADD3 2 83302 2.4009E-5 41651 0 7.95551E-6
10-111890186-A-G p.Thr558Thr synonymous ADD3 1 83306 1.20039E-5 41653 0 3.1839E-5
10-111890193-G-A p.Glu561Lys missense ADD3 1 83308 1.20036E-5 41654 0 NA
10-111890201-A-G p.Glu563Glu synonymous ADD3 4 83314 4.80111E-5 41657 0 7.95551E-6
10-111890215-C-T p.Thr568Ile missense ADD3 18 83308 2.16066E-4 41654 0 0.00302115
10-111890223-C-T p.Arg571Cys missense ADD3 4 83300 4.80192E-5 41650 0 3.29717E-5
10-111890224-G-A p.Arg571His missense ADD3 3 83294 3.6017E-5 41647 0 2.86642E-4
10-111890225-T-G p.Arg571Arg synonymous ADD3 3 83294 3.6017E-5 41647 0 8.24294E-6
10-111890241-G-A p.Glu577Lys missense ADD3 1 83276 1.20083E-5 41638 0 8.24987E-6
10-111892055-T-C c.1733-8T>C splice_region ADD3 2 82838 2.41435E-5 41419 0 NA
10-111892062-G-A c.1733-1G>A splice_acceptor ADD3 3 82978 3.61542E-5 41489 0 2.86642E-4
10-111892066-C-G p.Ala579Gly missense ADD3 166 83000 0.002 41500 0 0.00378957
10-111892067-T-A p.Ala579Ala synonymous ADD3 1 83006 1.20473E-5 41503 0 NA
10-111892070-G-A p.Glu580Glu synonymous ADD3 1 83042 1.20421E-5 41521 0 8.26119E-6
10-111892073-G-A p.Gln581Gln synonymous ADD3 3 83072 3.61133E-5 41536 0 1.65155E-5
10-111892080-C-G p.Leu584Val missense ADD3 3 83100 3.61011E-5 41550 0 5.03525E-4
10-111892090-A-G p.Asp587Gly missense ADD3 11 83130 1.32323E-4 41565 0 9.55536E-5
10-111892091-C-T p.Asp587Asp synonymous ADD3 4 83132 4.81162E-5 41566 0 3.50296E-4
10-111892092-G-A p.Ala588Thr missense ADD3 3 83130 3.60881E-5 41565 0 0.00100705
10-111892093-C-G p.Ala588Gly missense ADD3 5 83138 6.0141E-5 41569 0 2.80473E-4
10-111892096-C-T p.Ser589Leu missense ADD3 1 83140 1.20279E-5 41570 0 NA
10-111892101-G-T p.Val591Phe missense ADD3 33 83152 3.96864E-4 41576 1 7.00503E-4
10-111892107-C-T p.Gln593* stop_gained ADD3 1 83170 1.20236E-5 41585 0 NA
10-111892109-A-G p.Gln593Gln synonymous ADD3 1 83164 1.20244E-5 41582 0 3.97978E-6
10-111892132-C-T p.Pro601Leu missense ADD3 7 83142 8.41933E-5 41571 1 7.44774E-5
10-111892134-C-A p.Gln602Lys missense ADD3 27 83150 3.24714E-4 41575 0 4.22283E-4
10-111892135-A-C p.Gln602Pro missense ADD3 1 83156 1.20256E-5 41578 0 NA
10-111892139-T-C p.Asn603Asn synonymous ADD3 6 83132 7.21744E-5 41566 0 9.55718E-5
10-111892143-C-A p.Pro605Thr missense ADD3 2 83118 2.40622E-5 41559 0 NA
10-111892162-C-T c.1828+4C>T splice_region ADD3 2 82944 2.41127E-5 41472 0 1.31714E-4
10-111892164-C-T c.1828+6C>T splice_region ADD3 9 82932 1.08523E-4 41466 0 7.2077E-4
10-111892166-A-G c.1828+8A>G splice_region ADD3 9 82920 1.08538E-4 41460 1 6.39018E-5
10-111893078-T-C c.1733-6T>C splice_region ADD3 2 82470 2.42512E-5 41235 0 4.69656E-5
10-111893079-C-T c.1733-5C>T splice_region ADD3 1 82504 1.21206E-5 41252 0 3.37359E-5
10-111893080-G-A c.1733-4G>A splice_region ADD3 18 82500 2.18182E-4 41250 0 1.27397E-4
10-111893090-A-G p.His580Arg missense ADD3 2 82786 2.41587E-5 41393 0 1.63765E-5
10-111893095-C-CT p.Phe583fs frameshift ADD3 2 82796 2.41558E-5 41398 0 NA
10-111893103-C-T p.Ser584Ser synonymous ADD3 33 82922 3.97964E-4 41461 0 8.28236E-4
10-111893106-G-C p.Lys585Asn missense ADD3 1 82934 1.20578E-5 41467 0 4.05541E-6
10-111893112-C-A p.Phe587Leu missense ADD3 2 82970 2.41051E-5 41485 0 NA
10-111893121-G-T p.Met590Ile missense ADD3 1 83006 1.20473E-5 41503 0 NA
10-111893124-AG-CT p.GluVal591AspLeu missense ADD3 1 83046 1.20415E-5 41523 0 NA
10-111893128-C-G p.Pro593Ala missense ADD3 2 83062 2.40784E-5 41531 0 1.1967E-5
10-111893133-C-T p.Val594Val synonymous ADD3 26 83120 3.12801E-4 41560 0 3.50274E-4
10-111893136-GGTA-G p.Val597del conservative_inframe_deletion ADD3 2 83128 2.40593E-5 41564 0 9.55536E-5
10-111893136-G-A p.Met595Ile missense ADD3 1 83128 1.20296E-5 41564 0 8.24307E-6
10-111893160-G-C p.Met603Ile missense ADD3 700 83196 0.00841387 41598 15 0.0171689
10-111893161-C-T p.His604Tyr missense ADD3 3 83218 3.60499E-5 41609 0 4.37623E-5
10-111893173-G-A p.Asp608Asn missense ADD3 1 83240 1.20135E-5 41620 0 NA
10-111893189-G-A p.Arg613Gln missense ADD3 32 83248 3.84394E-4 41624 0 1.43206E-4
10-111893195-G-A p.Ser615Asn missense ADD3 1 83236 1.2014E-5 41618 0 NA
10-111893205-CACAAGT-C p.Ser620_Thr621del disruptive_inframe_deletion ADD3 2 83250 2.4024E-5 41625 1 NA
10-111893206-A-G p.Thr619Ala missense ADD3 1 83250 1.2012E-5 41625 0 NA
10-111893219-T-C p.Ile623Thr missense ADD3 2 83252 2.40234E-5 41626 0 7.95596E-6
10-111893227-A-G p.Ile626Val missense ADD3 1 83252 1.20117E-5 41626 0 3.97791E-6
10-111893229-C-T p.Ile626Ile synonymous ADD3 1 83256 1.20111E-5 41628 0 3.18756E-5
10-111893230-G-C p.Glu627Gln missense ADD3 2 83252 2.40234E-5 41626 0 1.64938E-5
10-111893240-T-A p.Ile630Asn missense ADD3 2 83248 2.40246E-5 41624 0 7.95729E-6
10-111893240-T-G p.Ile630Ser missense ADD3 1 83248 1.20123E-5 41624 0 NA
10-111893256-A-C p.Lys635Asn missense ADD3 6 83236 7.20842E-5 41618 0 8.25505E-5
10-111893259-C-T p.Ile636Ile synonymous ADD3 11 83230 1.32164E-4 41615 0 7.16526E-5
10-111893259-C-A p.Ile636Ile synonymous ADD3 2 83230 2.40298E-5 41615 0 6.25E-4
10-111893260-G-A p.Glu637Lys missense ADD3 1 83224 1.20158E-5 41612 0 7.9609E-6
10-111893273-C-T p.Ser641Leu missense ADD3 1 83194 1.20201E-5 41597 0 3.98273E-6
10-111893279-A-T p.Glu643Val missense ADD3 1 83180 1.20221E-5 41590 0 3.98391E-6
10-111893297-C-T p.Ser649Leu missense ADD3 2 83108 2.40651E-5 41554 0 8.28432E-6
10-111893298-G-A p.Ser649Ser synonymous ADD3 2 83088 2.40709E-5 41544 0 1.65736E-5
10-111893301-A-G p.Pro650Pro synonymous ADD3 2 83090 2.40703E-5 41545 0 NA
10-111893323-C-T p.Arg658Cys missense ADD3 2 82980 2.41022E-5 41490 0 8.33556E-6
10-111893324-G-A p.Arg658His missense ADD3 2 82954 2.41097E-5 41477 0 5.03525E-4
10-111893324-G-T p.Arg658Leu missense ADD3 2 82954 2.41097E-5 41477 0 8.33709E-6
10-111893329-CCTT-C p.Ser661del disruptive_inframe_deletion ADD3 3 82928 3.6176E-5 41464 0 1.26908E-5
10-111893346-GA-G p.Asn666fs frameshift ADD3 3 82770 3.6245E-5 41385 0 8.4478E-6
10-111893349-C-CA p.Glu670fs frameshift ADD3 27 82742 3.26316E-4 41371 0 1.96434E-4
10-111893349-C-T p.Asn666Asn synonymous ADD3 1 82758 1.20834E-5 41379 0 NA
10-111893350-A-C p.Lys667Gln missense ADD3 3 82740 3.62582E-5 41370 0 8.53475E-6
10-111893355-AAAG-A p.Lys669del conservative_inframe_deletion ADD3 2 82718 2.41785E-5 41359 0 3.18451E-5
10-111893356-A-T p.Lys669* stop_gained ADD3 3 82718 3.62678E-5 41359 0 8.51238E-6
10-111893361-GAA-G p.Lys671fs frameshift ADD3 1 82652 1.20989E-5 41326 0 NA
10-111893371-G-T p.Ala674Ser missense ADD3 2 82544 2.42295E-5 41272 0 NA
10-111894088-C-A c.*712C>A splice_region ADD3 1 44738 2.23524E-5 22369 0 9.82077E-4
10-111895322-T-C c.*1946T>C splice_region ADD3 16 44362 3.60669E-4 22181 1 4.77768E-4
10-111895323-A-G c.*1947A>G splice_region ADD3 4 44354 9.01835E-5 22177 0 NA