Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
4-2877619-G-C c.-20-4G>C splice_region ADD1 2 82784 2.41593E-5 41392 0 NA
4-2877643-A-G p.Met1? start_lost ADD1 1 83236 1.2014E-5 41618 0 NA
4-2877655-T-C p.Ser5Pro missense ADD1 1 83286 1.20068E-5 41643 0 8.42545E-6
4-2877656-C-G p.Ser5Cys missense ADD1 1 83290 1.20062E-5 41645 0 NA
4-2877658-C-T p.Arg6Cys missense ADD1 41 83292 4.92244E-4 41646 0 0.00112542
4-2877665-C-T p.Ala8Val missense ADD1 14 83320 1.68027E-4 41660 0 1.35408E-4
4-2877670-G-A p.Val10Met missense ADD1 3 83336 3.59988E-5 41668 0 3.32452E-5
4-2877674-C-G p.Thr11Ser missense ADD1 1 83348 1.19979E-5 41674 0 NA
4-2877684-C-T p.Pro14Pro synonymous ADD1 8 83368 9.59601E-5 41684 0 9.55536E-5
4-2877686-C-T p.Pro15Leu missense ADD1 2 83362 2.39917E-5 41681 0 3.58983E-5
4-2877687-G-T p.Pro15Pro synonymous ADD1 152 83362 0.00182337 41681 2 0.0105847
4-2877687-G-A p.Pro15Pro synonymous ADD1 4 83368 4.798E-5 41684 0 8.26446E-6
4-2877700-C-G p.His20Asp missense ADD1 2 83372 2.39889E-5 41686 0 NA
4-2877708-G-A p.Glu22Glu synonymous ADD1 1 83376 1.19939E-5 41688 0 NA
4-2877711-G-A p.Arg23Arg synonymous ADD1 2 83372 2.39889E-5 41686 0 7.96014E-6
4-2877717-C-T p.Phe25Phe synonymous ADD1 2 83376 2.39877E-5 41688 0 1.99013E-5
4-2877718-G-A p.Asp26Asn missense ADD1 2 83372 2.39889E-5 41686 0 5.03525E-4
4-2877723-A-C p.Arg27Arg synonymous ADD1 1 83382 1.1993E-5 41691 0 7.95716E-6
4-2877740-C-T p.Pro33Leu missense ADD1 4 83378 4.79743E-5 41689 0 1.23318E-4
4-2877751-A-G p.Arg37Gly missense ADD1 1 83390 1.19918E-5 41695 0 NA
4-2877757-A-G p.Arg39Gly missense ADD1 1 83384 1.19927E-5 41692 0 NA
4-2877764-TGG-T p.Met41fs frameshift ADD1 1 83384 1.19927E-5 41692 0 NA
4-2877769-CCAG-C p.Pro43_Asp44delinsHis disruptive_inframe_deletion ADD1 1 83386 1.19924E-5 41693 0 NA
4-2877771-A-G p.Pro43Pro synonymous ADD1 98 83384 0.00117529 41692 0 0.00554435
4-2877771-A-C p.Pro43Pro synonymous ADD1 3 83386 3.59773E-5 41693 0 1.64791E-5
4-2877782-A-T p.Gln47Leu missense ADD1 1 83382 1.1993E-5 41691 0 8.24158E-6
4-2877783-G-GATTCTCGTGCTGCGGTGGT p.Asp48fs frameshift ADD1 1 83382 1.1993E-5 41691 0 NA
4-2877785-A-G p.Asp48Gly missense ADD1 1 83384 1.19927E-5 41692 0 NA
4-2877791-A-G p.Asn50Ser missense ADD1 2 83382 2.3986E-5 41691 0 8.24824E-6
4-2877796-A-G p.Met52Val missense ADD1 1 83382 1.1993E-5 41691 0 1.19384E-5
4-2877816-G-A p.Val58Val synonymous ADD1 7 83350 8.39832E-5 41675 0 1.65997E-5
4-2877845-G-C c.195+8G>C splice_region ADD1 1 83256 1.20111E-5 41628 0 NA
4-2883622-T-C c.196-3T>C splice_region ADD1 1 83048 1.20412E-5 41524 0 NA
4-2883626-C-T p.Ala66Val missense+splice_region ADD1 2 83046 2.4083E-5 41523 0 NA
4-2883626-C-G p.Ala66Gly missense+splice_region ADD1 2 83046 2.4083E-5 41523 0 1.7092E-5
4-2883635-A-C p.Glu69Ala missense ADD1 1 83028 1.20441E-5 41514 0 5.01622E-5
4-2883669-G-GGAAACATTC p.Lys80_Lys81insGluThrPhe conservative_inframe_insertion ADD1 1 83200 1.20192E-5 41600 0 NA
4-2883681-C-T p.Asn84Asn synonymous ADD1 1 83220 1.20163E-5 41610 0 NA
4-2883689-G-A p.Gly87Asp missense ADD1 1 83234 1.20143E-5 41617 0 3.99275E-6
4-2883711-T-A p.Ile94Ile synonymous ADD1 1 83200 1.20192E-5 41600 0 8.25914E-6
4-2883712-G-A p.Ala95Thr missense ADD1 2 83196 2.40396E-5 41598 0 8.25996E-6
4-2883721-A-G p.Met98Val missense ADD1 1 83164 1.20244E-5 41582 0 NA
4-2883727-A-G p.Thr100Ala missense ADD1 2 83134 2.40575E-5 41567 0 NA
4-2883731-A-G p.Asn101Ser missense ADD1 6 83116 7.21883E-5 41558 0 2.54728E-4
4-2883747-C-T p.Tyr106Tyr synonymous ADD1 1 83024 1.20447E-5 41512 0 NA
4-2883754-G-C p.Ala109Pro missense ADD1 1 82932 1.20581E-5 41466 0 3.1837E-5
4-2883758-C-T p.Pro110Leu missense ADD1 1 82884 1.20651E-5 41442 0 1.2178E-5
4-2883759-G-A p.Pro110Pro synonymous ADD1 1 82858 1.20688E-5 41429 0 3.1835E-5
4-2883768-G-A p.Gly113Gly synonymous ADD1 2 82726 2.41762E-5 41363 0 4.14463E-6
4-2883787-A-AGTCTTGGTATG c.358_358+1insGTCTTGGTATG splice_donor ADD1 2 82268 2.43108E-5 41134 1 NA
4-2886235-A-T c.359-7A>T splice_region ADD1 1 82648 1.20995E-5 41324 0 1.44381E-4
4-2886250-A-G p.Met123Val missense ADD1 1 82938 1.20572E-5 41469 0 NA
4-2886271-C-T p.Leu130Phe missense ADD1 2 83232 2.40292E-5 41616 0 3.99671E-6
4-2886293-C-T p.Ala137Val missense ADD1 1 83248 1.20123E-5 41624 0 NA
4-2886294-G-A p.Ala137Ala splice_region+synonymous ADD1 26 83250 3.12312E-4 41625 0 1.63392E-4
4-2886300-C-T p.Asp139Asp synonymous ADD1 2 83272 2.40177E-5 41636 0 NA
4-2886304-G-C p.Gly141Arg missense ADD1 1 83278 1.2008E-5 41639 0 3.98229E-6
4-2886320-G-A p.Arg146Gln missense ADD1 1 83274 1.20085E-5 41637 0 NA
4-2886337-T-C p.Phe152Leu missense ADD1 3 83284 3.60213E-5 41642 0 1.19592E-5
4-2886340-T-C p.Tyr153His missense ADD1 1 83280 1.20077E-5 41640 0 NA
4-2886359-T-C p.Phe159Ser missense ADD1 1 83142 1.20276E-5 41571 0 4.40278E-5
4-2886360-T-C p.Phe159Phe synonymous ADD1 2 83142 2.40552E-5 41571 0 8.24593E-6
4-2886367-T-A p.Ser162Thr missense ADD1 1 83096 1.20343E-5 41548 0 6.3674E-5
4-2886381-C-T p.Tyr166Tyr synonymous ADD1 12 83018 1.44547E-4 41509 0 9.55049E-5
4-2886383-A-G p.Asn167Ser missense ADD1 3 83054 3.61211E-5 41527 0 5.03525E-4
4-2895732-C-T c.511-8C>T splice_region ADD1 2 83290 2.40125E-5 41645 0 NA
4-2895754-C-T p.Ser175Ser synonymous ADD1 3 83358 3.59893E-5 41679 0 6.37227E-5
4-2895755-G-A p.Glu176Lys missense ADD1 1 83362 1.19959E-5 41681 0 5.03525E-4
4-2895758-C-G p.Gln177Glu missense ADD1 1 83370 1.19947E-5 41685 0 6.36821E-5
4-2895764-C-T p.His179Tyr missense ADD1 2 83370 2.39894E-5 41685 0 NA
4-2895765-A-G p.His179Arg missense ADD1 1 83370 1.19947E-5 41685 0 NA
4-2895801-A-G p.Glu191Gly missense ADD1 1 83372 1.19944E-5 41686 0 NA
4-2895827-A-C c.591+7A>C splice_region ADD1 1 83320 1.20019E-5 41660 0 3.18431E-5
4-2895828-T-G c.591+8T>G splice_region ADD1 10 83320 1.20019E-4 41660 0 2.86569E-4
4-2896309-G-T p.Val198Phe missense+splice_region ADD1 2 81010 2.46883E-5 40505 0 NA
4-2896315-A-G p.Ile200Val missense ADD1 4 81266 4.92211E-5 40633 0 NA
4-2896328-G-T p.Gly204Val missense ADD1 2 81764 2.44606E-5 40882 0 1.66417E-5
4-2896329-A-T p.Gly204Gly synonymous ADD1 2 81790 2.44529E-5 40895 0 1.66398E-5
4-2896375-G-A p.Gly220Ser missense ADD1 1 82302 1.21504E-5 41151 0 6.25E-4
4-2896380-C-A p.Phe221Leu missense ADD1 2 82406 2.42701E-5 41203 0 NA
4-2896383-C-T p.Thr222Thr synonymous ADD1 1 82448 1.21289E-5 41224 0 4.06772E-6
4-2896394-C-T p.Ala226Val missense ADD1 1 82522 1.2118E-5 41261 0 3.19366E-5
4-2896395-A-G p.Ala226Ala synonymous ADD1 1 82538 1.21156E-5 41269 0 NA
4-2896403-C-T p.Ala229Val missense ADD1 1 82562 1.21121E-5 41281 0 NA
4-2896408-C-T p.Arg231Cys missense ADD1 17 82628 2.05741E-4 41314 0 1.56867E-4
4-2896410-C-A c.*320C>A splice_region ADD1 25 82634 3.02539E-4 41317 0 1.59765E-4
4-2896412-C-T p.Pro232Leu missense ADD1 1 82632 1.21018E-5 41316 0 5.04032E-4
4-2896416-C-T p.Asp233Asp synonymous ADD1 3 82638 3.63029E-5 41319 0 3.19244E-5
4-2896419-G-A p.Val234Val synonymous ADD1 346 82602 0.00418876 41301 2 0.00865041
4-2896419-G-T p.Val234Val synonymous ADD1 1 82610 1.21051E-5 41305 0 8.26037E-6
4-2896425-C-T p.Cys236Cys synonymous ADD1 1320 82426 0.0160144 41213 23 0.0352467
4-2896426-G-A p.Val237Ile missense ADD1 8 82450 9.70285E-5 41225 0 2.23442E-4
4-2896428-C-G p.Val237Val synonymous ADD1 6 82440 7.27802E-5 41220 0 2.47979E-5
4-2896428-C-T p.Val237Val synonymous ADD1 1 82440 1.213E-5 41220 0 NA
4-2896429-G-A p.Val238Met missense ADD1 2 82384 2.42766E-5 41192 0 3.34907E-5
4-2896444-C-A p.Pro243Thr missense ADD1 1 82172 1.21696E-5 41086 0 NA
4-2896448-C-T p.Ala244Val missense ADD1 5 82180 6.08421E-5 41090 0 8.62565E-4
4-2899907-C-G c.742-4C>G splice_region ADD1 1 83296 1.20054E-5 41648 0 3.98979E-6
4-2899907-C-T c.742-4C>T splice_region ADD1 1 83296 1.20054E-5 41648 0 NA
4-2899927-G-C p.Cys253Ser missense ADD1 1 83340 1.1999E-5 41670 0 8.24593E-6
4-2899941-A-G p.Ile258Val missense ADD1 3 83364 3.59868E-5 41682 0 1.1538E-4
4-2899948-C-A p.Pro260Gln missense ADD1 3 83364 3.59868E-5 41682 0 3.18451E-5
4-2899953-G-T p.Ala262Ser missense ADD1 5 83366 5.99765E-5 41683 0 1.98855E-5
4-2899955-G-A p.Ala262Ala synonymous ADD1 1 83366 1.19953E-5 41683 0 1.19309E-5
4-2899962-C-T p.Leu265Phe missense ADD1 1 83370 1.19947E-5 41685 0 NA
4-2899983-G-T p.Asp272Tyr missense ADD1 3 83364 3.59868E-5 41682 0 NA
4-2899990-A-G p.His274Arg missense ADD1 2 83374 2.39883E-5 41687 0 7.95317E-6
4-2899995-A-G p.Ile276Val missense ADD1 2 83370 2.39894E-5 41685 0 2.4717E-5
4-2899998-C-G p.Leu277Val missense ADD1 1 83366 1.19953E-5 41683 0 1.6478E-5
4-2900000-G-C p.Leu277Leu synonymous ADD1 1 83368 1.1995E-5 41684 0 NA
4-2900001-G-A p.Val278Ile missense ADD1 1 83368 1.1995E-5 41684 0 NA
4-2900006-T-C p.Asp279Asp synonymous ADD1 143 83358 0.00171549 41679 2 0.00805639
4-2900013-G-A p.Glu282Lys missense ADD1 1 83350 1.19976E-5 41675 0 1.64794E-5
4-2900015-A-G p.Glu282Glu synonymous ADD1 1 83356 1.19967E-5 41678 0 1.64791E-5
4-2900041-G-T p.Gly291Val missense ADD1 1 83330 1.20005E-5 41665 0 3.18512E-5
4-2900052-AAGGTCAGTAGGCATCTAATCTGGTATTTAAATTACAGCAGAAAGAAGAATAAAGCAAAGGACCAGTCTTCCTGCCCAGCTCCACAGAGCATTCATGCTTCCCCTC-A p.Val296fs frameshift ADD1 3 83330 3.60014E-5 41665 1 NA
4-2900058-A-G c.885+4A>G splice_region ADD1 2 83312 2.40061E-5 41656 0 3.57992E-5
4-2900166-A-G p.Ile298Val missense ADD1 1 83256 1.20111E-5 41628 0 NA
4-2900173-G-A p.Arg300Gln missense ADD1 2 83274 2.40171E-5 41637 0 5.03525E-4
4-2900186-C-G p.Leu304Leu synonymous ADD1 3 83290 3.60187E-5 41645 0 3.97744E-6
4-2900187-G-A p.Val305Met missense ADD1 11 83286 1.32075E-4 41643 0 6.36862E-5
4-2900187-G-C p.Val305Leu missense ADD1 2 83288 2.40131E-5 41644 0 1.19327E-5
4-2900187-G-T p.Val305Leu missense ADD1 1 83288 1.20065E-5 41644 0 3.97757E-6
4-2900194-T-C p.Val307Ala missense ADD1 2 83288 2.40131E-5 41644 0 3.18512E-5
4-2900201-G-A p.Glu309Glu synonymous ADD1 1 83290 1.20062E-5 41645 0 NA
4-2900202-A-T p.Ser310Cys missense ADD1 2 83288 2.40131E-5 41644 0 NA
4-2900204-C-T p.Ser310Ser synonymous ADD1 2 83278 2.40159E-5 41639 0 1.6475E-5
4-2900205-G-A p.Val311Ile missense ADD1 1 83276 1.20083E-5 41638 0 3.1816E-5
4-2900206-T-C p.Val311Ala missense ADD1 1 83280 1.20077E-5 41640 0 NA
4-2900219-C-G p.Phe315Leu missense ADD1 3 83292 3.60179E-5 41646 0 7.95374E-6
4-2900221-A-T p.Tyr316Phe missense ADD1 1 83294 1.20057E-5 41647 0 1.64753E-5
4-2900224-A-C p.Tyr317Ser missense ADD1 2 83294 2.40113E-5 41647 0 NA
4-2900978-T-C c.985-8T>C splice_region ADD1 6 83238 7.20825E-5 41619 0 4.0542E-6
4-2900999-C-A p.Ala333Asp missense ADD1 1 83354 1.1997E-5 41677 0 6.36983E-5
4-2901015-A-G p.Pro338Pro synonymous ADD1 1 83378 1.19936E-5 41689 0 3.1837E-5
4-2901047-A-G p.Tyr349Cys missense ADD1 1 83388 1.19921E-5 41694 0 8.23886E-6
4-2901061-C-T p.Arg354Cys missense ADD1 1 83388 1.19921E-5 41694 0 6.76089E-5
4-2901070-G-C p.Gly357Arg missense ADD1 1 83384 1.19927E-5 41692 0 8.23927E-6
4-2901077-C-T p.Pro359Leu missense ADD1 1 83374 1.19941E-5 41687 0 8.23968E-6
4-2901082-G-C p.Gly361Arg missense ADD1 1 83382 1.1993E-5 41691 0 NA
4-2901088-G-T p.Gly363Cys missense ADD1 5 83372 5.99722E-5 41686 0 6.36943E-5
4-2901098-C-T p.Ser366Leu missense ADD1 3 83350 3.59928E-5 41675 0 1.64845E-5
4-2901099-G-A p.Ser366Ser synonymous ADD1 2 83328 2.40015E-5 41664 0 2.47276E-5
4-2901099-G-T p.Ser366Ser synonymous ADD1 2 83328 2.40015E-5 41664 0 1.64851E-5
4-2901103-C-G p.Pro368Ala missense ADD1 3 83338 3.5998E-5 41669 0 NA
4-2901107-A-G p.Lys369Arg missense ADD1 4 83322 4.80065E-5 41661 0 4.94641E-5
4-2901109-T-C p.Trp370Arg missense ADD1 5 83322 6.00082E-5 41661 0 9.55171E-5
4-2901143-T-C p.Met381Thr missense ADD1 1 83156 1.20256E-5 41578 0 NA
4-2901153-C-T p.Leu384Leu synonymous ADD1 58 82908 6.99571E-4 41454 1 5.46479E-4
4-2901161-T-G p.Leu387Arg missense+splice_region ADD1 2 82700 2.41838E-5 41350 0 NA
4-2901167-G-A c.1161+5G>A splice_region ADD1 1 82588 1.21083E-5 41294 0 NA
4-2901169-A-G c.1161+7A>G splice_region ADD1 1 82568 1.21112E-5 41284 0 8.41241E-6
4-2901503-C-G n.1568C>G splice_region ADD1 45 9882 0.00455373 4941 0 0.0055092
4-2906484-A-T c.1162-7A>T splice_region ADD1 1 82982 1.20508E-5 41491 0 1.65412E-5
4-2906502-T-C p.Thr391Thr synonymous ADD1 2 83000 2.40964E-5 41500 0 8.2428E-6
4-2906516-G-A p.Arg396Gln missense ADD1 6 83118 7.21865E-5 41559 1 7.95931E-6
4-2906523-T-A p.Pro398Pro synonymous ADD1 142 83174 0.00170726 41587 2 0.00805639
4-2906540-C-G p.Ser404Cys missense ADD1 2 83264 2.402E-5 41632 0 NA
4-2906552-G-A p.Ser408Asn missense ADD1 1 83298 1.20051E-5 41649 0 3.18552E-5
4-2906553-C-T p.Ser408Ser synonymous ADD1 1 83290 1.20062E-5 41645 0 5.03525E-4
4-2906556-T-G p.Asp409Glu missense ADD1 1 83290 1.20062E-5 41645 0 3.18492E-5
4-2906562-G-T p.Glu411Asp missense ADD1 1 83276 1.20083E-5 41638 0 1.64747E-5
4-2906580-A-T p.Thr417Thr synonymous ADD1 1 83250 1.2012E-5 41625 0 NA
4-2906582-G-A p.Gly418Asp missense ADD1 1 83234 1.20143E-5 41617 0 8.23737E-6
4-2906585-A-C p.Tyr419Ser missense ADD1 1 83234 1.20143E-5 41617 0 NA
4-2906587-T-A p.Ser420Thr missense ADD1 5 83238 6.00687E-5 41619 0 NA
4-2906601-C-T p.Asp424Asp synonymous ADD1 6 83242 7.2079E-5 41621 0 3.29506E-5
4-2906602-G-A p.Gly425Ser missense ADD1 4 83244 4.80515E-5 41622 0 6.76229E-5
4-2906609-C-T p.Ser427Leu missense ADD1 1 83240 1.20135E-5 41620 0 1.19333E-5
4-2906610-G-A p.Ser427Ser synonymous ADD1 1 83232 1.20146E-5 41616 0 3.97782E-6
4-2906615-C-G p.Thr429Ser missense ADD1 4 83240 4.80538E-5 41620 0 1.59215E-4
4-2906622-C-T p.Ser431Ser synonymous ADD1 2 83240 2.40269E-5 41620 0 NA
4-2906624-C-G p.Pro432Arg missense ADD1 1 83244 1.20129E-5 41622 0 3.97779E-6
4-2906630-G-A p.Arg434Lys missense ADD1 1 83268 1.20094E-5 41634 0 NA
4-2906649-G-T p.Gln440His missense ADD1 1 83264 1.201E-5 41632 0 NA
4-2906652-G-T p.Gln441His missense ADD1 1 83264 1.201E-5 41632 0 NA
4-2906661-G-C p.Lys444Asn missense ADD1 1 83290 1.20062E-5 41645 0 NA
4-2906665-A-G p.Arg446Gly missense ADD1 2 83294 2.40113E-5 41647 0 2.05948E-4
4-2906684-G-A p.Arg452Gln missense ADD1 3 83276 3.60248E-5 41638 0 3.18228E-5
4-2906689-G-A p.Asp454Asn missense ADD1 1 83272 1.20088E-5 41636 0 4.37529E-5
4-2906691-C-T p.Asp454Asp synonymous ADD1 143 83262 0.00171747 41631 2 0.00755287
4-2906692-G-A p.Glu455Lys missense ADD1 2 83278 2.40159E-5 41639 0 8.23805E-6
4-2906699-C-T p.Ser457Phe missense ADD1 1 83256 1.20111E-5 41628 0 NA
4-2906700-C-T p.Ser457Ser synonymous ADD1 1 83254 1.20114E-5 41627 0 3.18593E-5
4-2906701-G-A p.Glu458Lys missense ADD1 4 83230 4.80596E-5 41615 0 8.35415E-5
4-2906707-G-T p.Gly460Trp missense ADD1 13785 82870 0.166345 41435 1226 0.203237
4-2906716-G-A p.Gly463Arg missense ADD1 1 83120 1.20308E-5 41560 0 7.95805E-6
4-2906729-A-G p.Lys467Arg missense ADD1 1 83026 1.20444E-5 41513 0 3.98067E-6
4-2906732-C-T p.Ser468Leu missense ADD1 1 82966 1.20531E-5 41483 0 3.18532E-5
4-2906733-G-A p.Ser468Ser synonymous ADD1 2 82962 2.41074E-5 41481 0 8.2375E-6
4-2906750-C-T p.Thr474Met missense ADD1 2 82808 2.41523E-5 41404 0 3.98613E-6
4-2906758-A-G p.Thr477Ala missense ADD1 2 82720 2.41779E-5 41360 0 NA
4-2906769-C-T p.His480His synonymous ADD1 1 82578 1.21098E-5 41289 0 NA
4-2906770-G-A p.Val481Met missense ADD1 1 82544 1.21148E-5 41272 0 2.4715E-5
4-2906794-T-C p.Ser489Pro missense ADD1 1 82144 1.21737E-5 41072 0 NA
4-2906796-G-A p.Ser489Ser synonymous ADD1 2 82002 2.43896E-5 41001 0 5.05051E-4
4-2906799-C-T p.Ser490Ser synonymous ADD1 39 82064 4.75239E-4 41032 0 8.28184E-4
4-2906800-G-A p.Gly491Ser missense ADD1 1 82040 1.21892E-5 41020 0 8.24416E-6
4-2906825-C-G p.Thr499Ser missense ADD1 1 81706 1.2239E-5 40853 0 NA
4-2906828-A-G p.Asn500Ser missense ADD1 5 81650 6.1237E-5 40825 0 4.81692E-5
4-2909493-A-C p.Arg510Ser missense ADD1 1 83258 1.20109E-5 41629 0 NA
4-2909504-C-G p.Ser514Cys missense ADD1 2 83288 2.40131E-5 41644 0 3.9763E-6
4-2909507-C-G p.Ala515Gly missense ADD1 1 83292 1.2006E-5 41646 0 3.97633E-6
4-2909519-T-A p.Leu519Gln missense ADD1 2 83298 2.40102E-5 41649 0 8.23655E-6
4-2909544-A-G p.Pro527Pro synonymous ADD1 2 83270 2.40183E-5 41635 0 0.00100908
4-2909575-C-T c.1608+4C>T splice_region ADD1 14 82994 1.68687E-4 41497 0 1.40079E-4
4-2910234-A-G c.1609-8A>G splice_region ADD1 2 83272 2.40177E-5 41636 0 3.18817E-5
4-2910235-C-A c.1609-7C>A splice_region ADD1 1 83284 1.20071E-5 41642 0 8.25491E-6
4-2910253-G-T p.Gln540His missense ADD1 1 83336 1.19996E-5 41668 0 NA
4-2910259-A-G p.Leu542Leu synonymous ADD1 1 83342 1.19988E-5 41671 0 NA
4-2910265-C-T p.Asp544Asp synonymous ADD1 3 83336 3.59988E-5 41668 0 3.18134E-4
4-2910266-A-G p.Ile545Val missense ADD1 4 83342 4.7995E-5 41671 0 6.25E-4
4-2910285-A-G p.Gln551Arg missense ADD1 1 83364 1.19956E-5 41682 0 NA
4-2910291-A-G p.Gln553Arg missense ADD1 1 83354 1.1997E-5 41677 0 NA
4-2910308-G-A p.Val559Met missense ADD1 342 83342 0.00410357 41671 0 0.00553877
4-2910323-C-T p.Leu564Phe missense ADD1 4 83338 4.79973E-5 41669 0 4.12242E-5
4-2910325-C-T p.Leu564Leu synonymous ADD1 2 83334 2.39998E-5 41667 0 3.1841E-5
4-2911065-G-A c.1606-1G>A splice_acceptor ADD1 2 77632 2.57626E-5 38816 0 NA
4-2911072-C-T p.Pro538Ser missense ADD1 1 77656 1.28773E-5 38828 0 6.04888E-5
4-2911079-C-G p.Ser540Cys missense ADD1 2 77654 2.57553E-5 38827 0 6.04668E-5
4-2911089-G-A p.Thr543Thr synonymous ADD1 1 77666 1.28756E-5 38833 0 3.18695E-5
4-2911096-A-T p.Ile546Phe missense ADD1 2 77670 2.575E-5 38835 0 NA
4-2911099-G-A p.Glu547Lys missense ADD1 2 77678 2.57473E-5 38839 0 6.25E-4
4-2911117-G-A p.Glu553Lys missense ADD1 8 77680 1.02987E-4 38840 0 3.18593E-4
4-2911134-C-T p.Pro558Pro synonymous ADD1 15 77668 1.9313E-4 38834 0 3.62889E-4
4-2911143-T-C p.Ser561Ser synonymous ADD1 510 77652 0.00656776 38826 11 0.0134894
4-2911156-A-G p.Lys566Glu missense+splice_region ADD1 1 77626 1.28823E-5 38813 0 NA
4-2911162-C-T c.1698+4C>T splice_region ADD1 1 77618 1.28836E-5 38809 0 6.0518E-5
4-2916603-A-G c.1699-8A>G splice_region ADD1 1 82832 1.20726E-5 41416 0 8.70989E-6
4-2916625-G-A p.Thr571Thr synonymous ADD1 1 83038 1.20427E-5 41519 0 4.01729E-6
4-2916631-C-T p.Ser573Ser synonymous ADD1 1 83108 1.20325E-5 41554 0 NA
4-2916664-C-T p.His584His synonymous ADD1 2 83214 2.40344E-5 41607 0 4.95802E-5
4-2916665-G-A p.Val585Ile missense ADD1 1 83208 1.20181E-5 41604 0 3.18451E-5
4-2916668-A-G p.Ile586Val missense ADD1 1 83214 1.20172E-5 41607 0 NA
4-2916680-A-G p.Thr590Ala missense ADD1 1 83178 1.20224E-5 41589 0 NA
4-2916681-C-T p.Thr590Met missense ADD1 5 83180 6.01106E-5 41590 0 1.653E-5
4-2916682-G-A p.Thr590Thr synonymous ADD1 7 83164 8.4171E-5 41582 0 6.25E-4
4-2916693-C-T p.Pro594Leu missense ADD1 1 83128 1.20296E-5 41564 0 8.26925E-6
4-2916710-G-T p.Asp600Tyr missense ADD1 1 83028 1.20441E-5 41514 0 NA
4-2916713-C-T p.Arg601Cys missense ADD1 2 82984 2.4101E-5 41492 0 1.65931E-5
4-2916714-G-A p.Arg601His missense ADD1 16 82992 1.9279E-4 41496 0 6.3674E-5
4-2916731-C-A p.Arg607Ser missense ADD1 1 82852 1.20697E-5 41426 0 NA
4-2916731-C-T p.Arg607Cys missense ADD1 3 82852 3.62091E-5 41426 0 6.79163E-5
4-2916732-G-A p.Arg607His missense ADD1 1 82846 1.20706E-5 41423 0 8.37802E-6
4-2916745-G-T p.Glu611Asp missense ADD1 2 82638 2.42019E-5 41319 0 NA
4-2916748-G-A p.Arg612Arg synonymous ADD1 16 82578 1.93756E-4 41289 0 9.55231E-5
4-2916762-C-G p.Ser617Cys missense ADD1 13524 81304 0.166339 40652 1091 0.213596
4-2916767-G-GAGAATCTGGACGA c.1855_1855+1insAGAATCTGGACGA splice_donor ADD1 1 82150 1.21729E-5 41075 0 NA
4-2927751-C-T p.Thr39Met missense ADD1 7 83176 8.41589E-5 41588 0 4.17077E-5
4-2927752-G-A p.Glu623Lys missense ADD1 3 83184 3.60646E-5 41592 0 3.33467E-5
4-2927756-C-G p.Ala624Gly missense ADD1 1 83218 1.20166E-5 41609 0 3.98035E-6
4-2927759-G-A p.Arg625Lys missense ADD1 3 83234 3.6043E-5 41617 0 1.91229E-4
4-2927761-G-A p.Glu626Lys missense ADD1 49 83226 5.88758E-4 41613 0 5.41539E-4
4-2927766-G-A p.Arg44Lys missense ADD1 2 83230 2.40298E-5 41615 0 1.6605E-5
4-2927773-A-G p.Lys630Glu missense ADD1 1 83260 1.20106E-5 41630 0 2.48954E-5
4-2927788-C-G p.Gln635Glu missense ADD1 9 83216 1.08152E-4 41608 0 1.91229E-4
4-2927790-G-T p.Gln635His missense ADD1 1 83198 1.20195E-5 41599 0 3.18695E-5
4-2927795-C-T p.Ala637Val missense ADD1 2 83140 2.40558E-5 41570 0 2.78702E-5
4-2927796-G-A p.Arg54Gln missense ADD1 2 83156 2.40512E-5 41578 0 3.18776E-5
4-2927803-C-T p.His640Tyr missense ADD1 1 83076 1.20372E-5 41538 0 1.59293E-5
4-2927807-C-T p.Pro641Leu missense ADD1 2 83060 2.4079E-5 41530 0 3.32745E-5
4-2927808-G-A p.Arg58His missense ADD1 2 83062 2.40784E-5 41531 0 1.59317E-5
4-2927809-C-T p.Pro642Ser missense ADD1 6 83064 7.22335E-5 41532 0 9.55901E-5
4-2927812-C-G p.Pro643Ala missense ADD1 1 83062 1.20392E-5 41531 0 NA
4-2927819-C-G p.Thr645Ser missense ADD1 1 82926 1.20589E-5 41463 0 NA
4-2927823-C-G p.Pro63Arg missense ADD1 33 82906 3.98041E-4 41453 0 3.82214E-4
4-2927842-G-A c.1954+3G>A splice_region ADD1 1 82240 1.21595E-5 41120 0 NA
4-2927862-C-T n.458C>T splice_region ADD1 12 81906 1.46509E-4 40953 0 4.77859E-4
4-2928005-A-G c.197-7A>G splice_region ADD1 1 63632 1.57154E-5 31816 0 7.15656E-6
4-2928009-C-T c.197-3C>T splice_region ADD1 1 62334 1.60426E-5 31167 0 7.21792E-6
4-2928044-G-A c.228+1G>A splice_donor ADD1 1 52162 1.9171E-5 26081 0 7.49895E-6
4-2928048-G-A c.228+5G>A splice_region ADD1 1 51520 1.94099E-5 25760 0 3.75991E-5
4-2928358-G-A c.1955-8G>A splice_region ADD1 10 83146 1.2027E-4 41573 0 9.56328E-5
4-2928367-A-C c.1955-2A>C splice_acceptor ADD1 3 83174 3.6069E-5 41587 0 NA
4-2928369-G-A p.Gly652Glu missense+splice_region ADD1 1 83178 1.20224E-5 41589 0 5.03525E-4
4-2928373-C-T p.Asp653Asp synonymous ADD1 1 83162 1.20247E-5 41581 0 2.57551E-5
4-2928379-C-T p.Cys655Cys synonymous ADD1 3 83168 3.60716E-5 41584 0 5.99603E-5
4-2928380-G-A p.Ala656Thr missense ADD1 1 83174 1.2023E-5 41587 0 8.55388E-6
4-2928383-A-G p.Arg657Gly missense ADD1 4 83178 4.80896E-5 41589 0 2.56196E-5
4-2928384-G-A p.Arg657Lys missense ADD1 1 83186 1.20213E-5 41593 0 NA
4-2929907-C-T p.Pro655Leu missense ADD1 4 83146 4.81081E-5 41573 0 4.77593E-5
4-2929908-G-A p.Arg72Gln missense ADD1 1 83152 1.20262E-5 41576 0 3.18796E-5
4-2929912-C-A p.Pro657Thr missense ADD1 2 83170 2.40471E-5 41585 0 8.24769E-6
4-2929914-G-A p.Arg74Gln missense ADD1 2 83204 2.40373E-5 41602 0 4.94731E-5
4-2929917-T-G p.Leu75Arg missense ADD1 1 83230 1.20149E-5 41615 0 NA
4-2929939-G-A p.Ala666Thr missense ADD1 2 83312 2.40061E-5 41656 0 3.18674E-5
4-2929940-C-T p.Ala666Val missense ADD1 2 83312 2.40061E-5 41656 0 9.56328E-5
4-2929942-A-G p.Thr667Ala missense ADD1 1 83318 1.20022E-5 41659 0 8.2375E-6
4-2929957-C-G p.Leu672Val missense ADD1 1 83328 1.20008E-5 41664 0 NA
4-2929962-C-T p.Pro90Leu missense ADD1 11 83344 1.31983E-4 41672 0 8.35103E-5
4-2929963-G-A p.Asp674Asn missense ADD1 2 83342 2.39975E-5 41671 0 1.59067E-5
4-2929964-A-T p.Asp674Val missense ADD1 1 83350 1.19976E-5 41675 0 8.23696E-6
4-2929987-G-A p.Glu682Lys missense ADD1 1 83336 1.19996E-5 41668 0 7.95267E-6
4-2929996-G-A p.Gly685Ser missense ADD1 4 83316 4.801E-5 41658 0 1.19293E-5
4-2930006-T-C p.Met688Thr missense ADD1 2 83304 2.40085E-5 41652 0 1.64804E-5
4-2930011-GAGA-G p.Lys691del conservative_inframe_deletion ADD1 1 83310 1.20034E-5 41655 0 NA
4-2930014-A-G p.Lys691Glu missense ADD1 24 83308 2.88088E-4 41654 0 0.00151057
4-2930017-G-A p.Glu692Lys missense ADD1 2 83286 2.40136E-5 41643 0 1.64886E-4
4-2930020-G-A p.Glu693Lys missense ADD1 1 83268 1.20094E-5 41634 0 5.77281E-5
4-2930025-A-G p.Glu694Glu synonymous ADD1 1 83280 1.20077E-5 41640 0 NA
4-2930026-G-A p.Ala695Thr missense ADD1 1 83262 1.20103E-5 41631 0 8.25123E-6
4-2930035-C-A p.Pro698Thr missense ADD1 1 83240 1.20135E-5 41620 0 3.97893E-6
4-2930035-C-T p.Pro698Ser missense ADD1 1 83240 1.20135E-5 41620 0 4.77471E-5
4-2930036-C-G p.Pro698Arg missense ADD1 18 83248 2.16221E-4 41624 0 0.001875
4-2930043-C-A p.Ser700Arg missense ADD1 4 83236 4.80561E-5 41618 0 NA
4-2930044-C-A p.Pro701Thr missense ADD1 2 83238 2.40275E-5 41619 0 3.18756E-5
4-2930046-C-CACTGAGGCCCCT p.Pro705_Ala708dup conservative_inframe_insertion ADD1 1 83230 1.20149E-5 41615 0 NA
4-2930053-G-T p.Ala704Ser missense ADD1 2 83178 2.40448E-5 41589 0 1.19626E-5
4-2930053-G-A p.Ala704Thr missense ADD1 2 83178 2.40448E-5 41589 0 1.65761E-5
4-2930055-C-T p.Ala704Ala synonymous ADD1 1 83188 1.2021E-5 41594 0 NA
4-2930061-T-C p.Thr706Thr synonymous ADD1 1 83164 1.20244E-5 41582 0 NA
4-2930064-GGCCAGCCCCGA-G p.Glu711fs frameshift ADD1 2 83156 2.40512E-5 41578 0 NA
4-2930065-G-C p.Ala708Pro missense ADD1 4 83122 4.8122E-5 41561 0 2.40211E-5
4-2930073-C-T c.*62C>T splice_region ADD1 1 83108 1.20325E-5 41554 0 4.41278E-5
4-2930074-G-A p.Glu711Lys missense ADD1 8 83112 9.62557E-5 41556 0 4.18753E-5
4-2930076-GCCAGCCCCAGAC-G p.Asp715_Pro718del disruptive_inframe_deletion ADD1 1 83102 1.20334E-5 41551 0 8.37717E-6
4-2930080-G-T p.Ala713Ser missense ADD1 1 83062 1.20392E-5 41531 0 1.20424E-5
4-2930082-C-T p.Ala713Ala synonymous ADD1 1 83082 1.20363E-5 41541 0 NA
4-2930088-C-T p.Asp715Asp synonymous ADD1 2 83058 2.40796E-5 41529 0 NA
4-2930092-GC-G p.Pro718fs frameshift ADD1 2 83006 2.40946E-5 41503 0 NA
4-2930094-C-G p.Ala717Ala synonymous ADD1 1 82992 1.20494E-5 41496 0 NA
4-2930095-C-G p.Pro718Ala missense ADD1 8 82980 9.64088E-5 41490 0 1.91339E-4
4-2930095-C-T p.Pro718Ser missense ADD1 3 82980 3.61533E-5 41490 0 1.91339E-4
4-2930096-C-T p.Pro718Leu missense ADD1 1 82972 1.20523E-5 41486 0 1.20698E-5
4-2930097-G-C p.Pro718Pro synonymous ADD1 1 82950 1.20555E-5 41475 0 NA
4-2930097-G-A p.Pro718Pro synonymous ADD1 2 82950 2.41109E-5 41475 0 5.03525E-4
4-2930107-G-A p.Glu722Lys missense ADD1 1 82924 1.20592E-5 41462 0 NA
4-2930113-G-A p.Ala724Thr missense ADD1 2 82842 2.41423E-5 41421 0 NA
4-2930114-C-T p.Ala724Val missense ADD1 1 82836 1.2072E-5 41418 0 6.25E-4
4-2930116-C-T p.Pro725Ser missense ADD1 2 82860 2.41371E-5 41430 0 8.41439E-6
4-2930117-C-T p.Pro725Leu missense ADD1 1 82870 1.20671E-5 41435 0 NA
4-2930124-T-TGTCGAGGAGGGGGCC p.Val728_Ala732dup disruptive_inframe_insertion ADD1 1 82738 1.20863E-5 41369 0 8.41595E-6
4-2930132-A-AGG p.Ala732fs frameshift ADD1 1 82714 1.20899E-5 41357 0 NA
4-2930139-C-T p.Ala732Ala synonymous ADD1 5 82790 6.03938E-5 41395 0 6.38529E-5
4-2930140-G-A p.Ala733Thr missense ADD1 1 82798 1.20776E-5 41399 0 3.19163E-5
4-2930142-C-T p.Ala733Ala synonymous ADD1 6 82840 7.24288E-5 41420 0 3.1902E-5
4-2930143-G-A p.Ala734Thr missense ADD1 7 82824 8.45166E-5 41412 0 0.00100705
4-2930144-C-T p.Ala734Val missense ADD1 9 82840 1.08643E-4 41420 0 1.84181E-4
4-2930145-G-A p.Ala734Ala synonymous ADD1 5 82894 6.0318E-5 41447 0 6.25E-4
4-2930154-C-T p.Gly737Gly synonymous ADD1 6 82934 7.23467E-5 41467 0 2.50325E-5
4-2930157-C-T p.Ser443Ser splice_region+synonymous ADD1 6 82930 7.23502E-5 41465 0 6.37999E-5
4-2930158-G-A p.Asp739Asn missense ADD1 13 82938 1.56744E-4 41469 0 7.25242E-4
4-2930166-TCCAGGCAAGTCC-T p.Gly743_Pro746del disruptive_inframe_deletion ADD1 1 82922 1.20595E-5 41461 0 NA
4-2930172-C-G p.Gly743Gly synonymous ADD1 1 82908 1.20616E-5 41454 0 3.18959E-5
4-2930179-C-A p.Pro746Thr missense ADD1 2 82960 2.4108E-5 41480 0 NA
4-2930181-G-A p.Pro746Pro synonymous ADD1 5 82964 6.02671E-5 41482 0 3.59439E-5
4-2930186-A-G p.Lys748Arg missense ADD1 3 82980 3.61533E-5 41490 0 8.31449E-6
4-2930187-AAAG-A p.Lys752del conservative_inframe_deletion ADD1 32 82986 3.85607E-4 41493 1 0.158746
4-2930197-AA-TT p.Lys752Leu missense ADD1 33 83020 3.97495E-4 41510 0 NA
4-2930197-A-T p.Lys752* stop_gained ADD1 8 83020 9.63623E-5 41510 0 0.00100705
4-2930204-G-A p.Arg754His missense ADD1 2 82980 2.41022E-5 41490 0 5.03525E-4
4-2930208-C-T p.Thr755Thr synonymous ADD1 1 82992 1.20494E-5 41496 0 6.37389E-5
4-2930210-C-T p.Pro756Leu missense ADD1 1 82986 1.20502E-5 41493 0 6.25E-4
4-2930211-G-A p.Pro756Pro synonymous ADD1 2 82994 2.40981E-5 41497 0 5.03525E-4
4-2930222-A-G p.Lys760Arg missense ADD1 7 82998 8.43394E-5 41499 0 3.32143E-5
4-2930224-A-G p.Lys761Glu missense ADD1 1 82986 1.20502E-5 41493 0 NA
4-2930229-CAAG-C p.Lys765del disruptive_inframe_deletion ADD1 2 82968 2.41057E-5 41484 0 8.30275E-5
4-2930237-A-G p.Lys765Arg missense ADD1 1 82978 1.20514E-5 41489 0 1.66096E-5
4-2930370-G-A n.40+1G>A splice_donor ADD1 12 74202 1.61721E-4 37101 0 6.43501E-4
4-2930372-C-T n.40+3C>T splice_region ADD1 1 73986 1.35161E-5 36993 0 3.18878E-5
4-2930373-C-T n.40+4C>T splice_region ADD1 1 73684 1.35715E-5 36842 0 NA
4-2931802-A-T c.*1552A>T splice_region ADD1 3 43670 6.8697E-5 21835 0 3.1839E-5