Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
18-904979-G-C c.-84G>C 5_prime_UTR_premature_start_codon_gain ADCYAP1 2 36172 5.52914E-5 18086 0 NA
18-904985-C-G c.-78C>G 5_prime_UTR_premature_start_codon_gain ADCYAP1 1 36186 2.7635E-5 18093 0 NA
18-905172-T-C c.-216T>C 5_prime_UTR_premature_start_codon_gain ADCYAP1 1 40158 2.49016E-5 20079 0 3.18756E-5
18-905225-A-T c.-163A>T 5_prime_UTR_premature_start_codon_gain ADCYAP1 3 66218 4.53049E-5 33109 0 NA
18-905245-C-T c.-143C>T 5_prime_UTR_premature_start_codon_gain ADCYAP1 6 70630 8.49497E-5 35315 0 NA
18-905303-C-T c.-85C>T 5_prime_UTR_premature_start_codon_gain ADCYAP1 1 79120 1.2639E-5 39560 0 NA
18-905332-G-T c.-56G>T 5_prime_UTR_premature_start_codon_gain ADCYAP1 1 81270 1.23047E-5 40635 0 3.18593E-5
18-905397-T-A p.Cys4Ser missense ADCYAP1 1 83078 1.20369E-5 41539 0 NA
18-905401-G-A p.Ser5Asn missense ADCYAP1 1 83074 1.20375E-5 41537 0 NA
18-905402-C-A p.Ser5Arg missense ADCYAP1 2 83066 2.40772E-5 41533 0 2.79642E-5
18-905403-G-A p.Gly6Arg missense ADCYAP1 2 83086 2.40714E-5 41543 0 NA
18-905416-C-T p.Ala10Val missense ADCYAP1 2 83092 2.40697E-5 41546 0 3.18613E-5
18-905418-C-A p.Leu11Met missense ADCYAP1 1 83104 1.20331E-5 41552 0 NA
18-905450-C-G p.Ser21Arg missense ADCYAP1 1 82932 1.20581E-5 41466 0 4.0103E-6
18-905451-G-T p.Val22Phe missense ADCYAP1 1 82954 1.20549E-5 41477 0 8.2605E-6
18-905452-T-C p.Val22Ala missense ADCYAP1 2 82936 2.4115E-5 41468 0 1.23924E-4
18-905467-C-T p.Ala27Val missense ADCYAP1 1 82756 1.20837E-5 41378 0 NA
18-905476-G-T p.Gly30Val missense ADCYAP1 4 82720 4.83559E-5 41360 0 3.2407E-5
18-905480-C-G p.Leu31Leu synonymous ADCYAP1 56 82694 6.77195E-4 41347 1 4.7115E-4
18-905483-G-C p.Arg32Arg synonymous ADCYAP1 1 82686 1.20939E-5 41343 0 NA
18-905487-C-T p.Pro34Ser missense ADCYAP1 2 82630 2.42043E-5 41315 0 NA
18-905489-C-A p.Pro34Pro synonymous ADCYAP1 1 82632 1.21018E-5 41316 0 4.14759E-5
18-907652-C-A c.111-8C>A splice_region ADCYAP1 2 77910 2.56706E-5 38955 0 6.25E-4
18-907661-C-G p.Pro38Ala missense+splice_region ADCYAP1 1 77900 1.2837E-5 38950 0 NA
18-907673-GCG-TCA p.Ala42Ser missense ADCYAP1 1 77818 1.28505E-5 38909 0 NA
18-907673-GC-AT p.Ala42Met missense ADCYAP1 1 77818 1.28505E-5 38909 0 NA
18-907675-G-A p.Ala42Ala synonymous ADCYAP1 49273 74394 0.662325 37197 16430 0.736353
18-907679-G-C p.Gly44Arg missense ADCYAP1 1 77754 1.28611E-5 38877 0 NA
18-907681-C-A p.Gly44Gly synonymous ADCYAP1 1 77714 1.28677E-5 38857 0 NA
18-907682-G-C p.Glu45Gln missense ADCYAP1 2 77718 2.57341E-5 38859 0 6.39386E-5
18-907684-G-A p.Glu45Glu synonymous ADCYAP1 26 77708 3.34586E-4 38854 0 6.25E-4
18-907685-G-C p.Asp46His missense ADCYAP1 1 77680 1.28733E-5 38840 0 0.00125
18-907701-C-T p.Pro51Leu missense ADCYAP1 1 77348 1.29286E-5 38674 0 NA
18-907710-A-G p.Asp54Gly missense ADCYAP1 16221 76032 0.213344 38016 1759 0.299247
18-907717-G-C p.Ser56Ser synonymous ADCYAP1 2 76608 2.61069E-5 38304 0 3.20595E-5
18-907721-C-A p.Pro58Thr missense ADCYAP1 1 76410 1.30873E-5 38205 0 3.20595E-5
18-907722-C-A p.Pro58Gln missense ADCYAP1 11 76374 1.44028E-4 38187 0 0.00439147
18-907723-G-T p.Pro58Pro synonymous ADCYAP1 1 76286 1.31086E-5 38143 0 7.45256E-6
18-907725-C-G p.Pro59Arg missense ADCYAP1 11 76222 1.44315E-4 38111 0 0.00213447
18-907725-C-A p.Pro59Gln missense ADCYAP1 1 76222 1.31196E-5 38111 0 NA
18-907726-G-C p.Pro59Pro synonymous ADCYAP1 5 76196 6.56202E-5 38098 0 0.00106838
18-907729-C-G p.Gly60Gly synonymous ADCYAP1 1 75934 1.31693E-5 37967 0 NA
18-907730-G-T p.Ala61Ser missense ADCYAP1 4 75920 5.2687E-5 37960 0 3.20492E-5
18-907733-G-A p.Gly62Arg missense ADCYAP1 1 75848 1.31843E-5 37924 0 NA
18-907734-G-A p.Gly62Glu missense ADCYAP1 1 75806 1.31916E-5 37903 0 3.20287E-5
18-907737-G-A p.Ser63Asn missense ADCYAP1 1 75388 1.32647E-5 37694 0 NA
18-907737-G-T p.Ser63Ile missense ADCYAP1 2 75388 2.65294E-5 37694 0 6.13798E-5
18-907741-C-A p.Pro64Pro synonymous ADCYAP1 4 75016 5.3322E-5 37508 0 2.6634E-5
18-907742-G-A p.Ala65Thr missense ADCYAP1 1 74856 1.3359E-5 37428 0 NA
18-907742-G-T p.Ala65Ser missense ADCYAP1 1 74856 1.3359E-5 37428 0 NA
18-907747-C-T p.Ser66Ser synonymous ADCYAP1 1 74258 1.34666E-5 37129 0 NA
18-907752-C-A p.Pro68Gln missense ADCYAP1 2 73530 2.71998E-5 36765 0 2.86369E-4
18-907756-C-A p.Arg69Arg synonymous ADCYAP1 2 73074 2.73695E-5 36537 0 2.13147E-5
18-907759-C-T p.Ala70Ala synonymous ADCYAP1 1 73014 1.3696E-5 36507 0 6.41601E-5
18-907762-C-T p.Ala71Ala synonymous ADCYAP1 28 72698 3.85155E-4 36349 0 4.74158E-4
18-907767-C-T p.Ala73Val missense ADCYAP1 3 72230 4.1534E-5 36115 0 6.89123E-5
18-907769-T-C p.Trp74Arg missense ADCYAP1 1 72156 1.38589E-5 36078 0 3.20924E-5
18-907773-A-G p.Tyr75Cys missense ADCYAP1 1 71876 1.39128E-5 35938 0 NA
18-907778-C-T p.Pro77Ser missense ADCYAP1 1 71602 1.39661E-5 35801 0 NA
18-907784-G-C p.Gly79Arg missense ADCYAP1 2 71254 2.80686E-5 35627 0 NA
18-908258-C-T n.241-8C>T splice_region ADCYAP1 1 80260 1.24595E-5 40130 0 NA
18-908261-G-A n.241-5G>A splice_region ADCYAP1 2 80368 2.48855E-5 40184 0 4.10041E-6
18-908269-T-C p.Asp82Asp synonymous ADCYAP1 1 80684 1.2394E-5 40342 0 4.07505E-6
18-908272-C-A p.Val83Val synonymous ADCYAP1 2 80760 2.47647E-5 40380 0 5.05561E-4
18-908279-G-A p.Gly86Arg missense ADCYAP1 1 81070 1.2335E-5 40535 0 NA
18-908289-A-G p.Asn89Ser missense ADCYAP1 3 81518 3.68017E-5 40759 0 1.91424E-4
18-908290-C-T p.Asn89Asn synonymous ADCYAP1 81 81548 9.9328E-4 40774 0 9.40015E-4
18-908295-C-T p.Ala91Val missense ADCYAP1 39 81644 4.77684E-4 40822 2 0.003125
18-908297-T-C p.Tyr92His missense ADCYAP1 2 81698 2.44804E-5 40849 0 NA
18-908300-C-A p.Arg93Ser missense ADCYAP1 2 81722 2.44732E-5 40861 0 3.46111E-5
18-908301-G-C p.Arg93Pro missense ADCYAP1 1 81742 1.22336E-5 40871 0 8.64274E-6
18-908308-G-A p.Val95Val synonymous ADCYAP1 2 81734 2.44696E-5 40867 0 1.61186E-5
18-908317-G-C p.Gln98His missense ADCYAP1 1 81732 1.22351E-5 40866 0 3.18715E-5
18-908320-G-A p.Leu99Leu synonymous ADCYAP1 16 81684 1.95877E-4 40842 0 6.37552E-5
18-908323-C-T p.Ser100Ser synonymous ADCYAP1 1 81654 1.22468E-5 40827 0 NA
18-908325-C-A p.Ala101Asp missense ADCYAP1 1 81632 1.22501E-5 40816 0 8.5803E-6
18-908328-G-A p.Gly102Glu missense ADCYAP1 1 81636 1.22495E-5 40818 0 8.05438E-6
18-908335-C-T p.His104His synonymous ADCYAP1 1 81566 1.226E-5 40783 0 NA
18-908340-A-G p.Gln106Arg missense ADCYAP1 1 81418 1.22823E-5 40709 0 4.03151E-6
18-908345-C-T p.Leu108Phe missense ADCYAP1 2 81262 2.46117E-5 40631 0 8.64484E-6
18-908347-C-T p.Leu108Leu synonymous ADCYAP1 14 81176 1.72465E-4 40588 0 2.23115E-4
18-908348-G-C p.Val109Leu missense ADCYAP1 1 81138 1.23247E-5 40569 0 4.04446E-6
18-908354-C-T p.Arg111Trp missense ADCYAP1 1 80850 1.23686E-5 40425 0 1.74377E-5
18-908358-G-A p.Gly112Asp missense ADCYAP1 6 80672 7.43752E-5 40336 0 6.25E-4
18-909448-G-A p.Gly115Arg missense+splice_region ADCYAP1 1 82516 1.21189E-5 41258 0 NA
18-909461-G-A p.Gly119Asp missense ADCYAP1 1 82794 1.20782E-5 41397 0 NA
18-909464-G-A p.Gly120Asp missense ADCYAP1 2 82810 2.41517E-5 41405 0 NA
18-909467-C-G p.Ala121Gly missense ADCYAP1 1 82854 1.20694E-5 41427 0 NA
18-909474-C-A p.Asp123Glu missense ADCYAP1 6 82880 7.23938E-5 41440 0 9.55779E-5
18-909477-C-T p.Asp124Asp synonymous ADCYAP1 5 82904 6.03107E-5 41452 0 6.36983E-5
18-909486-G-T p.Pro127Pro synonymous ADCYAP1 1 83038 1.20427E-5 41519 0 4.00731E-6
18-909493-A-C p.Lys130Gln missense ADCYAP1 1 83140 1.20279E-5 41570 0 NA
18-909496-C-T p.Arg131Cys missense ADCYAP1 2 83136 2.4057E-5 41568 0 NA
18-909532-C-A p.Arg143Ser missense ADCYAP1 2 83264 2.402E-5 41632 0 NA
18-909540-G-T p.Arg145Arg synonymous ADCYAP1 2 83290 2.40125E-5 41645 0 NA
18-909548-T-A p.Met148Lys missense ADCYAP1 1 83300 1.20048E-5 41650 0 5.96906E-5
18-909561-A-G p.Lys152Lys synonymous ADCYAP1 22966 82962 0.276826 41481 3345 0.280905
18-909569-C-A p.Ala155Glu missense ADCYAP1 1 83320 1.20019E-5 41660 0 NA
18-909569-C-T p.Ala155Val missense ADCYAP1 2 83320 2.40038E-5 41660 0 NA
18-909581-G-A p.Gly159Glu missense ADCYAP1 1 83326 1.20011E-5 41663 0 NA
18-909585-G-T p.Lys160Asn missense ADCYAP1 2 83318 2.40044E-5 41659 0 8.27897E-6
18-909586-A-C p.Arg161Arg synonymous ADCYAP1 12 83316 1.4403E-4 41658 0 2.23143E-4
18-909617-G-A p.Arg171His missense ADCYAP1 3 83326 3.60032E-5 41663 0 3.32397E-5
18-909617-G-C p.Arg171Pro missense ADCYAP1 2 83326 2.40021E-5 41663 0 NA
18-909620-G-T p.Arg172Leu missense ADCYAP1 3 83324 3.6004E-5 41662 0 NA
18-909628-T-G p.Tyr175Asp missense ADCYAP1 1 83322 1.20016E-5 41661 0 NA
18-909669-C-T n.562C>T splice_region ADCYAP1 924 83114 0.0111173 41557 31 0.0248882
18-909861-AATATATATAAAGAATATATATATATATATATATATAT-A c.*238_*274delAATATATATATATATATATATATATATATATATAAAG splice_region ADCYAP1 1 44860 2.22916E-5 22430 0 NA
18-909874-AATATATATATAT-A c.*260_*271delTATATATATATA splice_region ADCYAP1 1151 41268 0.0278909 20634 19 NA
18-909874-AATATATATATATATAT-A c.*256_*271delTATATATATATATATA splice_region ADCYAP1 1898 41278 0.0459809 20639 36 NA
18-909874-AATATATATATATAT-A c.*258_*271delTATATATATATATA splice_region ADCYAP1 11295 40862 0.276418 20431 1172 0.317692
18-909874-AATATAT-A c.*266_*271delTATATA splice_region ADCYAP1 5275 41120 0.128283 20560 229 0.160048
18-909874-AATATATATAT-A c.*262_*271delTATATATATA splice_region ADCYAP1 5655 41118 0.137531 20559 263 0.165925
18-909874-AATATATAT-A c.*264_*271delTATATATA splice_region ADCYAP1 3948 41172 0.0958904 20586 125 0.117754
18-909874-AATAT-A c.*268_*271delTATA splice_region ADCYAP1 3019 41208 0.0732625 20604 90 0.0883715
18-909874-AATATATATATATATATAT-A c.*254_*271delTATATATATATATATATA splice_region ADCYAP1 77 41306 0.00186414 20653 1 NA
18-909874-AATATATATATATATATATAT-A c.*252_*271delTATATATATATATATATATA splice_region ADCYAP1 2 41306 4.84191E-5 20653 0 NA
18-909896-TATATATATATA-T c.*262_*272delTATATATATAA splice_region ADCYAP1 2 40068 4.99151E-5 20034 0 1.94118E-4
18-909900-TATATATA-T c.*266_*272delTATATAA splice_region ADCYAP1 4 40540 9.8668E-5 20270 0 2.05128E-4
18-909901-AT-A c.*266delT splice_region ADCYAP1 2 40772 4.90533E-5 20386 0 9.03016E-5
18-909901-ATATAT-A c.*266_*270delTATAT splice_region ADCYAP1 1 40772 2.45266E-5 20386 0 9.03016E-5
18-911024-CTT-C n.1911_1912delTT splice_region ADCYAP1 1 3090 3.23625E-4 1545 0 0.00114803