Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
14-24787599-G-T c.*23C>A splice_region ADCY4 3 83172 3.60698E-5 41586 0 NA
14-24787625-G-A p.Gly1077Gly synonymous ADCY4 1 83302 1.20045E-5 41651 0 1.6629E-5
14-24787626-C-T p.Gly1077Asp missense ADCY4 1 83298 1.20051E-5 41649 0 NA
14-24787632-G-T p.Thr1075Asn missense ADCY4 1 83296 1.20054E-5 41648 0 9.55536E-5
14-24787642-G-A p.Pro1072Ser missense ADCY4 1 83324 1.20013E-5 41662 0 NA
14-24787644-G-A p.Pro1071Leu missense ADCY4 9 83332 1.08002E-4 41666 0 6.37064E-5
14-24787645-G-A p.Pro1071Ser missense ADCY4 7 83324 8.40094E-5 41662 0 1.65248E-5
14-24787651-T-C p.Thr1069Ala missense ADCY4 1 83338 1.19993E-5 41669 0 7.95843E-6
14-24787655-T-A p.Thr1067Thr synonymous ADCY4 3 83344 3.59954E-5 41672 0 NA
14-24787661-G-C p.Asp1065Glu missense ADCY4 1 83342 1.19988E-5 41671 0 7.95659E-6
14-24787667-G-C p.Asn1063Lys missense ADCY4 2 83344 2.39969E-5 41672 0 3.18654E-5
14-24787668-T-C p.Asn1063Ser missense ADCY4 2 83348 2.39958E-5 41674 0 NA
14-24787671-A-G p.Leu1062Pro missense ADCY4 1 83354 1.1997E-5 41677 0 NA
14-24787692-C-T p.Gly1055Glu missense ADCY4 1 83342 1.19988E-5 41671 0 NA
14-24787719-C-T p.Arg1046Gln missense ADCY4 1 83334 1.19999E-5 41667 0 3.18735E-5
14-24787720-G-A p.Arg1046Trp missense ADCY4 1 83332 1.20002E-5 41666 0 NA
14-24787721-G-T p.Ser1045Arg missense ADCY4 1 83330 1.20005E-5 41665 0 4.94584E-5
14-24787731-G-T p.Thr1042Asn missense ADCY4 4 83332 4.80008E-5 41666 0 3.29701E-5
14-24787732-T-G p.Thr1042Pro missense ADCY4 9 83326 1.0801E-4 41663 0 3.9775E-5
14-24787747-G-C p.Gln1037Glu missense ADCY4 1 83296 1.20054E-5 41648 0 8.24226E-6
14-24787752-G-A p.Ala1035Val missense ADCY4 1 83292 1.2006E-5 41646 0 1.19351E-5
14-24787764-T-G p.Glu1031Ala missense ADCY4 2 83272 2.40177E-5 41636 0 3.18776E-5
14-24787770-GTCACCTACAATTGGAGGGGGGCGAGGGAATATGGAGGTGGCCCTATTCTTAGTCCCCCTCCCCCTATGCCTCCAATGTGGTTCCC-G p.Val1028fs frameshift ADCY4 6 83250 7.20721E-5 41625 0 NA
14-24787771-T-A p.Thr1029Ser missense ADCY4 1 83256 1.20111E-5 41628 0 1.9906E-5
14-24787778-C-A c.3082-4G>T splice_region ADCY4 166 83236 0.00199433 41618 2 0.00229446
14-24787778-C-G c.3082-4G>C splice_region ADCY4 4 83236 4.80561E-5 41618 0 8.24253E-6
14-24787779-A-C c.3082-5T>G splice_region ADCY4 4 83236 4.80561E-5 41618 0 1.63285E-4
14-24787853-C-G c.3081+7G>C splice_region ADCY4 2 83322 2.40033E-5 41661 0 NA
14-24787881-T-C p.Thr1020Thr synonymous ADCY4 50 83346 5.99909E-4 41673 0 0.0025
14-24787892-TG-T p.Met1017fs frameshift ADCY4 11 83358 1.31961E-4 41679 0 0.00100705
14-24787894-C-T p.Arg1016His missense ADCY4 2 83352 2.39946E-5 41676 0 6.25E-4
14-24787904-C-T p.Val1013Met missense ADCY4 1 83344 1.19985E-5 41672 0 3.18593E-5
14-24787905-G-A p.Asn1012Asn synonymous ADCY4 1 83346 1.19982E-5 41673 0 1.98825E-5
14-24787926-G-A p.Asp1005Asp synonymous ADCY4 1 83360 1.19962E-5 41680 0 3.18552E-5
14-24787935-C-T p.Pro1002Pro synonymous ADCY4 2 83350 2.39952E-5 41675 0 1.64745E-5
14-24787936-G-T p.Pro1002Gln missense ADCY4 3 83348 3.59937E-5 41674 0 3.97636E-5
14-24787936-G-A p.Pro1002Leu missense ADCY4 1 83346 1.19982E-5 41673 0 3.18613E-5
14-24787942-T-C p.Gln1000Arg missense ADCY4 1 83338 1.19993E-5 41669 0 NA
14-24787968-G-A p.Pro991Pro synonymous ADCY4 4 83314 4.80111E-5 41657 0 6.37267E-5
14-24787974-A-G p.His989His synonymous ADCY4 1 83306 1.20039E-5 41653 0 8.24334E-6
14-24787983-C-G p.Gly986Gly splice_region+synonymous ADCY4 1 83280 1.20077E-5 41640 0 NA
14-24787985-C-CCACTCGCAGGCGGAAGTTGTTGAATGAATGCTTGT c.2957-2_2957-1insACAAGCATTCATTCAACAACTTCCGCCTGCGAGTG splice_acceptor ADCY4 1 83280 1.20077E-5 41640 0 NA
14-24787986-T-TCGCAGGCGG c.2957-3_2957-2insCCGCCTGCG splice_region ADCY4 1 83274 1.20085E-5 41637 0 NA
14-24787991-A-G c.2957-7T>C splice_region ADCY4 1 83256 1.20111E-5 41628 0 3.98032E-6
14-24787991-A-T c.2957-7T>A splice_region ADCY4 1 83256 1.20111E-5 41628 0 NA
14-24787992-G-C c.2957-8C>G splice_region ADCY4 1 83252 1.20117E-5 41626 0 3.98032E-6
14-24788295-GTC-G c.2956+7_2956+8delGA splice_region ADCY4 1 81850 1.22175E-5 40925 0 NA
14-24788309-C-T p.Arg984Gln missense ADCY4 1 81686 1.2242E-5 40843 0 1.59429E-4
14-24788310-G-A p.Arg984* stop_gained ADCY4 2 81552 2.45242E-5 40776 0 8.2511E-6
14-24788315-CG-C p.Arg982fs frameshift ADCY4 2 81408 2.45676E-5 40704 0 NA
14-24788316-G-A p.Arg982Cys missense ADCY4 106 81474 0.00130103 40737 1 0.00105579
14-24788341-G-A p.Ile973Ile synonymous ADCY4 12 81806 1.46689E-4 40903 0 3.18878E-5
14-24788346-C-T p.Val972Ile missense ADCY4 1 81868 1.22148E-5 40934 0 6.38147E-5
14-24788347-G-A p.Asp971Asp synonymous ADCY4 21 81940 2.56285E-4 40970 0 9.57121E-4
14-24788358-A-T p.Ser968Thr missense ADCY4 34 82154 4.13857E-4 41077 0 3.66686E-4
14-24788359-C-T p.Gly967Gly synonymous ADCY4 8 82186 9.73402E-5 41093 0 9.56328E-5
14-24788365-G-A p.Ala965Ala synonymous ADCY4 5 82266 6.07784E-5 41133 0 1.19532E-5
14-24788369-A-G p.Val964Ala missense ADCY4 19 82406 2.30566E-4 41203 0 1.19497E-4
14-24788370-C-T p.Val964Met missense ADCY4 1 82394 1.21368E-5 41197 0 0.00125
14-24788371-G-A p.Ala963Ala synonymous ADCY4 12 82418 1.45599E-4 41209 0 9.56389E-5
14-24788371-GG-AA p.Ala963Val missense ADCY4 1 82418 1.21333E-5 41209 0 NA
14-24788376-A-T p.Phe962Ile missense ADCY4 1 82610 1.21051E-5 41305 0 NA
14-24788384-A-G p.Met959Thr missense ADCY4 22 82714 2.65977E-4 41357 0 1.64875E-4
14-24788397-G-T p.His955Asn missense ADCY4 2 82886 2.41295E-5 41443 0 NA
14-24788407-C-A p.Arg951Arg synonymous ADCY4 1 83022 1.2045E-5 41511 0 1.27478E-4
14-24788408-C-T p.Arg951Gln missense ADCY4 1 83030 1.20438E-5 41515 0 0.00100705
14-24788409-G-A p.Arg951Trp missense ADCY4 28 83032 3.37219E-4 41516 1 5.41815E-4
14-24788412-C-G p.Glu950Gln missense ADCY4 1 83066 1.20386E-5 41533 0 NA
14-24788417-TCCTGGCAATGGGCCCGCCCACCAGGGTGGGCCAGTGAGGGCACAGGAATAAGTCCCACTAATAAGCCCATCAATGAGAGCCCAGAGGAGGATGGTAGGTAAGGAAGGGTTGCCGTA-T p.Asp948fs frameshift ADCY4 4 83094 4.81383E-5 41547 0 NA
14-24788426-T-C c.2842-8A>G splice_region ADCY4 1197 83034 0.0144158 41517 55 0.0352382
14-24788512-T-C n.673A>G splice_region ADCY4 1 83308 1.20036E-5 41654 0 6.37836E-5
14-24788528-G-A c.2841+7C>T splice_region ADCY4 2 83322 2.40033E-5 41661 0 NA
14-24788530-C-T c.2841+5G>A splice_region ADCY4 68 83326 8.16072E-4 41663 0 0.00149815
14-24788531-G-A c.2841+4C>T splice_region ADCY4 13 83328 1.5601E-4 41664 0 1.97746E-4
14-24788532-T-C c.2841+3A>G splice_region ADCY4 1 83334 1.19999E-5 41667 0 NA
14-24788535-C-T p.Gln947Gln splice_region+synonymous ADCY4 1 83356 1.19967E-5 41678 0 NA
14-24788546-C-T p.Asp944Asn missense ADCY4 1 83370 1.19947E-5 41685 0 NA
14-24788547-C-T p.Gln943Gln synonymous ADCY4 1 83376 1.19939E-5 41688 0 NA
14-24788551-C-T p.Gly942Glu missense ADCY4 3 83372 3.59833E-5 41686 0 3.9769E-6
14-24788556-G-A p.Thr940Thr synonymous ADCY4 17 83374 2.039E-4 41687 0 3.18695E-4
14-24788570-C-T p.Gly936Ser missense ADCY4 2 83380 2.39866E-5 41690 0 NA
14-24788573-TGGCTGCCATGTA-T p.Tyr931_Ala934del conservative_inframe_deletion ADCY4 1 83378 1.19936E-5 41689 0 NA
14-24788584-T-C p.Tyr931Cys missense ADCY4 1 83370 1.19947E-5 41685 0 NA
14-24788594-C-T p.Gly928Ser missense ADCY4 2 83374 2.39883E-5 41687 0 2.47129E-5
14-24788595-G-A p.Ile927Ile synonymous ADCY4 3 83376 3.59816E-5 41688 0 0.00100705
14-24788596-A-G p.Ile927Thr missense ADCY4 1 83376 1.19939E-5 41688 0 NA
14-24788619-A-T p.Ser919Arg missense ADCY4 2 83356 2.39935E-5 41678 0 NA
14-24788644-T-TCATCAAAATCA c.2734-3_2734-2insTGATTTTGATG splice_region ADCY4 1 83314 1.20028E-5 41657 0 NA
14-24788649-A-G c.2734-7T>C splice_region ADCY4 1 83286 1.20068E-5 41643 0 6.37024E-5
14-24788963-A-T p.Ile906Ile synonymous ADCY4 2 83280 2.40154E-5 41640 0 NA
14-24788964-A-G p.Ile906Thr missense ADCY4 1 83278 1.2008E-5 41639 0 8.24498E-6
14-24788967-A-G p.Ile905Thr missense ADCY4 2 83284 2.40142E-5 41642 0 NA
14-24788973-T-C p.Asn903Ser missense ADCY4 1 83284 1.20071E-5 41642 0 1.64891E-5
14-24788976-A-G p.Leu902Pro missense ADCY4 1 83270 1.20091E-5 41635 0 4.12249E-5
14-24788997-C-G p.Gly895Ala missense ADCY4 1 83264 1.201E-5 41632 0 NA
14-24789003-T-C p.His893Arg missense ADCY4 1 83284 1.20071E-5 41642 0 3.97722E-6
14-24789012-T-C p.Asn890Ser missense ADCY4 1 83266 1.20097E-5 41633 0 NA
14-24789019-C-T p.Glu888Lys missense ADCY4 1 83252 1.20117E-5 41626 0 NA
14-24789021-G-A p.Ser887Phe missense ADCY4 2 83246 2.40252E-5 41623 0 8.24606E-6
14-24789022-A-G p.Ser887Pro missense ADCY4 1 83242 1.20132E-5 41621 0 NA
14-24789027-A-G p.Phe885Ser missense ADCY4 1 83230 1.20149E-5 41615 0 0.00125
14-24789043-G-A p.Pro880Ser missense ADCY4 5 83186 6.01063E-5 41593 0 1.07393E-4
14-24789044-G-T p.Val879Val synonymous ADCY4 3 83174 3.6069E-5 41587 0 NA
14-24789053-G-A p.Phe876Phe synonymous ADCY4 4 83114 4.81267E-5 41557 0 1.59119E-5
14-24789065-A-G p.Val872Val synonymous ADCY4 1 82976 1.20517E-5 41488 0 NA
14-24789067-C-T p.Val872Ile missense ADCY4 1 82958 1.20543E-5 41479 0 3.30437E-5
14-24789068-G-A p.Cys871Cys synonymous ADCY4 119 82918 0.00143515 41459 0 0.00125
14-24789068-G-T p.Cys871* stop_gained ADCY4 1 82920 1.20598E-5 41460 0 8.2631E-6
14-24789077-G-A p.Ser868Ser synonymous ADCY4 1 82710 1.20904E-5 41355 0 NA
14-24789098-G-A c.2587-4C>T splice_region ADCY4 1 81660 1.22459E-5 40830 0 NA
14-24789109-G-T n.2297C>A splice_region ADCY4 6 80894 7.41711E-5 40447 0 1.7443E-4
14-24789111-C-G n.2296-1G>C splice_acceptor ADCY4 2 80704 2.47819E-5 40352 0 4.80989E-5
14-24790915-C-T n.4576+7G>A splice_region ADCY4 5 22986 2.17524E-4 11493 0 9.56389E-5
14-24791188-G-A n.4316-6C>T splice_region ADCY4 3 74890 4.00588E-5 37445 0 3.1841E-4
14-24791189-A-G n.4316-7T>C splice_region ADCY4 1 75050 1.33245E-5 37525 0 NA
14-24791266-A-G c.2586+6T>C splice_region ADCY4 4 81848 4.88711E-5 40924 0 2.04663E-4
14-24791270-A-G c.2586+2T>C splice_donor ADCY4 5 81858 6.10814E-5 40929 0 9.55901E-5
14-24791275-G-A p.Asn861Asn synonymous ADCY4 2 81992 2.43926E-5 40996 0 3.18532E-5
14-24791279-C-T p.Arg860His missense ADCY4 8 82006 9.75538E-5 41003 0 7.99655E-6
14-24791282-C-T p.Arg859Gln missense ADCY4 4 82034 4.87603E-5 41017 0 1.99649E-5
14-24791283-G-A p.Arg859Trp missense ADCY4 1 82124 1.21767E-5 41062 0 1.16661E-4
14-24791300-T-TG p.Gln853fs frameshift ADCY4 1 82336 1.21454E-5 41168 0 3.98302E-6
14-24791300-TG-T p.Gln853fs frameshift ADCY4 3 82336 3.64361E-5 41168 0 3.18573E-5
14-24791305-G-A p.Ala851Ala synonymous ADCY4 8 82394 9.70944E-5 41197 0 3.98016E-5
14-24791311-G-A p.His849His synonymous ADCY4 19 82372 2.30661E-4 41186 0 1.59337E-4
14-24791317-A-G p.Pro847Pro synonymous ADCY4 4 82472 4.85013E-5 41236 0 5.03525E-4
14-24791320-G-A p.Leu846Leu synonymous ADCY4 2 82466 2.42524E-5 41233 0 3.18654E-5
14-24791326-G-A p.Asn844Asn synonymous ADCY4 14 82364 1.69977E-4 41182 1 2.78432E-4
14-24791342-C-T p.Arg839Gln missense ADCY4 9 82308 1.09345E-4 41154 0 6.25E-4
14-24791343-G-A p.Arg839Trp missense ADCY4 1 82348 1.21436E-5 41174 0 1.19306E-5
14-24791349-G-A p.Leu837Leu synonymous ADCY4 1 82286 1.21527E-5 41143 0 7.95361E-6
14-24791360-G-A p.Thr833Met missense ADCY4 20 82048 2.4376E-4 41024 1 4.77859E-4
14-24791373-C-T p.Glu829Lys missense ADCY4 1 81722 1.22366E-5 40861 0 NA
14-24791380-C-T p.Gln826Gln synonymous ADCY4 2 81520 2.45339E-5 40760 0 3.18593E-5
14-24791384-C-T p.Arg825Lys missense ADCY4 5 81326 6.1481E-5 40663 1 1.03422E-4
14-24791392-C-T p.Lys822Lys synonymous ADCY4 1 80880 1.2364E-5 40440 0 8.26078E-6
14-24791415-G-A p.Arg815Cys missense ADCY4 1 78586 1.27249E-5 39293 0 3.18573E-5
14-24791418-A-G p.Cys814Arg missense ADCY4 22 78208 2.81301E-4 39104 1 0.00114656
14-24791420-T-C p.Tyr813Cys missense ADCY4 2 77928 2.56647E-5 38964 0 NA
14-24791428-A-G p.Asn810Asn splice_region+synonymous ADCY4 1 76826 1.30164E-5 38413 0 8.42219E-6
14-24791432-TG-T c.2428-3delC splice_region ADCY4 1 76202 1.3123E-5 38101 0 1.69022E-5
14-24791438-G-T c.2428-8C>A splice_region ADCY4 1 74894 1.33522E-5 37447 0 NA
14-24791831-T-C p.Gln809Arg missense+splice_region ADCY4 1 82822 1.20741E-5 41411 0 3.98473E-6
14-24791834-C-T p.Arg808His missense ADCY4 7 82830 8.45104E-5 41415 0 1.91327E-4
14-24791835-G-A p.Arg808Cys missense ADCY4 1 82936 1.20575E-5 41468 0 NA
14-24791851-G-A p.Thr802Thr synonymous ADCY4 3 83104 3.60993E-5 41552 0 1.91217E-4
14-24791851-G-T p.Thr802Thr synonymous ADCY4 2 83106 2.40657E-5 41553 0 NA
14-24791853-TGAA-T p.Phe801del conservative_inframe_deletion ADCY4 2 83078 2.40738E-5 41539 0 3.19816E-5
14-24791860-G-A p.Phe799Phe synonymous ADCY4 1 83142 1.20276E-5 41571 0 3.97947E-6
14-24791865-T-C p.Ile798Val missense ADCY4 2 83152 2.40523E-5 41576 0 2.50279E-5
14-24791865-TGAA-T p.Phe797del conservative_inframe_deletion ADCY4 1 83152 1.20262E-5 41576 0 1.19376E-5
14-24791884-C-T p.Met791Ile missense ADCY4 2 83106 2.40657E-5 41553 0 3.98124E-6
14-24791896-C-G p.Glu787Asp missense ADCY4 1 83052 1.20406E-5 41526 0 NA
14-24791909-C-G p.Gly783Ala missense ADCY4 1 82930 1.20584E-5 41465 0 NA
14-24791910-C-T p.Gly783Arg missense ADCY4 9 82922 1.08536E-4 41461 0 1.4162E-4
14-24791910-C-A p.Gly783* stop_gained ADCY4 2 82922 2.41191E-5 41461 0 NA
14-24791911-G-A p.Pro782Pro synonymous ADCY4 1 82904 1.20621E-5 41452 0 NA
14-24791912-G-A p.Pro782Leu missense+splice_region ADCY4 1 82894 1.20636E-5 41447 0 3.99968E-6
14-24791918-A-C c.2343-4T>G splice_region ADCY4 1 82796 1.20779E-5 41398 0 NA
14-24792103-T-C c.2342+7A>G splice_region ADCY4 4 80754 4.95332E-5 40377 0 5.30082E-5
14-24792122-G-A p.Pro777Leu missense ADCY4 3 81008 3.70334E-5 40504 0 1.27453E-4
14-24792124-G-A p.Gly776Gly synonymous ADCY4 2 81016 2.46865E-5 40508 0 NA
14-24792126-C-A p.Gly776Cys missense ADCY4 1 81064 1.23359E-5 40532 0 NA
14-24792132-A-G p.Tyr774His missense ADCY4 59 81126 7.27264E-4 40563 0 8.98443E-4
14-24792137-C-T p.Arg772His missense ADCY4 1 81068 1.23353E-5 40534 0 3.18695E-5
14-24792138-G-A p.Arg772Cys missense ADCY4 5 81142 6.16204E-5 40571 0 1.59357E-4
14-24792140-A-T p.Val771Asp missense ADCY4 6 81078 7.40028E-5 40539 0 4.27338E-5
14-24792141-C-T p.Val771Ile missense ADCY4 1 81032 1.23408E-5 40516 0 6.37552E-5
14-24792142-G-A p.Ile770Ile synonymous ADCY4 1 81124 1.23268E-5 40562 0 3.18674E-5
14-24792143-A-T p.Ile770Asn missense ADCY4 1 81122 1.23271E-5 40561 0 NA
14-24792154-C-T p.Ser766Ser synonymous ADCY4 417 81042 0.00514548 40521 13 0.0123366
14-24792155-G-A p.Ser766Leu missense ADCY4 1 81046 1.23387E-5 40523 0 0.00151362
14-24792169-G-A p.Ser761Ser synonymous ADCY4 1 81112 1.23286E-5 40556 0 NA
14-24792173-T-C p.His760Arg missense ADCY4 1 80842 1.23698E-5 40421 0 NA
14-24792177-G-A p.Leu759Leu synonymous ADCY4 17 80932 2.10053E-4 40466 1 8.03565E-4
14-24792185-G-A p.Ser756Phe missense ADCY4 1 80898 1.23612E-5 40449 0 4.01361E-6
14-24792196-C-T p.Ala752Ala synonymous ADCY4 4 80688 4.95737E-5 40344 0 6.37714E-5
14-24792197-G-A p.Ala752Val missense ADCY4 13 80548 1.61394E-4 40274 0 5.73797E-4
14-24792227-A-G p.Leu742Pro missense ADCY4 1 80972 1.23499E-5 40486 0 NA
14-24792232-G-A p.Phe740Phe synonymous ADCY4 1 80798 1.23765E-5 40399 0 5.59382E-5
14-24792239-A-G p.Met738Thr missense ADCY4 1 80764 1.23818E-5 40382 0 3.18756E-5
14-24792242-T-C p.His737Arg missense ADCY4 11 80624 1.36436E-4 40312 0 6.37674E-5
14-24792267-A-G p.Phe729Leu missense ADCY4 2 79934 2.50206E-5 39967 0 8.45466E-6
14-24792274-C-T p.Thr726Thr synonymous ADCY4 190 79432 0.00239198 39716 1 0.0026455
14-24792292-G-A p.Tyr720Tyr splice_region+synonymous ADCY4 1 78846 1.2683E-5 39423 0 8.60778E-6
14-24792294-A-ATGGGACACTGATGAGAGGCAGAGACCCAGGGAG c.2158-1_2158insCTCCCTGGGTCTCTGCCTCTCATCAGTGTCCCA splice_acceptor ADCY4 1 78702 1.27062E-5 39351 0 NA
14-24792301-G-C c.2158-7C>G splice_region ADCY4 5 78356 6.38113E-5 39178 0 1.2099E-5
14-24792531-G-T p.Pro419Thr missense ADCY4 5 82216 6.08154E-5 41108 0 1.91107E-4
14-24792543-C-T p.Val415Ile missense ADCY4 2 82306 2.42996E-5 41153 0 NA
14-24792555-C-G p.Val718Leu missense ADCY4 1 82362 1.21415E-5 41181 0 NA
14-24792555-C-T p.Val718Ile missense ADCY4 4 82362 4.85661E-5 41181 0 NA
14-24792576-C-T p.Gly711Arg missense ADCY4 1 82364 1.21412E-5 41182 0 NA
14-24792577-A-G p.Pro710Pro synonymous ADCY4 1 82372 1.214E-5 41186 0 NA
14-24792583-C-G p.Glu708Asp missense ADCY4 1 82368 1.21406E-5 41184 0 NA
14-24792588-A-G p.Trp707Arg missense ADCY4 8 82368 9.71251E-5 41184 0 2.78727E-4
14-24792590-G-A p.Ser706Phe missense ADCY4 1 82364 1.21412E-5 41182 0 1.72384E-4
14-24792596-T-A p.Asn704Ile missense ADCY4 2 82336 2.42907E-5 41168 0 4.30886E-5
14-24792608-G-C p.Ser700Cys missense ADCY4 2 82300 2.43013E-5 41150 0 3.18756E-5
14-24792611-G-A p.Ser699Phe missense ADCY4 2 82262 2.43126E-5 41131 0 4.32863E-5
14-24792612-A-T p.Ser699Thr missense ADCY4 1 82248 1.21584E-5 41124 0 5.97757E-6
14-24792615-C-T p.Val698Met missense ADCY4 2 82224 2.43238E-5 41112 0 NA
14-24792616-A-G p.Asn697Asn synonymous ADCY4 1 82202 1.21652E-5 41101 0 NA
14-24792622-A-G p.Ala695Ala synonymous ADCY4 1 82136 1.21749E-5 41068 0 NA
14-24792639-C-G p.Asp690His missense ADCY4 1 82032 1.21904E-5 41016 0 NA
14-24792642-A-G p.Ser689Pro missense ADCY4 1 82014 1.2193E-5 41007 0 NA
14-24792646-T-C p.Thr687Thr synonymous ADCY4 1 81998 1.21954E-5 40999 0 NA
14-24792660-A-T p.Phe683Ile missense+splice_region ADCY4 1 81880 1.2213E-5 40940 0 NA
14-24792665-A-G c.2047-5T>C splice_region ADCY4 2 81814 2.44457E-5 40907 0 3.18613E-5
14-24793268-C-A p.Leu682Leu splice_region+synonymous ADCY4 1 83142 1.20276E-5 41571 0 8.30303E-6
14-24793269-A-G p.Leu682Pro missense+splice_region ADCY4 12 83152 1.44314E-4 41576 0 6.37064E-5
14-24793285-T-C p.Met677Val missense ADCY4 1 83168 1.20239E-5 41584 0 8.25791E-6
14-24793301-G-C p.Ile671Met missense ADCY4 1 83174 1.2023E-5 41587 0 NA
14-24793310-G-A p.Thr668Thr synonymous ADCY4 1 83178 1.20224E-5 41589 0 6.25E-4
14-24793317-A-G p.Leu666Ser missense ADCY4 1 83202 1.20189E-5 41601 0 1.64894E-5
14-24793318-A-G p.Leu666Leu synonymous ADCY4 1 83204 1.20187E-5 41602 0 8.75218E-5
14-24793323-A-G p.Ile664Thr missense ADCY4 3 83210 3.60534E-5 41605 0 8.24416E-6
14-24793338-C-T p.Arg659Gln missense ADCY4 3 83182 3.60655E-5 41591 0 3.18451E-5
14-24793339-G-A p.Arg659* stop_gained ADCY4 26 83198 3.12508E-4 41599 0 6.25E-4
14-24793341-G-A p.Thr658Ile missense ADCY4 3 83198 3.60586E-5 41599 0 1.64867E-5
14-24793358-C-G p.Leu652Leu synonymous ADCY4 1 83198 1.20195E-5 41599 0 NA
14-24793361-T-G p.Ala651Ala synonymous ADCY4 2 83222 2.40321E-5 41611 0 1.64837E-5
14-24793369-G-C p.Leu649Val missense ADCY4 1 83226 1.20155E-5 41613 0 3.97823E-6
14-24793372-A-T p.Trp648Arg missense ADCY4 1 83230 1.20149E-5 41615 0 8.24117E-6
14-24793385-G-A p.Pro643Pro synonymous ADCY4 1 83226 1.20155E-5 41613 0 NA
14-24793397-G-A p.Val639Val synonymous ADCY4 1 83194 1.20201E-5 41597 0 3.18431E-5
14-24793401-C-T p.Cys638Tyr missense ADCY4 1 83208 1.20181E-5 41604 0 0.00125
14-24793405-TCTGTGGAGGGAGCATGGGCATCTTAGCCACGGGGCTGGGGCACCCTCTTCAGGACAGGTTGTGACCAGGGCTCCGGCATACCACTTCCACCCCTCAGCCCACCTCAC-T c.1908+1_1909-1del splice_acceptor ADCY4 6 83208 7.21085E-5 41604 0 NA
14-24793413-G-C c.1909-8C>G splice_region ADCY4 1 83196 1.20198E-5 41598 0 NA
14-24793507-C-T c.1908+6G>A splice_region ADCY4 28 83224 3.36441E-4 41612 0 8.91663E-4
14-24793510-C-T c.1908+3G>A splice_region ADCY4 534 83236 0.00641549 41618 16 0.0160191
14-24793513-C-T p.Met636Ile missense+splice_region ADCY4 4 83258 4.80434E-5 41629 0 3.18512E-5
14-24793542-G-C p.Leu627Val missense ADCY4 5 83278 6.00399E-5 41639 0 3.18451E-5
14-24793565-G-GTGCA p.Thr619fs frameshift ADCY4 1 83222 1.20161E-5 41611 0 3.97681E-6
14-24793569-T-C p.Ile618Val missense ADCY4 1 83224 1.20158E-5 41612 0 NA
14-24793570-G-A p.Ser617Ser synonymous ADCY4 2 83218 2.40333E-5 41609 0 4.12011E-5
14-24793573-A-G p.Tyr616Tyr synonymous ADCY4 1 83194 1.20201E-5 41597 0 3.18431E-5
14-24793574-T-C p.Tyr616Cys missense ADCY4 1 83194 1.20201E-5 41597 0 NA
14-24793576-C-T p.Thr615Thr synonymous ADCY4 3 83174 3.6069E-5 41587 0 3.97703E-5
14-24793577-G-A p.Thr615Met missense ADCY4 1 83160 1.2025E-5 41580 0 3.57938E-5
14-24793581-T-C p.Ile614Val missense ADCY4 1 83134 1.20288E-5 41567 0 3.97728E-6
14-24793589-G-A p.Ala611Val missense ADCY4 2 83066 2.40772E-5 41533 0 1.64804E-5
14-24793600-G-A c.1824-3C>T splice_region ADCY4 73722 76084 0.968955 38042 35903 0.991875
14-24793603-G-A c.1824-6C>T splice_region ADCY4 10 82876 1.20662E-4 41438 1 5.96844E-5
14-24794577-T-C c.1823+6A>G splice_region ADCY4 2 83066 2.40772E-5 41533 0 8.24484E-6
14-24794601-T-A p.Gln602Leu missense ADCY4 1 83186 1.20213E-5 41593 0 NA
14-24794612-G-A p.Asn598Asn synonymous ADCY4 1 83246 1.20126E-5 41623 0 1.98834E-5
14-24794614-T-C p.Asn598Asp missense ADCY4 2 83244 2.40258E-5 41622 0 NA
14-24794622-A-G p.Phe595Ser missense ADCY4 2 83274 2.40171E-5 41637 0 NA
14-24794625-A-T p.Val594Asp missense ADCY4 1 83276 1.20083E-5 41638 0 7.95305E-6
14-24794633-G-A p.Thr591Thr synonymous ADCY4 1 83292 1.2006E-5 41646 0 NA
14-24794634-G-T p.Thr591Asn missense ADCY4 1 83286 1.20068E-5 41643 0 NA
14-24794638-A-G p.Cys590Arg missense ADCY4 1 83280 1.20077E-5 41640 0 NA
14-24794641-C-T p.Ala589Thr missense ADCY4 3 83286 3.60205E-5 41643 0 4.12052E-5
14-24794652-T-G p.Lys585Thr missense ADCY4 1 83262 1.20103E-5 41631 0 8.24974E-6
14-24794659-C-T p.Ala583Thr missense ADCY4 1 83216 1.20169E-5 41608 0 4.96114E-5
14-24794660-G-A p.Pro582Pro synonymous ADCY4 4 83218 4.80665E-5 41609 0 0.00151057
14-24794660-G-T p.Pro582Pro synonymous ADCY4 1 83218 1.20166E-5 41609 0 8.27458E-6
14-24794676-C-T p.Arg577Gln missense ADCY4 1 83120 1.20308E-5 41560 0 3.19183E-5
14-24794676-C-A p.Arg577Leu missense ADCY4 1 83120 1.20308E-5 41560 0 1.27673E-4
14-24794677-G-A p.Arg577* stop_gained ADCY4 12 83086 1.44429E-4 41543 0 1.01345E-4
14-24794678-G-A p.Tyr576Tyr splice_region+synonymous ADCY4 1 83078 1.20369E-5 41539 0 NA
14-24795017-A-G c.1725+7T>C splice_region ADCY4 1 82244 1.21589E-5 41122 0 3.9593E-5
14-24795022-A-C c.1725+2T>G splice_donor ADCY4 1 82300 1.21507E-5 41150 0 NA
14-24795023-C-G c.1725+1G>C splice_donor ADCY4 1 82328 1.21465E-5 41164 0 5.69909E-5
14-24795038-C-G p.Glu571Gln missense ADCY4 1 82494 1.21221E-5 41247 0 3.18654E-5
14-24795048-G-T p.Phe567Leu missense ADCY4 2 82558 2.42254E-5 41279 0 4.40222E-6
14-24795048-G-C p.Phe567Leu missense ADCY4 1 82558 1.21127E-5 41279 0 NA
14-24795066-G-A p.Pro125Ser missense ADCY4 3 82638 3.63029E-5 41319 0 5.16529E-5
14-24795068-T-G p.Asn561His missense ADCY4 2 82640 2.42014E-5 41320 0 NA
14-24795078-C-T p.Glu121Lys missense ADCY4 3 82608 3.63161E-5 41304 0 2.28404E-5
14-24795093-T-TTTCTGCGAGTTGAGCTGCTCAATGAC c.1656-1_1656insGTCATTGAGCAGCTCAACTCGCAGAA splice_acceptor ADCY4 1 82496 1.21218E-5 41248 0 NA
14-24795093-T-TTTCTGCGAGTTGAGCTGCTCAATGACCTGGAAGAA c.1656-1_1656insTTCTTCCAGGTCATTGAGCAGCTCAACTCGCAGAA splice_acceptor ADCY4 1 82496 1.21218E-5 41248 0 NA
14-24795278-T-A c.1655+7A>T splice_region ADCY4 2 82332 2.42919E-5 41166 0 NA
14-24795281-G-C c.1655+4C>G splice_region ADCY4 28 82418 3.39732E-4 41209 0 1.69166E-4
14-24795281-G-A c.1655+4C>T splice_region ADCY4 9 82418 1.09199E-4 41209 0 1.15745E-4
14-24795281-G-T c.1655+4C>A splice_region ADCY4 17 82416 2.06271E-4 41208 0 5.33473E-4
14-24795291-G-A p.Ser550Leu missense ADCY4 1 82756 1.20837E-5 41378 0 1.77093E-5
14-24795299-C-T p.Gln547Gln synonymous ADCY4 1 82912 1.2061E-5 41456 0 NA
14-24795305-A-G c.345+6T>C splice_region ADCY4 1 82996 1.20488E-5 41498 0 NA
14-24795306-A-G p.Ile545Thr missense ADCY4 1 83022 1.2045E-5 41511 0 4.29749E-6
14-24795308-G-A c.345+3C>T splice_region ADCY4 1 83028 1.20441E-5 41514 0 NA
14-24795331-C-T p.Gly537Arg missense ADCY4 5 83176 6.01135E-5 41588 0 1.01194E-4
14-24795332-G-A p.Thr536Thr synonymous ADCY4 4 83180 4.80885E-5 41590 0 8.77886E-6
14-24795333-G-A p.Thr536Ile missense ADCY4 2 83196 2.40396E-5 41598 0 NA
14-24795340-G-C p.Leu534Val missense ADCY4 1 83200 1.20192E-5 41600 0 NA
14-24795347-A-G p.Asp531Asp synonymous ADCY4 1 83202 1.20189E-5 41601 0 NA
14-24795357-C-T p.Arg528Gln missense ADCY4 7 83204 8.41306E-5 41602 0 5.03525E-4
14-24795358-G-A p.Arg528Trp missense ADCY4 1 83200 1.20192E-5 41600 0 5.03525E-4
14-24795360-G-T p.Pro527His missense ADCY4 1 83216 1.20169E-5 41608 0 4.12181E-6
14-24795366-C-T p.Arg525His missense ADCY4 10 83184 1.20215E-4 41592 0 6.25E-4
14-24795367-G-A p.Arg525Cys missense ADCY4 3 83182 3.60655E-5 41591 0 1.72539E-5
14-24795368-G-A p.Ser524Ser synonymous ADCY4 1 83194 1.20201E-5 41597 0 5.17045E-5
14-24795370-TCCTGCACAGTGAGAGCCAAGTCCATCACCACAGAGACCCTCAGAGCGTCTGGGCAAAGCAGGAGCAGACCCCCAGGGAGGATGGAGGGGGTCATCCAGACAGCCCCACTGGCAAAGACTTTGAGGCCTCCTCA-T p.Ser524fs frameshift ADCY4 2 83200 2.40385E-5 41600 0 NA
14-24795371-C-T p.Arg523Arg splice_region+synonymous ADCY4 1 83200 1.20192E-5 41600 0 5.03525E-4
14-24795376-A-C c.1569-5T>G splice_region ADCY4 1 83174 1.2023E-5 41587 0 1.71195E-5
14-24795499-C-G c.1568+6G>C splice_region ADCY4 1 82926 1.20589E-5 41463 0 7.95368E-6
14-24795502-C-T c.1568+3G>A splice_region ADCY4 3 82904 3.61864E-5 41452 0 5.76758E-5
14-24795505-C-T p.Arg523Gln missense+splice_region ADCY4 8 82866 9.65414E-5 41433 0 1.64804E-5
14-24795506-G-A p.Arg523Trp missense+splice_region ADCY4 1 82854 1.20694E-5 41427 0 6.36294E-5
14-24795513-G-T p.Ser520Arg missense ADCY4 1 82828 1.20732E-5 41414 0 NA
14-24795515-T-C p.Ser520Gly missense ADCY4 3 82834 3.6217E-5 41417 0 4.12031E-5
14-24795534-A-T p.Ala513Ala synonymous ADCY4 2 82612 2.42096E-5 41306 0 1.64848E-5
14-24795535-G-A p.Ala513Val missense ADCY4 3 82570 3.63328E-5 41285 0 NA
14-24795547-T-C p.Glu509Gly missense+splice_region ADCY4 1 82212 1.21637E-5 41106 0 NA
14-24795549-C-G c.1525-1G>C splice_acceptor ADCY4 1 82144 1.21737E-5 41072 0 NA
14-24795552-T-C c.1525-4A>G splice_region ADCY4 1 82030 1.21907E-5 41015 0 NA
14-24798087-G-A n.1057-8C>T splice_region ADCY4 1 37322 2.67938E-5 18661 0 1.27462E-4
14-24798262-C-T c.1524+5G>A splice_region ADCY4 1 80636 1.24014E-5 40318 0 9.16499E-5
14-24798267-C-T p.Pro508Pro splice_region+synonymous ADCY4 180 80930 0.00222414 40465 1 0.00302612
14-24798268-G-A p.Pro508Leu missense+splice_region ADCY4 3 81148 3.69695E-5 40574 0 1.27673E-4
14-24798282-G-C p.Thr503Thr synonymous ADCY4 3 81860 3.66479E-5 40930 0 3.19305E-5
14-24798284-T-G p.Thr503Pro missense ADCY4 16 81884 1.95398E-4 40942 1 0.00251762
14-24798300-T-A p.Gly497Gly synonymous ADCY4 3 82350 3.64299E-5 41175 0 NA
14-24798302-C-T p.Gly497Arg missense ADCY4 3 82376 3.64184E-5 41188 0 5.03525E-4
14-24798303-G-A p.His496His synonymous ADCY4 4 82372 4.85602E-5 41186 0 1.9162E-4
14-24798333-G-A p.Gly486Gly synonymous ADCY4 14 82692 1.69303E-4 41346 0 1.59229E-5
14-24798336-C-T p.Trp485* stop_gained ADCY4 2 82740 2.41721E-5 41370 0 1.65125E-5
14-24798347-G-A p.Leu482Leu synonymous ADCY4 26 82904 3.13616E-4 41452 0 0.00100705
14-24798352-C-T p.Arg480His missense ADCY4 1 82920 1.20598E-5 41460 0 8.25805E-6
14-24798352-C-A p.Arg480Leu missense ADCY4 1 82920 1.20598E-5 41460 0 3.98026E-6
14-24798353-G-A p.Arg480Cys missense ADCY4 2 82916 2.41208E-5 41458 0 1.65169E-5
14-24798368-A-G p.Ser475Pro missense ADCY4 1 83004 1.20476E-5 41502 0 NA
14-24798370-G-A p.Pro474Leu missense ADCY4 1 83002 1.20479E-5 41501 0 6.60884E-5
14-24798372-A-C p.Arg473Arg synonymous ADCY4 1 83000 1.20482E-5 41500 0 NA
14-24798376-A-G p.Met472Thr missense ADCY4 1 83034 1.20433E-5 41517 0 NA
14-24798380-T-C p.Lys471Glu missense ADCY4 2 83056 2.40801E-5 41528 0 NA
14-24798383-G-T p.Leu470Ile missense ADCY4 1 83044 1.20418E-5 41522 0 NA
14-24798387-C-T p.Glu468Glu synonymous ADCY4 1 83066 1.20386E-5 41533 0 6.38733E-5
14-24798387-CT-C p.Glu468fs frameshift ADCY4 1 83066 1.20386E-5 41533 0 NA
14-24798388-T-C p.Glu468Gly missense ADCY4 4 83070 4.81522E-5 41535 0 5.03525E-4
14-24798393-C-T p.Ser466Ser synonymous ADCY4 63 83060 7.58488E-4 41530 0 0.0020141
14-24798394-G-A p.Ser466Leu missense ADCY4 1 83062 1.20392E-5 41531 0 4.13866E-5
14-24798400-A-G p.Leu464Pro missense ADCY4 3 83076 3.61115E-5 41538 0 2.48468E-5
14-24798401-G-A p.Leu464Leu synonymous ADCY4 1 83086 1.20357E-5 41543 0 3.98397E-6
14-24798412-G-A p.Ala460Val missense ADCY4 1 83100 1.20337E-5 41550 0 NA
14-24798415-G-C p.Thr459Ser missense ADCY4 2 83090 2.40703E-5 41545 0 NA
14-24798428-C-T p.Asp455Asn missense ADCY4 1 83076 1.20372E-5 41538 0 8.32099E-6
14-24798429-C-T p.Glu454Glu synonymous ADCY4 6 83076 7.2223E-5 41538 0 2.55379E-4
14-24798433-T-A p.Glu453Val missense ADCY4 426 83044 0.00512981 41522 2 0.00755287
14-24798441-C-CCG c.1351-2_1351-1insCG splice_acceptor ADCY4 2 83032 2.40871E-5 41516 0 NA
14-24798608-C-T p.Arg450Gln missense+splice_region ADCY4 4 83104 4.81325E-5 41552 0 5.71363E-5
14-24798615-C-T p.Asp448Asn missense ADCY4 1 83112 1.2032E-5 41556 0 4.51565E-5
14-24798616-G-A p.Ile447Ile synonymous ADCY4 7 83120 8.42156E-5 41560 0 2.2433E-4
14-24798636-C-A p.Glu441* stop_gained ADCY4 1 83162 1.20247E-5 41581 0 NA
14-24798637-C-T p.Gly440Gly synonymous ADCY4 1 83168 1.20239E-5 41584 0 NA
14-24798642-G-C p.Leu439Val missense ADCY4 1 83150 1.20265E-5 41575 0 4.697E-6
14-24798647-C-G p.Arg437Pro missense ADCY4 1 83152 1.20262E-5 41576 0 NA
14-24798653-T-C p.Tyr435Cys missense ADCY4 2 83150 2.40529E-5 41575 0 5.03525E-4
14-24798657-G-T p.Pro434Thr missense ADCY4 2 83152 2.40523E-5 41576 0 9.60307E-5
14-24798658-G-T p.Asp433Glu missense ADCY4 1 83138 1.20282E-5 41569 0 NA
14-24798662-C-T p.Arg432Gln missense ADCY4 1 83124 1.20302E-5 41562 0 3.56621E-5
14-24798663-G-A p.Arg432Trp missense ADCY4 1 83118 1.20311E-5 41559 0 1.9232E-4
14-24798665-T-C p.His431Arg missense ADCY4 1 83134 1.20288E-5 41567 0 1.81158E-5
14-24798673-G-T p.Ala439Glu missense ADCY4 8 83114 9.62533E-5 41557 0 9.59939E-5
14-24798687-C-A p.Val424Leu missense ADCY4 2 83050 2.40819E-5 41525 0 9.31732E-6
14-24798695-G-A p.Ala421Val missense ADCY4 1 83004 1.20476E-5 41502 0 NA
14-24798696-C-A p.Ala421Ser missense ADCY4 1 83020 1.20453E-5 41510 0 1.78336E-5
14-24798709-G-A p.Pro427Leu missense ADCY4 2 82912 2.4122E-5 41456 0 3.19366E-5
14-24798720-C-A p.Ala413Ser missense ADCY4 2 82808 2.41523E-5 41404 0 8.99637E-6
14-24798737-C-T p.Arg407Gln missense+splice_region ADCY4 1 82530 1.21168E-5 41265 0 2.24298E-5
14-24798738-G-A p.Arg407* stop_gained ADCY4 1 82486 1.21233E-5 41243 0 3.19714E-5
14-24798740-C-CCTGGTACACCGCCTGCCTCCA c.1218-2_1218-1insTGGAGGCAGGCGGTGTACCAG splice_acceptor ADCY4 1 82470 1.21256E-5 41235 0 NA
14-24798740-C-CCTGGTACACCGCCTGCCTCCATGTGGTTAGCCAG c.1218-2_1218-1insCTGGCTAACCACATGGAGGCAGGCGGTGTACCAG splice_acceptor ADCY4 1 82470 1.21256E-5 41235 0 NA
14-24798741-T-G c.1218-2A>C splice_acceptor ADCY4 1 82428 1.21318E-5 41214 0 NA
14-24798742-G-C c.1218-3C>G splice_region ADCY4 1 82398 1.21362E-5 41199 0 NA
14-24799065-C-A c.1217+1G>T splice_donor ADCY4 1 82302 1.21504E-5 41151 0 NA
14-24799066-C-T p.Gly406Glu missense+splice_region ADCY4 2 82326 2.42937E-5 41163 0 NA
14-24799067-C-G p.Gly406Arg missense+splice_region ADCY4 1 82350 1.21433E-5 41175 0 2.79917E-5
14-24799076-C-T p.Gly403Ser missense ADCY4 2 82484 2.42471E-5 41242 0 1.66656E-5
14-24799083-C-T p.Arg411Lys missense ADCY4 18 82726 2.17586E-4 41363 0 1.99184E-4
14-24799091-G-A p.His398Tyr missense ADCY4 1 82878 1.20659E-5 41439 0 NA
14-24799103-T-C p.Thr394Ala missense ADCY4 1 83022 1.2045E-5 41511 0 NA
14-24799104-G-C p.Ser404* stop_gained ADCY4 1 83026 1.20444E-5 41513 0 4.95229E-5
14-24799121-C-T p.Val388Ile missense ADCY4 3 83132 3.60872E-5 41566 0 3.18274E-5
14-24799125-G-A p.Arg212* stop_gained ADCY4 2 83152 2.40523E-5 41576 0 5.96744E-5
14-24799125-G-C p.Tyr386* stop_gained ADCY4 2 83152 2.40523E-5 41576 0 8.24606E-6
14-24799130-G-A p.Gln385* stop_gained ADCY4 1 83174 1.2023E-5 41587 0 1.649E-5
14-24799145-C-G p.Gly380Arg missense ADCY4 3 83196 3.60594E-5 41598 0 7.95665E-6
14-24799146-G-A p.Ser390Leu missense ADCY4 376 83188 0.00451988 41594 2 0.00376276
14-24799163-C-T p.Val374Ile missense ADCY4 1 83202 1.20189E-5 41601 0 3.18715E-5
14-24799164-G-T p.Ser373Arg missense ADCY4 176 83184 0.00211579 41592 0 0.00302895
14-24799164-G-A p.Ala384Val missense ADCY4 6 83188 7.21258E-5 41594 0 8.35608E-5
14-24799166-T-C p.Ser373Gly missense ADCY4 2 83192 2.40408E-5 41596 0 1.59161E-5
14-24799174-T-G p.His370Pro missense ADCY4 1 83204 1.20187E-5 41602 0 NA
14-24799178-C-T p.Val369Met missense ADCY4 2 83206 2.40367E-5 41603 0 1.649E-5
14-24799179-G-A p.Ala379Val missense ADCY4 3 83196 3.60594E-5 41598 0 1.19436E-5
14-24799182-C-T p.Trp378* stop_gained ADCY4 12 83214 1.44206E-4 41607 0 3.18492E-5
14-24799186-C-T p.Arg366His missense ADCY4 2 83204 2.40373E-5 41602 0 6.36983E-5
14-24799187-G-A p.Arg366Cys missense ADCY4 1 83210 1.20178E-5 41605 0 3.29897E-5
14-24799203-G-A p.Ala371Val missense ADCY4 8 83196 9.61585E-5 41598 0 6.6096E-5
14-24799215-C-T p.Gly367Glu missense ADCY4 1 83152 1.20262E-5 41576 0 1.99505E-5
14-24799216-C-T p.Arg356Gln missense ADCY4 1 83138 1.20282E-5 41569 0 1.99532E-5
14-24799217-G-A p.Arg356Trp missense ADCY4 5 83116 6.01569E-5 41558 0 3.31148E-5
14-24799218-C-T p.Cys366Tyr missense ADCY4 6 83118 7.21865E-5 41559 0 9.55718E-5
14-24799229-G-A c.1059-5C>T splice_region ADCY4 1 83100 1.20337E-5 41550 0 NA
14-24799231-A-G c.1059-7T>C splice_region ADCY4 3 83084 3.6108E-5 41542 0 1.27551E-4
14-24799231-A-AGT c.1059-9_1059-8dupAC splice_region ADCY4 9 83084 1.08324E-4 41542 0 6.67958E-5
14-24799231-A-T c.1059-7T>A splice_region ADCY4 1 83084 1.2036E-5 41542 0 NA
14-24799232-G-A c.1059-8C>T splice_region ADCY4 1 83074 1.20375E-5 41537 0 2.50731E-5
14-24799232-G-C c.1059-8C>G splice_region ADCY4 1 83074 1.20375E-5 41537 0 NA
14-24799368-G-A c.1058+6C>T splice_region ADCY4 1 82876 1.20662E-5 41438 0 NA
14-24799369-C-G c.1058+5G>C splice_region ADCY4 2 82884 2.41301E-5 41442 0 3.1841E-5
14-24799373-C-T c.1058+1G>A splice_donor ADCY4 3 82916 3.61812E-5 41458 0 2.39225E-5
14-24799379-G-T p.Pro362Gln missense ADCY4 23 82940 2.77309E-4 41470 0 9.36427E-4
14-24799383-C-T p.Arg350Gln missense ADCY4 10 82964 1.20534E-4 41482 0 7.96857E-5
14-24799384-G-A p.Arg350Trp missense ADCY4 1 82958 1.20543E-5 41479 0 6.37186E-5
14-24799404-C-T p.Arg343His missense ADCY4 21 83046 2.52872E-4 41523 0 5.03525E-4
14-24799405-G-A p.Arg343Cys missense ADCY4 4 83040 4.81696E-5 41520 0 7.41693E-5
14-24799408-C-T p.Val342Met missense ADCY4 2 83066 2.40772E-5 41533 0 8.24022E-6
14-24799418-G-A p.Pro349Leu missense ADCY4 1 83138 1.20282E-5 41569 0 NA
14-24799424-G-A p.Thr347Ile missense ADCY4 20 83132 2.40581E-4 41566 0 7.15916E-5
14-24799431-A-T p.Leu334Gln missense ADCY4 3 83166 3.60724E-5 41583 1 8.23873E-6
14-24799455-C-T p.Cys326Tyr missense ADCY4 1 83162 1.20247E-5 41581 0 NA
14-24799469-C-A p.Gly332Val missense ADCY4 2 83180 2.40442E-5 41590 0 1.64794E-5
14-24799485-C-T p.Arg316Gln missense ADCY4 8 83184 9.61723E-5 41592 0 7.41681E-5
14-24799495-C-G p.Glu313Gln missense ADCY4 1 83152 1.20262E-5 41576 0 NA
14-24799501-C-T p.Glu311Lys missense+splice_region ADCY4 2 83082 2.40726E-5 41541 0 1.64859E-5
14-24799506-G-T p.Pro320Thr missense ADCY4 41 83072 4.93548E-4 41536 0 3.0237E-4
14-24799512-G-A p.His318Tyr missense ADCY4 6 82962 7.23223E-5 41481 0 1.19415E-5
14-24799529-G-A p.Pro312Leu missense ADCY4 1 82720 1.2089E-5 41360 0 3.98578E-6
14-24799537-GT-G c.931-5delA splice_region ADCY4 1 82524 1.21177E-5 41262 0 NA
14-24800226-T-C p.Lys310Glu missense+splice_region ADCY4 1 83116 1.20314E-5 41558 0 NA
14-24800230-A-C p.Ile308Met missense ADCY4 2 83150 2.40529E-5 41575 0 NA
14-24800238-C-T p.Asp306Asn missense ADCY4 1 83178 1.20224E-5 41589 0 8.61282E-6
14-24800251-G-C p.Ser37Cys missense ADCY4 1 83200 1.20192E-5 41600 0 3.18756E-5
14-24800257-A-T p.Asn299Lys missense ADCY4 5 83208 6.00904E-5 41604 0 NA
14-24800258-T-C p.Asn299Ser missense ADCY4 3 83202 3.60568E-5 41601 0 3.18735E-5
14-24800266-G-A p.Ser32Leu missense ADCY4 5 83210 6.00889E-5 41605 0 6.25E-4
14-24800268-G-T p.Cys31* stop_gained ADCY4 41 83204 4.92765E-4 41602 0 0.0075
14-24800291-T-C p.Glu288Gly missense ADCY4 2 83208 2.40361E-5 41604 0 NA
14-24800298-C-G p.Ala286Pro missense ADCY4 3 83174 3.6069E-5 41587 0 1.19525E-5
14-24800303-C-T p.Arg284Gln missense ADCY4 2 83176 2.40454E-5 41588 0 3.18857E-5
14-24800304-G-A p.Arg284Trp missense ADCY4 3 83188 3.60629E-5 41594 0 2.48546E-5
14-24800305-C-T p.Arg19His missense ADCY4 2 83194 2.40402E-5 41597 0 8.28349E-6
14-24800317-G-A p.Ser15Leu missense ADCY4 8 83188 9.61677E-5 41594 0 9.56206E-5
14-24800327-T-C p.Tyr276Cys missense ADCY4 1 83178 1.20224E-5 41589 0 NA
14-24800329-C-T p.Cys11Tyr missense ADCY4 3 83168 3.60716E-5 41584 0 3.18674E-5
14-24800334-C-T p.Val274Met missense+splice_region ADCY4 18 83130 2.16528E-4 41565 0 3.82555E-4
14-24800335-GCTGCATAGGGCAGACTGTGTCAGCAGGGCCAGGGTCTTAGCCCACAGGCCCCTCCCCTCCAGCCATTCTTCCTCATAC-G c.818+1_819-1delGTATGAGGAAGAATGGCTGGAGGGGAGGGGCCTGTGGGCTAAGACCCTGGCCCTGCTGACACAGTCTGCCCTATGCAG splice_acceptor ADCY4 7 83118 8.42176E-5 41559 0 NA
14-24800335-G-T p.Ser273Arg missense+splice_region ADCY4 1 83118 1.20311E-5 41559 0 NA
14-24800337-T-A c.819-2A>T splice_acceptor ADCY4 1 83132 1.20291E-5 41566 0 NA
14-24800407-C-T c.818+7G>A splice_region ADCY4 7 83158 8.41771E-5 41579 0 3.97836E-5
14-24800409-C-T c.818+5G>A splice_region ADCY4 1 83148 1.20267E-5 41574 0 NA
14-24800410-A-C c.818+4T>G splice_region ADCY4 8 83154 9.6207E-5 41577 0 6.25E-4
14-24800411-T-C c.818+3A>G splice_region ADCY4 5 83154 6.01294E-5 41577 0 1.98912E-5
14-24800431-C-T p.Arg3Lys missense ADCY4 1 83228 1.20152E-5 41614 0 4.77616E-4
14-24800436-C-T p.Met1? start_lost ADCY4 1 83232 1.20146E-5 41616 0 NA
14-24800437-A-G p.Met1? start_lost ADCY4 1 83234 1.20143E-5 41617 0 3.97703E-6
14-24800437-A-T p.Met1? start_lost ADCY4 1 83234 1.20143E-5 41617 0 4.78011E-4
14-24800452-A-T p.Asn260Lys missense ADCY4 1 83240 1.20135E-5 41620 0 NA
14-24800454-T-C p.Asn260Asp missense ADCY4 1 83240 1.20135E-5 41620 0 NA
14-24800464-C-T p.Glu256Glu synonymous ADCY4 1 83248 1.20123E-5 41624 0 NA
14-24800466-C-T p.Glu256Lys missense ADCY4 2 83246 2.40252E-5 41623 0 NA
14-24800467-T-C p.Pro255Pro synonymous ADCY4 4 83242 4.80527E-5 41621 0 NA
14-24800472-G-A p.Arg254Trp missense ADCY4 13 83228 1.56197E-4 41614 0 1.27453E-4
14-24800478-C-T p.Gly252Arg missense ADCY4 16 83246 1.92201E-4 41623 0 9.55779E-5
14-24800489-T-C p.Gln248Arg missense ADCY4 1 83248 1.20123E-5 41624 0 NA
14-24800491-C-T p.Leu247Leu synonymous ADCY4 9 83244 1.08116E-4 41622 0 6.25E-4
14-24800494-C-CCTTCATCTCTGCCTTCATCTCT p.Leu247fs frameshift ADCY4 1 83238 1.20137E-5 41619 0 NA
14-24800495-C-T p.Arg246Gln missense ADCY4 3 83224 3.60473E-5 41612 0 6.37227E-5
14-24800496-G-A p.Arg246Trp missense ADCY4 3 83226 3.60464E-5 41613 0 1.64766E-5
14-24800500-C-T p.Met244Ile missense ADCY4 4 83242 4.80527E-5 41621 0 1.72999E-4
14-24800501-A-T p.Met244Lys missense ADCY4 7 83234 8.41002E-5 41617 0 5.68435E-4
14-24800519-T-C p.Glu238Gly missense ADCY4 2 83186 2.40425E-5 41593 0 3.97785E-6
14-24800520-C-T p.Glu238Lys missense ADCY4 2 83188 2.40419E-5 41594 0 NA
14-24800522-C-T p.Arg237Gln missense ADCY4 6 83162 7.21483E-5 41581 0 3.18512E-5
14-24800523-G-A p.Arg237* stop_gained ADCY4 1 83142 1.20276E-5 41571 0 4.77422E-5
14-24800523-G-C p.Arg237Gly missense ADCY4 2 83142 2.40552E-5 41571 0 1.98926E-5
14-24800524-G-T p.Ala236Ala synonymous ADCY4 2 83132 2.40581E-5 41566 0 NA
14-24800528-A-G p.Leu235Pro missense ADCY4 2 83094 2.40691E-5 41547 0 NA
14-24800559-G-A p.His225Tyr missense ADCY4 2 82158 2.43433E-5 41079 0 NA
14-24800990-T-TGACCTGGTGCTTCTTCTCGGTGTCCAGCC c.644_669+3dupGGCTGGACACCGAGAAGAAGCACCAGGTC splice_region ADCY4 9 81472 1.10467E-4 40736 0 1.91205E-4
14-24801008-C-T p.Glu219Lys missense ADCY4 2 81696 2.4481E-5 40848 0 NA
14-24801009-G-A c.-140C>T 5_prime_UTR_premature_start_codon_gain ADCY4 75 81714 9.17835E-4 40857 0 6.25207E-4
14-24801011-T-A p.Thr218Ser missense ADCY4 1 81706 1.2239E-5 40853 0 NA
14-24801018-C-A p.Arg215Arg synonymous ADCY4 1 81800 1.22249E-5 40900 0 NA
14-24801018-C-T p.Arg215Arg synonymous ADCY4 1 81800 1.22249E-5 40900 0 NA
14-24801022-C-T p.Arg214Gln missense ADCY4 1 81824 1.22214E-5 40912 0 4.08227E-6
14-24801035-G-A c.-166C>T 5_prime_UTR_premature_start_codon_gain ADCY4 1 81974 1.2199E-5 40987 0 NA
14-24801036-G-A p.Ser209Ser synonymous ADCY4 1 81976 1.21987E-5 40988 0 1.21044E-5
14-24801042-G-A p.Leu207Leu synonymous ADCY4 1 81898 1.22103E-5 40949 0 NA
14-24801045-T-A p.Ala206Ala synonymous ADCY4 1173 81820 0.0143363 40910 61 0.0318559
14-24801052-C-T p.Arg204Gln missense ADCY4 4 81750 4.89297E-5 40875 0 6.37511E-5
14-24801053-G-A p.Arg204Trp missense ADCY4 9 81738 1.10108E-4 40869 0 6.25E-4
14-24801057-C-A p.Thr202Thr synonymous ADCY4 1 81708 1.22387E-5 40854 0 8.9844E-6
14-24801060-G-A p.Ala201Ala synonymous ADCY4 2 81728 2.44714E-5 40864 0 NA
14-24801074-G-A p.Arg197Cys missense ADCY4 2 81692 2.44822E-5 40846 0 1.21769E-5
14-24801081-C-T p.Leu194Leu synonymous ADCY4 1 81826 1.22211E-5 40913 0 NA
14-24801089-T-C p.Lys192Glu missense ADCY4 6 81760 7.33855E-5 40880 0 0.00125
14-24801113-C-A p.Gly184Trp missense ADCY4 1 81358 1.22914E-5 40679 0 8.41432E-6
14-24801443-CTT-C n.1350_1351delAA splice_region ADCY4 50 14262 0.00350582 7131 3 0.00232074
14-24801443-CT-C n.1351delA splice_region ADCY4 1938 11874 0.163214 5937 185 0.350672
14-24801443-C-CT n.1351dupA splice_region ADCY4 13 14216 9.14463E-4 7108 0 0.00684219
14-24801443-CTTT-C n.1349_1351delAAA splice_region ADCY4 4 14326 2.79213E-4 7163 0 NA
14-24801443-CTTTT-C n.1348_1351delAAAA splice_region ADCY4 2 14344 1.39431E-4 7172 0 NA
14-24801443-CTTTTTTTT-C n.1344_1351delAAAAAAAA splice_region ADCY4 2 14348 1.39392E-4 7174 0 NA
14-24801731-C-A p.Pro172Pro synonymous ADCY4 1 71124 1.406E-5 35562 0 3.18654E-5
14-24801739-G-A c.-286C>T 5_prime_UTR_premature_start_codon_gain ADCY4 3 73092 4.10442E-5 36546 0 1.27478E-4
14-24801745-G-T p.Pro36Thr missense+splice_region ADCY4 1 74144 1.34873E-5 37072 0 0.0010142
14-24801756-G-A p.Pro164Leu missense ADCY4 1 76054 1.31486E-5 38027 0 4.36453E-5
14-24801760-G-A p.Gln163* stop_gained ADCY4 1 76952 1.29951E-5 38476 0 NA
14-24801768-A-G p.Leu160Pro missense ADCY4 1 77944 1.28297E-5 38972 0 3.18512E-5
14-24801778-C-T p.Gly157Arg missense ADCY4 1 78790 1.2692E-5 39395 0 1.57307E-4
14-24801779-G-A c.-326C>T 5_prime_UTR_premature_start_codon_gain ADCY4 1 78920 1.26711E-5 39460 0 9.55171E-5
14-24801782-G-A p.Val155Val synonymous ADCY4 1 79168 1.26314E-5 39584 0 NA
14-24801783-A-G p.Val155Ala missense ADCY4 1 79180 1.26295E-5 39590 0 6.36943E-5
14-24801785-C-A c.-332G>T 5_prime_UTR_premature_start_codon_gain ADCY4 2 79402 2.51883E-5 39701 0 3.1839E-5
14-24801790-G-A c.-337C>T 5_prime_UTR_premature_start_codon_gain ADCY4 1 79752 1.25389E-5 39876 0 NA
14-24801792-TGCGAGA-T p.Leu150_Ser151del disruptive_inframe_deletion ADCY4 1 79808 1.25301E-5 39904 0 NA
14-24801794-C-T p.Ser151Ser synonymous ADCY4 1 79862 1.25216E-5 39931 0 3.7037E-5
14-24801795-G-A p.Ser151Leu missense ADCY4 1 79978 1.25034E-5 39989 0 2.0971E-5
14-24801816-G-T p.Ala144Glu missense ADCY4 2 80536 2.48336E-5 40268 0 NA
14-24801820-C-G p.Val143Leu missense ADCY4 2 80566 2.48244E-5 40283 0 NA
14-24801821-G-A c.-368C>T 5_prime_UTR_premature_start_codon_gain ADCY4 1 80596 1.24076E-5 40298 0 1.03167E-5
14-24801822-G-A p.Ala142Val missense ADCY4 2 80590 2.4817E-5 40295 0 NA
14-24801824-G-A c.-371C>T 5_prime_UTR_premature_start_codon_gain ADCY4 2 80568 2.48238E-5 40284 0 0.00152439
14-24801835-T-A p.Met138Leu missense ADCY4 1 80724 1.23879E-5 40362 0 NA
14-24801839-C-A p.Leu136Phe missense ADCY4 1 80794 1.23772E-5 40397 0 5.00912E-6
14-24801841-A-C p.Leu136Val missense ADCY4 2 80782 2.4758E-5 40391 0 3.26477E-4
14-24801849-A-G p.Met1? start_lost ADCY4 1 80810 1.23747E-5 40405 0 NA
14-24801854-A-C p.Tyr131* stop_gained ADCY4 1 80790 1.23778E-5 40395 0 NA
14-24801855-T-C p.Tyr131Cys missense ADCY4 1 80756 1.2383E-5 40378 0 NA
14-24801861-G-A p.Thr129Met missense ADCY4 1 80656 1.23983E-5 40328 0 3.1837E-5
14-24801886-ACACCTGGGGGCGGGGCGCGGGAAGCCGAAGGCCCAAGTGGGGCTATTCAAGGCCTGGTGAGGGATCGAAGCCCGGGCCGTCCCCGCTGCCCCGCCTGCCGCCCCTCT-A p.Val120_Ser121del splice_acceptor ADCY4 5 80002 6.24984E-5 40001 0 NA
14-24801928-G-T c.-78C>A splice_region ADCY4 1 76230 1.31182E-5 38115 0 NA
14-24802012-C-T p.Val114Val synonymous ADCY4 1 72746 1.37465E-5 36373 0 NA
14-24802018-G-A p.Gly112Gly synonymous ADCY4 977 72376 0.0134989 36188 90 0.115166
14-24802023-C-T p.Gly111Arg missense ADCY4 2 72934 2.74221E-5 36467 0 NA
14-24802024-G-A c.-464C>T 5_prime_UTR_premature_start_codon_gain ADCY4 1 72944 1.37091E-5 36472 0 3.18613E-5
14-24802037-G-C p.Ala106Gly missense ADCY4 14 73318 1.90949E-4 36659 0 8.32408E-5
14-24802052-A-G p.Leu101Pro missense ADCY4 2 74432 2.68702E-5 37216 0 NA
14-24802054-C-A p.Leu100Leu synonymous ADCY4 1 74376 1.34452E-5 37188 0 9.5584E-5
14-24802063-C-G p.Trp97Cys missense ADCY4 1 75046 1.33252E-5 37523 0 NA
14-24802065-A-G p.Trp97Arg missense ADCY4 1 75304 1.32795E-5 37652 0 1.29171E-5
14-24802075-G-C p.Ser93Ser synonymous ADCY4 10 75884 1.3178E-4 37942 0 1.03101E-4
14-24802086-G-A p.Arg90Cys missense ADCY4 2 75988 2.63199E-5 37994 0 3.39889E-5
14-24802099-C-T p.Leu85Leu synonymous ADCY4 1 77176 1.29574E-5 38588 0 NA
14-24802103-C-T p.Arg84Gln missense ADCY4 3 77304 3.88078E-5 38652 0 NA
14-24802112-C-G p.Arg81Pro missense ADCY4 1 77902 1.28366E-5 38951 0 2.48857E-5
14-24802115-G-A p.Ser80Phe missense ADCY4 1 78100 1.28041E-5 39050 0 2.06925E-5
14-24802119-C-G p.Ala79Pro missense ADCY4 1 78246 1.27802E-5 39123 0 3.73968E-5
14-24802120-G-A c.-560C>T 5_prime_UTR_premature_start_codon_gain ADCY4 1 78332 1.27662E-5 39166 0 8.28336E-6
14-24802121-A-AG p.Leu78fs frameshift ADCY4 1 78432 1.27499E-5 39216 0 NA
14-24802141-G-A p.Gly71Gly synonymous ADCY4 1 79026 1.26541E-5 39513 0 9.18358E-6
14-24802144-G-A p.Gly70Gly synonymous ADCY4 2 79042 2.5303E-5 39521 0 9.55353E-5
14-24802164-T-G p.Thr64Pro missense ADCY4 1 79448 1.25868E-5 39724 0 3.19061E-5
14-24802165-G-A p.Thr63Thr synonymous ADCY4 1 79434 1.25891E-5 39717 0 NA
14-24802175-C-T p.Ser60Asn missense ADCY4 1 79216 1.26237E-5 39608 0 NA
14-24802181-T-C p.Asp58Gly missense ADCY4 5 79004 6.32879E-5 39502 0 2.00698E-5
14-24802186-G-A p.Thr56Thr synonymous ADCY4 1 78946 1.26669E-5 39473 0 NA
14-24802187-G-C p.Thr56Ser missense ADCY4 37 78850 4.69245E-4 39425 0 0.00125
14-24802191-G-T p.Leu55Met missense ADCY4 2 78640 2.54323E-5 39320 0 1.88661E-5
14-24802198-T-TTACTGGATTTGGCTCC c.160-5_160-4insGGAGCCAAATCCAGTA splice_region ADCY4 1 78448 1.27473E-5 39224 0 NA
14-24803705-C-T p.Gly52Ser missense ADCY4 2 56758 3.52373E-5 28379 0 5.78737E-5
14-24803710-G-A p.Ala50Val missense ADCY4 895 56450 0.0158547 28225 14 0.0320781
14-24803718-C-T p.Val47Val synonymous ADCY4 2 56470 3.5417E-5 28235 0 8.40477E-5
14-24803722-G-T p.Ala46Glu missense ADCY4 1 56068 1.78355E-5 28034 0 6.37389E-5
14-24803724-G-A c.-659C>T 5_prime_UTR_premature_start_codon_gain ADCY4 6 55810 1.07508E-4 27905 0 2.81136E-5
14-24803736-G-A c.-671C>T 5_prime_UTR_premature_start_codon_gain ADCY4 61 54560 0.00111804 27280 0 0.00204082
14-24803740-G-C p.Ala40Gly missense ADCY4 1 54218 1.84441E-5 27109 0 2.83833E-5
14-24803756-CCAG-C p.Leu34del conservative_inframe_deletion ADCY4 58 52286 0.00110928 26143 0 0.0370935
14-24803756-C-CCAG p.Leu34dup conservative_inframe_insertion ADCY4 2 53426 3.7435E-5 26713 0 1.69469E-4
14-24803775-C-T p.Pro28Pro synonymous ADCY4 1 51438 1.94409E-5 25719 0 3.19081E-5
14-24803793-G-T p.Ser22Arg missense ADCY4 1 50356 1.98586E-5 25178 0 NA
14-24803802-G-T p.Thr19Thr synonymous ADCY4 1 49878 2.00489E-5 24939 0 1.18287E-5
14-24803825-T-TG p.Ser12fs frameshift ADCY4 1 47216 2.11793E-5 23608 0 1.2971E-5
14-24803826-G-A p.Pro11Pro synonymous ADCY4 1 47570 2.10217E-5 23785 0 NA
14-24803827-G-C p.Pro11Arg missense ADCY4 1 47552 2.10296E-5 23776 0 NA
14-24803833-G-A p.Pro9Leu missense ADCY4 1 46944 2.1302E-5 23472 0 NA
14-24803834-G-C p.Pro9Ala missense ADCY4 1 46736 2.13968E-5 23368 0 NA
14-24803840-G-A p.Pro7Ser missense ADCY4 2 46344 4.31555E-5 23172 0 0.00103734
14-24803851-C-T p.Arg3His missense ADCY4 1 45170 2.21386E-5 22585 0 3.58156E-5
14-24803883-G-C c.-25C>G splice_region ADCY4 2 42556 4.69969E-5 21278 0 4.66309E-4
14-24803885-C-A c.-26-1G>T splice_acceptor ADCY4 91 42352 0.00214866 21176 2 0.00515497
14-24803886-T-A c.-26-2A>T splice_acceptor ADCY4 37 42274 8.75242E-4 21137 0 0.00187354
14-24804088-A-T n.187+3T>A splice_region ADCY4 2183 13578 0.160775 6789 9 0.20091