Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
2-25042041-C-T c.*760G>A splice_region ADCY3 1 44742 2.23504E-5 22371 0 NA
2-25042805-G-T p.Ser1144Tyr missense ADCY3 1 81532 1.22651E-5 40766 0 7.5764E-5
2-25042811-TCCA-T p.Val1141del disruptive_inframe_deletion ADCY3 1 81486 1.2272E-5 40743 0 NA
2-25042813-C-T p.Val1141Val synonymous ADCY3 2 81620 2.45038E-5 40810 0 3.18613E-5
2-25042814-A-G p.Val1141Ala missense ADCY3 1 81402 1.22847E-5 40701 0 3.18817E-5
2-25042815-C-G p.Val1141Leu missense ADCY3 1 81634 1.22498E-5 40817 0 NA
2-25042832-G-A p.Thr1135Ile missense ADCY3 3 81962 3.66023E-5 40981 0 1.59942E-5
2-25042838-G-T p.Ser1133Tyr missense ADCY3 3 82008 3.65818E-5 41004 0 1.59939E-5
2-25042838-G-C p.Ser1133Cys missense ADCY3 2 82008 2.43879E-5 41004 0 3.18674E-5
2-25042840-G-A p.Pro1132Pro synonymous ADCY3 1 82148 1.21732E-5 41074 0 1.67165E-5
2-25042846-A-G p.Asn1130Asn synonymous ADCY3 28 82110 3.41006E-4 41055 0 0.00201613
2-25042848-T-G p.Asn1130His missense ADCY3 4 82128 4.87045E-5 41064 0 4.00375E-6
2-25042856-G-C p.Thr1127Ser missense ADCY3 4 82126 4.87056E-5 41063 0 1.20146E-5
2-25042860-C-A p.Ala1126Ser missense ADCY3 1 82072 1.21844E-5 41036 0 8.3661E-6
2-25042870-C-G p.Arg1122Arg synonymous ADCY3 1 82532 1.21165E-5 41266 0 NA
2-25042872-G-A p.Arg1122Trp missense ADCY3 3 82556 3.6339E-5 41278 0 3.18979E-5
2-25042874-C-T p.Gly1121Glu missense ADCY3 1 82644 1.21001E-5 41322 0 8.36568E-6
2-25042876-C-T p.Lys1120Lys synonymous ADCY3 1 82664 1.20972E-5 41332 0 NA
2-25042879-CAAG-C p.Phe1118del disruptive_inframe_deletion ADCY3 1 82676 1.20954E-5 41338 0 4.18845E-5
2-25042886-AA-GT p.Phe1117Thr missense ADCY3 2 82716 2.41791E-5 41358 0 NA
2-25042905-TCC-T p.Gly1110fs frameshift ADCY3 1 82394 1.21368E-5 41197 0 NA
2-25042929-G-T p.Arg1103Arg synonymous ADCY3 3 81568 3.67791E-5 40784 0 3.1998E-5
2-25042940-C-T p.Arg1099His missense ADCY3 3 81322 3.68904E-5 40661 0 6.35526E-5
2-25042941-G-A p.Arg1099Cys missense ADCY3 7 81440 8.59529E-5 40720 0 5.04032E-4
2-25042947-C-T p.Gly1097Ser missense ADCY3 8 81518 9.81378E-5 40759 0 5.53128E-5
2-25042954-T-C p.Arg1094Arg synonymous ADCY3 1 81362 1.22908E-5 40681 0 NA
2-25042956-G-A p.Arg1094* stop_gained ADCY3 1 81314 1.2298E-5 40657 0 NA
2-25042978-T-C p.Ter49Trpext*? stop_lost ADCY3 1 80602 1.24066E-5 40301 0 NA
2-25042981-C-G p.Trp48Ser missense+splice_region ADCY3 2 80484 2.48497E-5 40242 0 2.72593E-5
2-25042986-G-GAATGTTGCCCATGACCCCCGTGGACTCCATCCTGCTGGCTACATT c.3253-4_3253-3insAATGTAGCCAGCAGGATGGAGTCCACGGGGGTCATGGGCAACATT splice_region ADCY3 1 80308 1.24521E-5 40154 0 NA
2-25043246-C-G c.140+7G>C splice_region ADCY3 18 35116 5.12587E-4 17558 0 1.96059E-4
2-25043248-G-A c.140+5C>T splice_region ADCY3 2 34996 5.71494E-5 17498 0 NA
2-25043295-T-G p.Glu33Ala missense ADCY3 1 37342 2.67795E-5 18671 0 6.37511E-5
2-25043296-C-T p.Glu33Lys missense ADCY3 2 37454 5.33988E-5 18727 0 9.56145E-5
2-25043316-C-T p.Arg26His missense ADCY3 2 39334 5.08466E-5 19667 0 6.37227E-5
2-25043317-G-A p.Arg26Cys missense ADCY3 3 39302 7.6332E-5 19651 0 1.02312E-4
2-25043318-C-T p.Trp25* stop_gained ADCY3 3 40622 7.38516E-5 20311 0 4.00673E-5
2-25043320-A-G p.Trp25Arg missense+splice_region ADCY3 2 41748 4.79065E-5 20874 0 NA
2-25043328-A-G c.73-8T>C splice_region ADCY3 1 43290 2.31E-5 21645 0 3.18593E-5
2-25043585-G-C c.3252+8C>G splice_region ADCY3 1 83368 1.1995E-5 41684 0 NA
2-25043588-C-A c.3252+5G>T splice_region ADCY3 3 83372 3.59833E-5 41686 0 3.98238E-6
2-25043606-A-G p.Met1080Thr missense ADCY3 2 83392 2.39831E-5 41696 0 0.00100705
2-25043610-C-T p.Val1079Ile missense ADCY3 79 83398 9.47265E-4 41699 0 9.56023E-4
2-25043614-C-T p.Thr1077Thr synonymous ADCY3 1 83402 1.19901E-5 41701 0 6.37471E-5
2-25043623-C-T p.Met1074Ile missense ADCY3 1 83404 1.19898E-5 41702 0 3.97753E-6
2-25043644-T-C p.Thr1067Thr synonymous ADCY3 1 83400 1.19904E-5 41700 0 1.64761E-5
2-25043645-G-C p.Thr1067Arg missense ADCY3 1 83400 1.19904E-5 41700 0 3.9769E-6
2-25043671-T-C p.Lys1058Lys synonymous ADCY3 1 83386 1.19924E-5 41693 0 1.27559E-4
2-25043675-C-T p.Arg1057Gln missense ADCY3 1 83388 1.19921E-5 41694 0 3.97741E-6
2-25043682-C-T p.Gly1055Arg missense ADCY3 1 83394 1.19913E-5 41697 0 3.97738E-6
2-25043683-G-A p.Ile1054Ile synonymous ADCY3 8 83392 9.59325E-5 41696 0 1.27551E-4
2-25043686-G-A p.Val1053Val synonymous ADCY3 1 83378 1.19936E-5 41689 0 5.03525E-4
2-25043689-C-A p.Gly1052Gly synonymous ADCY3 1 83386 1.19924E-5 41693 0 NA
2-25043702-C-T p.Gly1048Glu missense ADCY3 2 83382 2.3986E-5 41691 0 NA
2-25043704-G-A p.Gly1047Gly synonymous ADCY3 4 83370 4.79789E-5 41685 0 6.25E-4
2-25043710-G-GTT p.Asn1045fs frameshift ADCY3 2 83368 2.399E-5 41684 0 NA
2-25043713-C-A p.Met1044Ile missense ADCY3 2 83372 2.39889E-5 41686 0 3.18613E-5
2-25043713-C-T p.Met1044Ile missense ADCY3 1 83372 1.19944E-5 41686 0 0.001875
2-25043722-G-C c.3128-5C>G splice_region ADCY3 2 83364 2.39912E-5 41682 0 NA
2-25044378-G-T c.3127+8C>A splice_region ADCY3 1 82470 1.21256E-5 41235 0 8.27226E-6
2-25044380-G-C c.3127+6C>G splice_region ADCY3 2 82454 2.42559E-5 41227 0 2.48016E-5
2-25044383-C-T c.3127+3G>A splice_region ADCY3 2 82550 2.42277E-5 41275 0 3.98498E-6
2-25044388-A-G p.Ile1042Thr missense+splice_region ADCY3 1 82692 1.20931E-5 41346 0 1.59212E-5
2-25044389-T-C p.Ile1042Val missense ADCY3 1 82720 1.2089E-5 41360 0 NA
2-25044391-C-T p.Arg1041His missense ADCY3 2 82720 2.41779E-5 41360 0 3.18451E-5
2-25044399-G-A p.Phe1038Phe synonymous ADCY3 3 82922 3.61786E-5 41461 0 3.18492E-5
2-25044411-G-T p.Ser1034Ser synonymous ADCY3 2 83014 2.40923E-5 41507 1 NA
2-25044417-G-A p.Asn1032Asn synonymous ADCY3 627 82990 0.00755513 41495 2 0.00591455
2-25044419-T-C p.Asn1032Asp missense ADCY3 1 83044 1.20418E-5 41522 0 1.64829E-5
2-25044434-G-A p.Leu1027Phe missense ADCY3 4 83036 4.81719E-5 41518 0 NA
2-25044435-C-T p.Thr1026Thr synonymous ADCY3 2 83018 2.40912E-5 41509 0 0.00125
2-25044436-G-A p.Thr1026Met missense ADCY3 3 83028 3.61324E-5 41514 0 3.29614E-5
2-25044451-A-AGC p.Leu1021fs frameshift ADCY3 1 82994 1.20491E-5 41497 0 NA
2-25044453-C-T p.Ala1020Ala synonymous ADCY3 14 82950 1.68776E-4 41475 0 0.00250156
2-25044461-C-T p.Asp1018Asn missense ADCY3 1 82900 1.20627E-5 41450 0 6.25E-4
2-25044462-G-A p.Ala1017Ala synonymous ADCY3 1 82902 1.20624E-5 41451 0 6.37186E-5
2-25044482-G-A p.Gln1011* stop_gained ADCY3 1 82782 1.20799E-5 41391 0 NA
2-25044486-G-C p.Arg1009Arg synonymous ADCY3 3 82712 3.62704E-5 41356 0 1.59208E-5
2-25044491-C-G p.Glu1008Gln missense ADCY3 1 82638 1.2101E-5 41319 0 NA
2-25044495-C-T p.Glu1006Glu synonymous ADCY3 1 82580 1.21095E-5 41290 0 3.1839E-5
2-25044497-C-T p.Glu1006Lys missense ADCY3 1 82500 1.21212E-5 41250 0 1.99156E-5
2-25045374-A-C c.3003+6T>G splice_region ADCY3 3 83304 3.60127E-5 41652 0 1.91107E-4
2-25045377-T-C c.3003+3A>G splice_region ADCY3 3 83308 3.60109E-5 41654 0 3.18431E-5
2-25045383-G-T p.Asn1000Lys missense ADCY3 28 83342 3.35965E-4 41671 0 3.82117E-4
2-25045383-G-C p.Asn1000Lys missense ADCY3 1 83342 1.19988E-5 41671 0 NA
2-25045398-G-A p.Gly995Gly synonymous ADCY3 2 83360 2.39923E-5 41680 0 1.64769E-5
2-25045399-C-T p.Gly995Asp missense ADCY3 1 83364 1.19956E-5 41682 0 NA
2-25045401-A-G p.Asn994Asn synonymous ADCY3 6 83376 7.19632E-5 41688 0 8.74884E-5
2-25045409-T-C p.Asn992Asp missense ADCY3 1 83374 1.19941E-5 41687 0 NA
2-25045413-A-G p.Asp990Asp synonymous ADCY3 1 83364 1.19956E-5 41682 0 NA
2-25045415-C-T p.Asp990Asn missense ADCY3 3 83360 3.59885E-5 41680 0 3.18674E-5
2-25045415-C-G p.Asp990His missense ADCY3 4 83360 4.79846E-5 41680 0 NA
2-25045416-G-A p.Pro989Pro synonymous ADCY3 7 83380 8.3953E-5 41690 0 3.82239E-4
2-25045434-C-T p.Ala983Ala synonymous ADCY3 23 83376 2.75859E-4 41688 0 1.27551E-4
2-25045443-C-T p.Thr980Thr synonymous ADCY3 2 83372 2.39889E-5 41686 0 4.37407E-5
2-25045472-T-C p.Ile971Val missense ADCY3 3 83348 3.59937E-5 41674 0 6.37267E-5
2-25045478-G-A p.Arg969Trp missense ADCY3 2 83324 2.40027E-5 41662 0 4.94462E-5
2-25045483-T-A p.Lys967Met missense ADCY3 1 83296 1.20054E-5 41648 0 8.24144E-6
2-25045485-G-A p.Pro966Pro synonymous ADCY3 1 83292 1.2006E-5 41646 0 3.97681E-6
2-25045490-T-C p.Asn965Asp missense ADCY3 1 83260 1.20106E-5 41630 0 NA
2-25046090-T-C p.Ser957Ser synonymous ADCY3 54041 81334 0.664433 40667 18126 0.694226
2-25046093-G-A p.Ile956Ile synonymous ADCY3 3 83202 3.60568E-5 41601 0 8.24212E-6
2-25046099-T-C p.Glu954Glu synonymous ADCY3 1 83226 1.20155E-5 41613 0 1.64826E-5
2-25046123-A-T p.Ile946Ile synonymous ADCY3 1 83292 1.2006E-5 41646 0 8.23913E-6
2-25046132-A-G p.Asn943Asn synonymous ADCY3 1 83316 1.20025E-5 41658 0 8.23873E-6
2-25046159-G-A p.Asp934Asp synonymous ADCY3 1 83338 1.19993E-5 41669 0 1.27397E-4
2-25046162-A-G p.Ala933Ala synonymous ADCY3 1 83336 1.19996E-5 41668 0 1.64783E-5
2-25046180-G-A p.Ala927Ala synonymous ADCY3 1 83330 1.20005E-5 41665 0 8.23968E-6
2-25046191-C-T p.Val924Ile missense ADCY3 2 83322 2.40033E-5 41661 0 NA
2-25046196-A-G p.Ile922Thr missense ADCY3 2 83306 2.40079E-5 41653 0 1.19403E-5
2-25046206-ACGTCT-A p.Gln917fs frameshift ADCY3 1 83294 1.20057E-5 41647 0 NA
2-25046207-C-T p.Thr918Thr synonymous ADCY3 172 83278 0.00206537 41639 1 0.00382166
2-25046208-G-A p.Thr918Met missense ADCY3 1 83280 1.20077E-5 41640 0 7.1756E-5
2-25046212-G-GGA p.Gln917fs frameshift ADCY3 1 83266 1.20097E-5 41633 0 NA
2-25046222-C-T p.Glu913Glu splice_region+synonymous ADCY3 1 83196 1.20198E-5 41598 0 4.02671E-6
2-25046226-T-TC c.2737-3_2737-2insG splice_region ADCY3 1 83168 1.20239E-5 41584 0 NA
2-25046231-A-C c.2737-7T>G splice_region ADCY3 2 83122 2.4061E-5 41561 0 3.1839E-5
2-25047243-T-TCA c.2736+3_2736+4insTG splice_region ADCY3 2 83246 2.40252E-5 41623 0 2.78625E-5
2-25047247-C-T p.Glu912Glu splice_region+synonymous ADCY3 1 83292 1.2006E-5 41646 0 NA
2-25047284-A-C p.Val900Gly missense ADCY3 1 83362 1.19959E-5 41681 0 3.97687E-6
2-25047285-C-T p.Val900Met missense ADCY3 2 83362 2.39917E-5 41681 0 3.97697E-6
2-25047286-G-A p.His899His synonymous ADCY3 27 83370 3.23858E-4 41685 0 0.00302115
2-25047309-C-T p.Val892Ile missense ADCY3 1 83378 1.19936E-5 41689 0 NA
2-25047318-C-T p.Glu889Lys missense ADCY3 2 83382 2.3986E-5 41691 0 2.47125E-5
2-25047319-G-A p.Asn888Asn synonymous ADCY3 3 83384 3.59781E-5 41692 0 3.97649E-6
2-25047327-G-A p.Arg886Cys missense ADCY3 12 83386 1.43909E-4 41693 0 2.54745E-4
2-25047338-T-C p.Tyr882Cys missense ADCY3 1 83384 1.19927E-5 41692 0 7.95305E-6
2-25047344-C-T p.Arg880His missense ADCY3 1 83380 1.19933E-5 41690 0 8.23778E-6
2-25047346-T-A p.Glu879Asp missense ADCY3 2 83382 2.3986E-5 41691 0 NA
2-25047349-C-T p.Lys878Lys synonymous ADCY3 1 83378 1.19936E-5 41689 0 NA
2-25047352-C-T p.Gln877Gln synonymous ADCY3 1 83374 1.19941E-5 41687 0 NA
2-25047377-A-G p.Leu869Ser missense ADCY3 4 83368 4.798E-5 41684 0 2.47174E-5
2-25047388-C-G p.Arg865Arg synonymous ADCY3 1 83342 1.19988E-5 41671 0 3.18431E-5
2-25047390-G-A p.Arg865Trp missense ADCY3 2 83338 2.39987E-5 41669 0 NA
2-25047407-T-TGAGCATCATGAGGA c.2578-3_2578-2insTCCTCATGATGCTC splice_region ADCY3 1 83270 1.20091E-5 41635 0 NA
2-25047408-A-G c.2578-3T>C splice_region ADCY3 40928 80818 0.506422 40409 10541 0.551063
2-25047410-A-ACCATCACC c.2578-6_2578-5insGGTGATGG splice_region ADCY3 1 83258 1.20109E-5 41629 0 NA
2-25048914-G-A p.His859His splice_region+synonymous ADCY3 3 81334 3.68849E-5 40667 0 5.19045E-5
2-25048917-G-T p.Arg198Arg splice_region+synonymous ADCY3 6 81414 7.36974E-5 40707 0 3.99061E-5
2-25048919-G-A p.Arg858Cys missense ADCY3 2 81480 2.45459E-5 40740 0 8.49878E-6
2-25048924-A-T p.Phe856Tyr missense ADCY3 3 81282 3.69085E-5 40641 0 0.00100705
2-25048947-G-A p.Leu848Leu synonymous ADCY3 13 81792 1.5894E-4 40896 0 1.19504E-5
2-25048949-G-C p.Leu848Val missense ADCY3 1 81772 1.22291E-5 40886 0 NA
2-25048949-G-A p.Leu848Phe missense ADCY3 1 81772 1.22291E-5 40886 0 3.98273E-6
2-25048951-A-C p.Phe847Cys missense ADCY3 5 81728 6.11785E-5 40864 0 3.18756E-5
2-25048962-C-T p.Thr843Thr synonymous ADCY3 32 81686 3.91744E-4 40843 0 9.24686E-4
2-25048962-C-A p.Thr843Thr synonymous ADCY3 1 81692 1.22411E-5 40846 0 1.19506E-5
2-25048962-C-G p.Thr843Thr synonymous ADCY3 1 81692 1.22411E-5 40846 0 NA
2-25048963-G-A p.Thr843Met missense ADCY3 3 81702 3.67188E-5 40851 0 7.96686E-6
2-25048965-C-T p.Met842Ile missense ADCY3 26 81712 3.18191E-4 40856 0 3.66449E-4
2-25048967-T-C p.Met842Val missense ADCY3 1 81688 1.22417E-5 40844 0 8.35953E-6
2-25048980-A-T p.Pro837Pro synonymous ADCY3 1 81456 1.22766E-5 40728 0 6.3804E-5
2-25048991-G-A p.Pro834Ser missense ADCY3 2 81224 2.46233E-5 40612 0 7.17709E-5
2-25050407-G-A c.2495+8C>T splice_region ADCY3 217 81742 0.00265469 40871 3 0.0043963
2-25050436-G-C p.Pro825Arg missense ADCY3 1 82006 1.21942E-5 41003 0 NA
2-25050438-G-A p.Asn824Asn synonymous ADCY3 1 81986 1.21972E-5 40993 0 4.66348E-6
2-25050446-C-T p.Gly822Arg missense ADCY3 1 82026 1.21913E-5 41013 0 9.38817E-6
2-25050456-C-T p.Glu818Glu synonymous ADCY3 1 82058 1.21865E-5 41029 0 3.18451E-5
2-25050474-T-C p.Leu812Leu synonymous ADCY3 1 82140 1.21743E-5 41070 0 4.85512E-6
2-25050477-G-GTCGTGCTCCCGAAAACGCTTGTGGTCGTATTCATCAAAGA c.2433-1_2433insTCTTTGATGAATACGACCACAAGCGTTTTCGGGAGCACGA splice_acceptor ADCY3 2 82166 2.4341E-5 41083 0 NA
2-25050479-T-C c.2433-2A>G splice_acceptor ADCY3 1 82156 1.2172E-5 41078 0 NA
2-25050772-C-T p.Asp811Asn missense+splice_region ADCY3 5 83212 6.00875E-5 41606 0 5.78035E-5
2-25050773-G-A p.His810His splice_region+synonymous ADCY3 54 83194 6.49085E-4 41597 0 6.25E-4
2-25050779-C-T p.Arg808Arg synonymous ADCY3 2 83170 2.40471E-5 41585 0 1.59312E-5
2-25050780-C-T p.Arg808Gln missense ADCY3 5 83162 6.01236E-5 41581 0 6.25E-4
2-25050786-C-T p.Arg806His missense ADCY3 7 83146 8.41893E-5 41573 0 1.23424E-4
2-25050787-G-A p.Arg806Cys missense ADCY3 12 83120 1.4437E-4 41560 0 5.03525E-4
2-25050789-T-C p.Lys805Arg missense ADCY3 1 83136 1.20285E-5 41568 0 2.4741E-5
2-25050791-G-C p.His804Gln missense ADCY3 1 83104 1.20331E-5 41552 0 1.99016E-5
2-25050803-A-G p.Asp800Asp synonymous ADCY3 1 83078 1.20369E-5 41539 0 NA
2-25050805-C-T p.Asp800Asn missense ADCY3 1 83112 1.2032E-5 41556 0 NA
2-25050806-A-G p.Phe799Phe synonymous ADCY3 1 83102 1.20334E-5 41551 0 4.94446E-5
2-25050811-C-T p.Val798Ile missense ADCY3 3 83070 3.61141E-5 41535 0 9.55171E-5
2-25050814-G-C p.Pro797Ala missense ADCY3 1 83064 1.20389E-5 41532 0 NA
2-25050816-C-T p.Arg796His missense ADCY3 6 83010 7.22804E-5 41505 0 5.03525E-4
2-25050817-G-A p.Arg796Cys missense ADCY3 2 83004 2.40952E-5 41502 0 1.64794E-5
2-25050835-T-C p.Ile790Val missense ADCY3 5 83132 6.01453E-5 41566 0 5.56877E-5
2-25050844-C-T p.Val787Met missense ADCY3 2 83104 2.40662E-5 41552 0 6.3678E-5
2-25050847-C-T p.Ala786Thr missense ADCY3 7 83092 8.4244E-5 41546 0 1.97726E-4
2-25050848-G-A p.Gly785Gly synonymous ADCY3 3 83096 3.61028E-5 41548 0 5.03525E-4
2-25050852-G-A p.Ala784Val missense ADCY3 9 83132 1.08262E-4 41566 0 1.64777E-5
2-25050853-C-T p.Ala784Thr missense ADCY3 2 83140 2.40558E-5 41570 0 8.75051E-5
2-25050856-C-T p.Val783Ile missense ADCY3 1 83134 1.20288E-5 41567 0 9.55171E-5
2-25050870-G-A p.Thr778Met missense ADCY3 1 83126 1.20299E-5 41563 0 1.91046E-4
2-25050882-A-G p.Met774Thr missense ADCY3 1 83124 1.20302E-5 41562 0 NA
2-25050883-T-C p.Met774Val missense ADCY3 1 83138 1.20282E-5 41569 0 NA
2-25050893-C-T c.1072-1G>A splice_acceptor ADCY3 7 83158 8.41771E-5 41579 0 1.91034E-4
2-25050905-G-A p.Ile766Ile synonymous ADCY3 3 83186 3.60638E-5 41593 0 NA
2-25050907-T-C p.Ile766Val missense ADCY3 1 83184 1.20215E-5 41592 0 NA
2-25050909-G-A p.Thr765Ile missense ADCY3 3 83186 3.60638E-5 41593 0 3.97703E-6
2-25050914-G-A p.Ile763Ile synonymous ADCY3 1 83138 1.20282E-5 41569 0 8.24035E-6
2-25050928-C-T p.Val759Met missense ADCY3 2 83084 2.4072E-5 41542 0 3.29663E-5
2-25050929-G-A p.Ala758Ala synonymous ADCY3 4 83086 4.81429E-5 41543 0 2.7843E-5
2-25050949-T-C p.Lys752Glu missense ADCY3 1 82860 1.20685E-5 41430 0 NA
2-25050954-T-C p.Asn750Ser missense ADCY3 8 82766 9.6658E-5 41383 0 2.23001E-4
2-25050962-G-A p.Cys747Cys synonymous ADCY3 1 82446 1.21292E-5 41223 0 NA
2-25050970-C-T p.Gly745Ser missense ADCY3 1 82172 1.21696E-5 41086 0 1.23965E-4
2-25050975-G-A p.Thr743Met missense ADCY3 5 81858 6.10814E-5 40929 0 1.99534E-5
2-25050975-GTT-ATC p.GluThr742GluMet missense ADCY3 5 81858 6.10814E-5 40929 0 NA
2-25050977-T-C p.Glu742Glu synonymous ADCY3 51514 79490 0.648056 39745 17020 0.68655
2-25050984-C-G p.Gly740Ala missense ADCY3 1 81988 1.21969E-5 40994 0 3.1841E-5
2-25050984-C-A p.Gly740Val missense ADCY3 1 81988 1.21969E-5 40994 0 1.65481E-5
2-25050989-C-T p.Thr738Thr synonymous ADCY3 1 81878 1.22133E-5 40939 0 8.27445E-6
2-25050990-G-A p.Thr738Met missense ADCY3 2 81848 2.44355E-5 40924 0 3.1841E-5
2-25050997-T-G p.Asn736His missense ADCY3 4 81744 4.89333E-5 40872 0 NA
2-25051002-G-T p.Pro734His missense ADCY3 2 81544 2.45266E-5 40772 0 7.98416E-6
2-25051003-G-A p.Pro734Ser missense ADCY3 2 81490 2.45429E-5 40745 0 NA
2-25051007-C-T p.Thr732Thr synonymous ADCY3 8 81312 9.83865E-5 40656 0 0.0015121
2-25051008-G-A p.Thr732Met missense ADCY3 4 81338 4.91775E-5 40669 0 3.31323E-5
2-25051022-A-G p.Cys727Cys synonymous ADCY3 2 80694 2.4785E-5 40347 0 NA
2-25051024-A-G p.Cys727Arg missense ADCY3 1 80602 1.24066E-5 40301 0 NA
2-25051027-T-C p.Ser726Gly missense ADCY3 1 80412 1.2436E-5 40206 0 NA
2-25051032-TGGAGGCCAGGACGGCGGGCAGGGACACAC-T c.2173-31_2173-3delGTGTGTCCCTGCCCGCCGTCCTGGCCTCC splice_region ADCY3 2 80084 2.49738E-5 40042 0 NA
2-25053579-A-G p.Met724Thr missense+splice_region ADCY3 2 83032 2.40871E-5 41516 0 NA
2-25053586-C-T p.Val722Met missense ADCY3 19 83038 2.28811E-4 41519 1 9.55597E-5
2-25053603-A-G p.Leu716Pro missense ADCY3 1 83106 1.20328E-5 41553 0 NA
2-25053615-GCGAGCAT-G p.Met710fs frameshift ADCY3 1 83092 1.20349E-5 41546 0 NA
2-25053617-G-A p.Leu711Leu synonymous ADCY3 3 83102 3.61002E-5 41551 0 8.253E-6
2-25053617-G-T p.Leu711Leu synonymous ADCY3 3 83100 3.61011E-5 41550 0 1.6506E-5
2-25053627-C-G p.Trp708Ser missense ADCY3 2 83146 2.40541E-5 41573 0 NA
2-25053630-G-A p.Thr707Ile missense ADCY3 4 83136 4.81139E-5 41568 0 9.56023E-5
2-25053632-G-A p.Asn706Asn synonymous ADCY3 1 83144 1.20273E-5 41572 0 8.25273E-6
2-25053636-C-T p.Arg705Lys missense ADCY3 4 83152 4.81047E-5 41576 0 NA
2-25053651-C-T p.Arg700Gln missense ADCY3 4 83154 4.81035E-5 41577 0 1.27462E-4
2-25053657-A-G p.Ile698Thr missense ADCY3 1 83150 1.20265E-5 41575 0 3.18573E-5
2-25053663-G-A p.Thr696Ile missense ADCY3 3 83160 3.6075E-5 41580 0 NA
2-25053671-G-C p.Ala693Ala synonymous ADCY3 4 83130 4.81174E-5 41565 0 5.97077E-5
2-25053693-G-T p.Ala686Asp missense+splice_region ADCY3 2 82954 2.41097E-5 41477 0 NA
2-25053693-G-A p.Ala686Val missense+splice_region ADCY3 1 82954 1.20549E-5 41477 0 NA
2-25053695-C-CCGGGGAAAGA c.2056-2_2056-1insTCTTTCCCCG splice_acceptor ADCY3 1 82918 1.20601E-5 41459 0 NA
2-25053698-G-A c.2056-4C>T splice_region ADCY3 1 82866 1.20677E-5 41433 0 8.29311E-6
2-25054532-C-T p.Arg685Gln missense+splice_region ADCY3 3 82628 3.63073E-5 41314 0 3.50398E-5
2-25054544-G-T p.Ala681Asp missense ADCY3 7 82750 8.45921E-5 41375 0 1.5952E-5
2-25054559-A-G p.Ile676Thr missense ADCY3 1 82884 1.20651E-5 41442 0 NA
2-25054562-G-A p.Thr675Ile missense ADCY3 3 82912 3.61829E-5 41456 0 3.98356E-6
2-25054566-G-A p.Leu674Leu synonymous ADCY3 2 82934 2.41156E-5 41467 0 NA
2-25054573-G-A p.Leu671Leu synonymous ADCY3 1 82940 1.20569E-5 41470 0 NA
2-25054587-C-T p.Gly667Arg missense ADCY3 1 82956 1.20546E-5 41478 0 NA
2-25054619-C-CAGGGGTCGATGAGTATCTCGACCAGGGCCG c.1968-2_1968-1insCGGCCCTGGTCGAGATACTCATCGACCCCT splice_acceptor ADCY3 2 82556 2.4226E-5 41278 1 NA
2-25054625-C-G c.1968-7G>C splice_region ADCY3 1 82330 1.21462E-5 41165 0 8.00987E-6
2-25057349-C-T c.1967+5G>A splice_region ADCY3 1 80094 1.24853E-5 40047 0 NA
2-25057351-C-T c.1967+3G>A splice_region ADCY3 1 80178 1.24722E-5 40089 0 2.55376E-5
2-25057359-G-A p.Asp654Asp synonymous ADCY3 1 80850 1.23686E-5 40425 0 NA
2-25057362-G-A p.Ile653Ile synonymous ADCY3 21 81284 2.58353E-4 40642 0 4.15973E-4
2-25057365-G-A p.Leu652Leu synonymous ADCY3 3 81630 3.67512E-5 40815 0 3.35031E-5
2-25057373-C-T p.Glu650Lys missense ADCY3 3 82008 3.65818E-5 41004 0 3.19918E-5
2-25057373-C-G p.Glu650Gln missense ADCY3 1 82008 1.21939E-5 41004 0 NA
2-25057383-C-G p.Thr646Thr synonymous ADCY3 1 82438 1.21303E-5 41219 0 NA
2-25057391-G-A p.Leu644Phe missense ADCY3 1 82696 1.20925E-5 41348 0 NA
2-25057397-C-T p.Val642Ile missense ADCY3 1 82734 1.20869E-5 41367 0 3.19163E-5
2-25057398-G-A p.Val641Val synonymous ADCY3 10 82756 1.20837E-4 41378 0 5.03525E-4
2-25057405-G-C p.Ser639Cys missense ADCY3 2 82906 2.41237E-5 41453 0 NA
2-25057413-G-A p.Phe636Phe synonymous ADCY3 1 82994 1.20491E-5 41497 0 8.25996E-6
2-25057419-A-G p.Ala634Ala synonymous ADCY3 1 83018 1.20456E-5 41509 0 7.95564E-6
2-25057429-T-C p.Gln631Arg missense ADCY3 5 83076 6.01859E-5 41538 0 NA
2-25057431-C-A p.Lys630Asn missense ADCY3 1 83072 1.20378E-5 41536 0 3.18634E-5
2-25057446-C-T p.Ser625Ser synonymous ADCY3 1 83126 1.20299E-5 41563 0 6.37349E-5
2-25057453-C-T p.Arg623His missense ADCY3 1 83126 1.20299E-5 41563 0 1.64957E-5
2-25057463-T-A p.Met620Leu missense ADCY3 1 83124 1.20302E-5 41562 0 3.97659E-6
2-25057467-G-A p.Pro618Pro synonymous ADCY3 2 83106 2.40657E-5 41553 0 1.6494E-5
2-25057474-A-G p.Met616Thr missense ADCY3 1 83164 1.20244E-5 41582 0 8.24661E-6
2-25057479-C-A p.Arg614Arg synonymous ADCY3 4 83162 4.80989E-5 41581 0 4.94829E-5
2-25057480-C-T p.Arg614Gln missense ADCY3 2 83164 2.40489E-5 41582 0 NA
2-25057481-G-A p.Arg614Trp missense ADCY3 4 83154 4.81035E-5 41577 0 6.5975E-5
2-25057482-C-T p.Met613Ile missense ADCY3 3 83162 3.60742E-5 41581 0 3.18735E-5
2-25057485-G-A p.Ser612Ser synonymous ADCY3 3 83176 3.60681E-5 41588 0 3.977E-6
2-25057490-A-T p.Leu611Met missense ADCY3 1 83174 1.2023E-5 41587 0 1.64967E-5
2-25057494-G-A p.Phe609Phe synonymous ADCY3 1 83190 1.20207E-5 41595 0 8.24878E-6
2-25057515-T-TACTTGGGCGGACTCTCGCTCAAGCAGGGCCTCGTTGAGCAG c.1806-1_1806insCTGCTCAACGAGGCCCTGCTTGAGCGAGAGTCCGCCCAAGT splice_acceptor ADCY3 4 83140 4.81116E-5 41570 2 NA
2-25057518-G-T c.1806-3C>A splice_region ADCY3 1 83102 1.20334E-5 41551 0 3.97956E-6
2-25057656-C-T c.1805+7G>A splice_region ADCY3 3 82590 3.6324E-5 41295 0 3.58606E-5
2-25057657-G-A c.1805+6C>T splice_region ADCY3 1 82598 1.21068E-5 41299 0 2.54992E-4
2-25057662-C-T c.1805+1G>A splice_donor ADCY3 1 82568 1.21112E-5 41284 0 3.98273E-6
2-25057670-C-T p.Ala600Thr missense ADCY3 21 82450 2.547E-4 41225 0 6.37105E-5
2-25057671-G-A p.Ser599Ser synonymous ADCY3 1 82466 1.21262E-5 41233 0 3.32149E-5
2-25057679-G-A p.Arg597* stop_gained ADCY3 2 82338 2.42901E-5 41169 0 8.31214E-6
2-25057692-C-T p.Glu592Glu synonymous ADCY3 1 82116 1.21779E-5 41058 0 2.49925E-5
2-25057693-T-G p.Glu592Ala missense ADCY3 1 82090 1.21818E-5 41045 0 NA
2-25057695-G-A p.Asn591Asn synonymous ADCY3 3 81986 3.65916E-5 40993 0 0.001875
2-25057696-T-C p.Asn591Ser missense ADCY3 1 81980 1.21981E-5 40990 0 2.50146E-5
2-25057738-A-G p.Val577Ala missense ADCY3 2 80278 2.49134E-5 40139 0 8.46196E-6
2-25057744-C-T p.Arg575Gln missense ADCY3 3 79868 3.7562E-5 39934 0 2.80444E-5
2-25057745-G-A p.Arg575* stop_gained ADCY3 1 79826 1.25272E-5 39913 0 NA
2-25057753-A-G p.Leu572Pro missense ADCY3 4 79462 5.03385E-5 39731 0 3.18573E-5
2-25057755-G-A p.Asp571Asp synonymous ADCY3 1 79324 1.26065E-5 39662 0 NA
2-25057756-T-C p.Asp571Gly missense ADCY3 1 79274 1.26145E-5 39637 0 NA
2-25057758-C-T p.Gln570Gln synonymous ADCY3 5 79234 6.31042E-5 39617 0 6.25782E-4
2-25057761-C-T p.Leu569Leu synonymous ADCY3 1 78990 1.26598E-5 39495 0 NA
2-25057766-G-A p.Arg568Cys missense ADCY3 3 78280 3.8324E-5 39140 0 1.20507E-5
2-25057775-G-A p.Arg565Trp missense ADCY3 2 77312 2.58692E-5 38656 0 1.71756E-5
2-25057777-C-T p.Arg564His missense ADCY3 6 76706 7.82207E-5 38353 0 1.24529E-4
2-25057778-G-A p.Arg564Cys missense ADCY3 2 76712 2.60715E-5 38356 0 8.03348E-6
2-25057781-G-A p.Pro563Ser missense ADCY3 1 76470 1.3077E-5 38235 0 NA
2-25057795-G-T p.Pro558His missense ADCY3 1 75282 1.32834E-5 37641 0 8.65351E-6
2-25057802-C-T p.Asp556Asn missense ADCY3 2 74324 2.69092E-5 37162 0 3.18654E-5
2-25057803-G-A p.Ala555Ala splice_region+synonymous ADCY3 1 74374 1.34456E-5 37187 0 5.24816E-5
2-25057808-G-GGGCATCCTGCTCCTCGGGCTTCTCCGACGTGGACCCACTGC c.1663-4_1663-3insGCAGTGGGTCCACGTCGGAGAAGCCCGAGGAGCAGGATGCC splice_region ADCY3 1 74326 1.34542E-5 37163 0 NA
2-25057810-G-A c.1663-5C>T splice_region ADCY3 1 74280 1.34626E-5 37140 0 4.85241E-5
2-25059790-G-A p.Ala553Val missense ADCY3 42 82240 5.107E-4 41120 1 5.73248E-4
2-25059792-A-T p.Asp552Glu missense ADCY3 1 82356 1.21424E-5 41178 0 3.18532E-5
2-25059803-C-T p.Glu549Lys missense ADCY3 2 82596 2.42142E-5 41298 0 6.36902E-5
2-25059804-G-C p.Pro548Pro synonymous ADCY3 1 82628 1.21024E-5 41314 0 NA
2-25059813-C-T p.Ser545Ser synonymous ADCY3 4 82792 4.83138E-5 41396 0 3.58609E-5
2-25059814-G-A p.Ser545Leu missense ADCY3 9 82808 1.08685E-4 41404 0 9.96231E-5
2-25059816-C-T p.Thr544Thr synonymous ADCY3 3 82838 3.62153E-5 41419 0 4.78027E-5
2-25059817-G-A p.Thr544Met missense ADCY3 10 82840 1.20715E-4 41420 0 6.26566E-4
2-25059821-A-T p.Ser543Thr missense ADCY3 2 82866 2.41354E-5 41433 0 3.18471E-5
2-25059828-G-A p.Ser540Ser synonymous ADCY3 1 82896 1.20633E-5 41448 0 1.59238E-5
2-25059828-G-C p.Ser540Arg missense ADCY3 1 82896 1.20633E-5 41448 0 3.1839E-5
2-25059831-G-A p.His539His synonymous ADCY3 1 82910 1.20613E-5 41455 0 NA
2-25059843-G-A p.Asn535Asn synonymous ADCY3 4 82832 4.82905E-5 41416 0 7.96343E-6
2-25059855-G-A p.Thr531Thr synonymous ADCY3 211 82746 0.00254997 41373 2 0.00453172
2-25059872-G-A p.Pro526Ser missense ADCY3 1 82588 1.21083E-5 41294 0 NA
2-25059874-G-A p.Ser525Phe missense ADCY3 1 82540 1.21153E-5 41270 0 NA
2-25059877-C-G p.Ser524Thr missense ADCY3 2 82468 2.42518E-5 41234 0 1.67054E-5
2-25059882-C-T p.Lys522Lys synonymous ADCY3 1 82406 1.2135E-5 41203 0 1.19571E-5
2-25059895-G-C p.Pro518Arg missense ADCY3 10 82146 1.21734E-4 41073 0 2.86734E-4
2-25059914-C-T p.Ala512Thr missense+splice_region ADCY3 8 81386 9.8297E-5 40693 0 9.60023E-5
2-25061314-C-T p.Ser511Ser splice_region+synonymous ADCY3 6 79316 7.56468E-5 39658 0 1.16614E-4
2-25061315-G-A p.Ser511Leu missense+splice_region ADCY3 76 79568 9.55158E-4 39784 1 5.37643E-4
2-25061315-G-C p.Ser511Trp missense+splice_region ADCY3 2 79570 2.51351E-5 39785 0 8.40068E-6
2-25061320-A-G p.Asn509Asn synonymous ADCY3 1 80442 1.24313E-5 40221 0 8.32972E-6
2-25061323-G-A p.Leu508Leu synonymous ADCY3 2 80766 2.47629E-5 40383 0 3.99693E-6
2-25061324-A-T p.Leu508His missense ADCY3 1 80878 1.23643E-5 40439 0 NA
2-25061326-G-A p.Gly507Gly synonymous ADCY3 1 81014 1.23435E-5 40507 0 1.66063E-5
2-25061327-C-T p.Gly507Asp missense ADCY3 1 81112 1.23286E-5 40556 0 NA
2-25061344-T-G p.Lys501Asn missense ADCY3 2 82132 2.4351E-5 41066 0 2.47741E-5
2-25061350-C-T p.Val499Val synonymous ADCY3 19 82320 2.30807E-4 41160 0 1.15409E-4
2-25061353-C-A p.Glu498Asp missense ADCY3 2 82456 2.42554E-5 41228 0 3.19591E-5
2-25061358-G-A p.Pro497Ser missense ADCY3 1 82544 1.21148E-5 41272 0 NA
2-25061366-G-A p.Ala494Val missense ADCY3 1 82660 1.20978E-5 41330 0 3.97706E-6
2-25061371-G-A p.Ile492Ile synonymous ADCY3 2 82778 2.4161E-5 41389 0 NA
2-25061376-G-C p.Leu491Val missense ADCY3 1 82828 1.20732E-5 41414 0 NA
2-25061377-G-A p.Tyr490Tyr synonymous ADCY3 3 82836 3.62161E-5 41418 0 3.97646E-6
2-25061380-G-A p.Thr489Thr synonymous ADCY3 3 82862 3.62048E-5 41431 0 3.29625E-5
2-25061386-A-G p.Ile487Ile synonymous ADCY3 1 82914 1.20607E-5 41457 0 NA
2-25061390-C-A p.Gly486Val missense ADCY3 1 82922 1.20595E-5 41461 0 NA
2-25061391-C-T p.Gly486Ser missense ADCY3 1 82940 1.20569E-5 41470 0 1.64794E-5
2-25061407-A-G p.Asp480Asp synonymous ADCY3 2 82962 2.41074E-5 41481 0 4.11977E-5
2-25061416-G-A p.Ser477Ser synonymous ADCY3 1 82894 1.20636E-5 41447 0 3.97633E-6
2-25061428-G-A p.Gly473Gly synonymous ADCY3 2 82566 2.4223E-5 41283 0 1.23275E-4
2-25061440-A-C p.Asp469Glu missense ADCY3 3 82562 3.63363E-5 41281 0 6.37105E-5
2-25061449-C-A p.Gly466Gly synonymous ADCY3 1 82566 1.21115E-5 41283 0 NA
2-25061451-C-G p.Gly466Arg missense ADCY3 1 82566 1.21115E-5 41283 0 NA
2-25061461-G-A p.Asp462Asp synonymous ADCY3 2 82538 2.42313E-5 41269 0 NA
2-25061467-G-A p.Thr460Thr synonymous ADCY3 1 82558 1.21127E-5 41279 0 NA
2-25061470-G-A p.Ser459Ser synonymous ADCY3 1 82532 1.21165E-5 41266 0 NA
2-25061480-A-G p.Ile456Thr missense ADCY3 1 82484 1.21236E-5 41242 0 1.98942E-5
2-25061482-G-A p.His455His synonymous ADCY3 2 82490 2.42454E-5 41245 0 3.97915E-6
2-25061485-C-G p.Val454Val synonymous ADCY3 3 82466 3.63786E-5 41233 0 NA
2-25061487-C-T p.Val454Met missense ADCY3 1 82420 1.2133E-5 41210 0 8.25082E-6
2-25061488-G-A p.Arg453Arg synonymous ADCY3 6 82416 7.28014E-5 41208 0 4.95041E-5
2-25061492-C-CCAGGGATGCCGCCGGCCTCCATCTTGTTGGCTACAG c.1356-2_1356-1insCTGTAGCCAACAAGATGGAGGCCGGCGGCATCCCTG splice_acceptor ADCY3 4 82414 4.85354E-5 41207 2 NA
2-25061492-C-CCAGGGATGCCGCCGGCCTCCATCTTGT c.1356-2_1356-1insACAAGATGGAGGCCGGCGGCATCCCTG splice_acceptor ADCY3 2 82414 2.42677E-5 41207 1 NA
2-25061708-G-A c.254+8C>T splice_region ADCY3 1 80048 1.24925E-5 40024 0 NA
2-25061711-C-T c.254+5G>A splice_region ADCY3 1 80058 1.24909E-5 40029 0 4.13791E-6
2-25061715-C-T c.254+1G>A splice_donor ADCY3 1 80020 1.24969E-5 40010 0 1.73825E-5
2-25061716-T-A p.Glu85Val missense+splice_region ADCY3 1 79972 1.25044E-5 39986 0 6.08368E-5
2-25061725-A-G p.Leu82Pro missense ADCY3 1 79942 1.25091E-5 39971 0 NA
2-25061734-G-A p.Thr79Ile missense ADCY3 1 79826 1.25272E-5 39913 0 NA
2-25061735-T-C p.Thr79Ala missense ADCY3 1 79830 1.25266E-5 39915 0 6.37349E-5
2-25061742-C-T p.Val76Val synonymous ADCY3 10 79698 1.25474E-4 39849 0 2.8677E-4
2-25061743-A-C p.Val76Gly missense ADCY3 1 79658 1.25537E-5 39829 0 2.86935E-4
2-25061744-C-T p.Val76Met missense ADCY3 1 79632 1.25578E-5 39816 0 6.37999E-5
2-25061745-G-A p.Val75Val synonymous ADCY3 1 79568 1.25679E-5 39784 0 1.65473E-5
2-25061749-C-T p.Cys74Tyr missense ADCY3 1 79486 1.25808E-5 39743 0 2.06856E-5
2-25061752-G-A p.Ser73Phe missense ADCY3 9 79370 1.13393E-4 39685 0 3.18817E-4
2-25061754-G-A p.Tyr72Tyr synonymous ADCY3 2 79300 2.52207E-5 39650 0 NA
2-25061755-T-C p.Tyr72Cys missense ADCY3 727 79248 0.00917373 39624 20 0.0169838
2-25061757-CAA-TAT p.Leu71Ile missense ADCY3 2 79192 2.52551E-5 39596 0 NA
2-25061758-A-G p.Leu71Ser missense ADCY3 1 79174 1.26304E-5 39587 0 NA
2-25061780-C-T p.Gly64Arg missense+splice_region ADCY3 7 78368 8.93222E-5 39184 0 6.25E-4
2-25061781-G-A p.Gly63Gly splice_region+synonymous ADCY3 5 78244 6.39027E-5 39122 0 6.38733E-5
2-25062752-C-T p.Gly449Ser missense ADCY3 1 82238 1.21598E-5 41119 0 3.1904E-5
2-25062753-G-A p.Gly448Gly synonymous ADCY3 3 82204 3.64946E-5 41102 0 1.5927E-5
2-25062755-C-T p.Gly448Ser missense ADCY3 1 82292 1.21518E-5 41146 0 8.29187E-6
2-25062756-G-A p.Ala447Ala synonymous ADCY3 12 82270 1.45861E-4 41135 0 0.00125
2-25062798-G-A p.Asp433Asp synonymous ADCY3 1 82312 1.21489E-5 41156 0 8.29669E-6
2-25062801-G-A p.Tyr432Tyr synonymous ADCY3 2 82244 2.43179E-5 41122 0 2.4895E-4
2-25062811-C-A p.Arg429Leu missense ADCY3 2 82112 2.4357E-5 41056 0 NA
2-25062812-G-A p.Arg429Cys missense ADCY3 1 82068 1.2185E-5 41034 0 NA
2-25062828-G-A p.Gly423Gly synonymous ADCY3 4 81504 4.90773E-5 40752 0 4.15648E-5
2-25062840-G-A p.Thr419Thr synonymous ADCY3 2 81016 2.46865E-5 40508 0 3.19165E-5
2-25062843-G-A p.Gly418Gly synonymous ADCY3 1 80870 1.23655E-5 40435 0 3.18634E-5
2-25062846-C-T p.Thr417Thr synonymous ADCY3 1 80862 1.23667E-5 40431 0 3.59187E-5
2-25062846-C-A p.Thr417Thr synonymous ADCY3 1 80862 1.23667E-5 40431 0 3.18756E-5
2-25062849-G-A p.His416His synonymous ADCY3 1 80714 1.23894E-5 40357 0 8.32321E-6
2-25062852-C-T p.Val415Val synonymous ADCY3 6 80540 7.44971E-5 40270 0 0.00151057
2-25062874-C-T p.Gly408Glu missense ADCY3 2 78650 2.54291E-5 39325 0 9.22006E-5
2-25062875-C-T p.Gly408Arg missense ADCY3 54 78596 6.87058E-4 39298 1 0.00553877
2-25062880-T-C p.Lys406Arg missense ADCY3 2 77760 2.57202E-5 38880 0 4.01477E-6
2-25062891-C-T p.Arg402Arg synonymous ADCY3 1 75860 1.31822E-5 37930 0 2.23058E-4
2-25062894-C-T p.Val401Val synonymous ADCY3 1 75120 1.3312E-5 37560 0 NA
2-25062900-C-CGAGATGGCCTCCACCATGGCCAGCCCCATGAGGATGGAG c.1197-1_1197insCTCCATCCTCATGGGGCTGGCCATGGTGGAGGCCATCTC splice_acceptor ADCY3 1 74244 1.34691E-5 37122 0 NA
2-25062903-G-A c.1197-3C>T splice_region ADCY3 8 73402 1.08989E-4 36701 0 1.21554E-5
2-25063394-C-T n.79G>A splice_region ADCY3 3 51872 5.78347E-5 25936 0 6.82799E-6
2-25064133-G-A p.Ala397Ala synonymous ADCY3 2 80984 2.46962E-5 40492 0 5.8511E-6
2-25064146-G-A p.Ala393Val missense ADCY3 2 81210 2.46275E-5 40605 0 3.18918E-5
2-25064153-C-T p.Gly391Arg missense ADCY3 2 81298 2.46009E-5 40649 0 NA
2-25064157-G-C c.-1C>G 5_prime_UTR_premature_start_codon_gain ADCY3 6593 81186 0.0812086 40593 417 0.106768
2-25064170-A-G p.Val385Ala missense ADCY3 1 81366 1.22901E-5 40683 0 NA
2-25064171-C-T p.Val385Ile missense ADCY3 9 81372 1.10603E-4 40686 0 1.27796E-4
2-25064172-G-A c.-16C>T 5_prime_UTR_premature_start_codon_gain ADCY3 2 81416 2.45652E-5 40708 0 9.39438E-5
2-25064174-C-T p.Ala384Thr missense ADCY3 1 81410 1.22835E-5 40705 0 NA
2-25064175-G-A c.-19C>T 5_prime_UTR_premature_start_codon_gain ADCY3 2 81412 2.45664E-5 40706 0 3.18796E-5
2-25064185-C-T p.Arg380Gln missense ADCY3 1 81478 1.22733E-5 40739 0 2.7474E-5
2-25064193-G-A c.-37C>T 5_prime_UTR_premature_start_codon_gain ADCY3 38648 81212 0.47589 40606 9381 0.576115
2-25064199-G-C p.Gly375Gly synonymous ADCY3 2 81690 2.44828E-5 40845 0 NA
2-25064201-C-T p.Gly375Ser missense ADCY3 2 81686 2.4484E-5 40843 0 6.37836E-5
2-25064202-G-A p.Cys374Cys synonymous ADCY3 1 81708 1.22387E-5 40854 0 1.34155E-4
2-25064223-G-A p.Gly367Gly synonymous ADCY3 3 81910 3.66256E-5 40955 0 3.18776E-5
2-25064229-G-T p.Ile365Ile synonymous ADCY3 2 81994 2.4392E-5 40997 0 NA
2-25064241-C-A p.Leu361Leu synonymous ADCY3 1 82100 1.21803E-5 41050 0 NA
2-25064247-G-A p.His359His synonymous ADCY3 1 82174 1.21693E-5 41087 0 NA
2-25064263-G-A c.1069-8C>T splice_region ADCY3 7 82300 8.50547E-5 41150 0 0.001875
2-25064418-G-GA c.1068+6_1068+7insT splice_region ADCY3 1 82082 1.21829E-5 41041 0 NA
2-25064422-T-TA c.1068+2_1068+3insT splice_donor ADCY3 1 82156 1.2172E-5 41078 0 NA
2-25064424-C-T c.1068+1G>A splice_donor ADCY3 1 82184 1.21678E-5 41092 0 4.0474E-6
2-25064443-G-C p.Arg350Arg synonymous ADCY3 467 82582 0.00565499 41291 4 0.0111897
2-25064445-G-A p.Arg350Cys missense ADCY3 1 82628 1.21024E-5 41314 0 4.005E-6
2-25064450-A-G p.Phe348Ser missense ADCY3 1 82720 1.2089E-5 41360 0 NA
2-25064452-G-A p.Leu347Leu synonymous ADCY3 1 82736 1.20866E-5 41368 0 3.99719E-6
2-25064458-G-A c.-133C>T 5_prime_UTR_premature_start_codon_gain ADCY3 183 82794 0.00221031 41397 0 0.0116162
2-25064491-G-C p.Ala334Ala synonymous ADCY3 2 82942 2.41132E-5 41471 0 NA
2-25064518-G-A p.Ile325Ile synonymous ADCY3 1 82632 1.21018E-5 41316 0 3.9968E-6
2-25064524-G-A p.Ala323Ala synonymous ADCY3 2 82456 2.42554E-5 41228 0 0.00100705
2-25064537-C-T c.957-1G>A splice_acceptor ADCY3 2 82062 2.43718E-5 41031 0 4.01555E-6
2-25064539-G-GACGTTCTCGTGACGGTACATGTACATGGTGTTGAACTGCTGCTGGT c.957-4_957-3insACCAGCAGCAGTTCAACACCATGTACATGTACCGTCACGAGAACGT splice_region ADCY3 2 81972 2.43986E-5 40986 1 NA
2-25065115-C-T c.956+8G>A splice_region ADCY3 1 82038 1.21895E-5 41019 0 6.37227E-5
2-25065116-G-A c.956+7C>T splice_region ADCY3 48 82038 5.85095E-4 41019 0 2.39021E-4
2-25065119-G-A c.956+4C>T splice_region ADCY3 5 82112 6.08924E-5 41056 0 4.95819E-5
2-25065128-G-A p.Asn317Asn synonymous ADCY3 2 82274 2.4309E-5 41137 0 1.19441E-5
2-25065134-G-A p.His315His synonymous ADCY3 3 82252 3.64733E-5 41126 0 8.36041E-5
2-25065139-G-A p.Arg314Cys missense ADCY3 3 82232 3.64821E-5 41116 0 3.9808E-6
2-25065140-G-A p.Tyr313Tyr synonymous ADCY3 1 82262 1.21563E-5 41131 0 NA
2-25065152-G-C p.Thr309Thr synonymous ADCY3 8 82252 9.72621E-5 41126 0 5.45058E-4
2-25065156-T-C p.Asn308Ser missense ADCY3 3 82290 3.64564E-5 41145 0 NA
2-25065172-C-T p.Asp303Asn missense ADCY3 1 82324 1.21471E-5 41162 0 3.97896E-6
2-25065184-C-T p.Glu299Lys missense ADCY3 1 82370 1.21403E-5 41185 0 1.27445E-4
2-25065185-G-A p.Asp298Asp synonymous ADCY3 8 82354 9.71416E-5 41177 0 4.13237E-5
2-25065209-C-T p.Glu290Glu synonymous ADCY3 4 82462 4.85072E-5 41231 0 NA
2-25065212-G-A p.Asp289Asp synonymous ADCY3 31 82410 3.76168E-4 41205 0 3.42332E-4
2-25065248-G-A p.Asn277Asn synonymous ADCY3 6 81902 7.32583E-5 40951 0 1.7408E-4
2-25065256-G-GCTGCTGGCTCTGCTCTTCCAGGTTCATC c.826-4_826-3insGATGAACCTGGAAGAGCAGAGCCAGCAG splice_region ADCY3 4 81712 4.89524E-5 40856 2 NA
2-25065256-G-GC c.826-4_826-3insG splice_region ADCY3 2 81712 2.44762E-5 40856 1 NA
2-25095432-G-A c.825+7C>T splice_region ADCY3 3 82812 3.62266E-5 41406 0 1.67003E-5
2-25095487-G-A p.Arg259Arg synonymous ADCY3 1 83194 1.20201E-5 41597 0 NA
2-25095488-C-T p.Arg259His missense ADCY3 1 83188 1.2021E-5 41594 0 1.65648E-5
2-25095489-G-A p.Arg259Cys missense ADCY3 7 83178 8.41569E-5 41589 0 4.77817E-5
2-25095490-G-A p.Ala258Ala synonymous ADCY3 1 83176 1.20227E-5 41588 0 7.95735E-6
2-25095491-G-T p.Ala258Asp missense ADCY3 1 83166 1.20241E-5 41583 0 NA
2-25095498-G-A p.Leu256Leu synonymous ADCY3 49 83044 5.90049E-4 41522 0 9.23626E-4
2-25095510-G-C p.Arg252Gly missense ADCY3 2 83110 2.40645E-5 41555 0 3.18593E-5
2-25095510-G-A p.Arg252Cys missense ADCY3 1 83110 1.20322E-5 41555 0 6.25E-4
2-25095518-C-A p.Arg249Leu missense ADCY3 10 83158 1.20253E-4 41579 0 6.37064E-5
2-25095519-G-A p.Arg249Cys missense ADCY3 4 83166 4.80966E-5 41583 0 6.36476E-5
2-25095525-C-A p.Ala247Ser missense ADCY3 1 83170 1.20236E-5 41585 0 NA
2-25095539-A-T p.Met242Lys missense ADCY3 1 83260 1.20106E-5 41630 0 NA
2-25095549-C-A p.Val239Leu missense ADCY3 2 83270 2.40183E-5 41635 0 NA
2-25095552-C-T p.Ala238Thr missense ADCY3 8 83276 9.60661E-5 41638 0 8.2428E-5
2-25095553-G-A p.Ile237Ile synonymous ADCY3 3 83256 3.60334E-5 41628 0 6.25E-4
2-25095558-C-T p.Ala236Thr missense ADCY3 5 83268 6.00471E-5 41634 0 4.12167E-5
2-25095559-G-A p.Cys235Cys synonymous ADCY3 4 83264 4.804E-5 41632 0 5.77025E-5
2-25095564-G-A p.Leu234Leu synonymous ADCY3 1 83258 1.20109E-5 41629 0 3.1839E-5
2-25095571-G-A p.Phe231Phe synonymous ADCY3 4 83236 4.80561E-5 41618 0 0.00125
2-25095576-C-T p.Val230Ile missense ADCY3 1 83188 1.2021E-5 41594 0 0.00125
2-25095577-G-A p.Asn229Asn synonymous ADCY3 2 83184 2.40431E-5 41592 0 3.18492E-5
2-25095581-G-A p.Ala228Val missense ADCY3 2 83154 2.40518E-5 41577 0 3.18471E-5
2-25095583-C-T p.Leu227Leu synonymous ADCY3 2 83148 2.40535E-5 41574 0 NA
2-25095587-A-ATAGT p.Ile226fs frameshift ADCY3 1 83110 1.20322E-5 41555 0 NA
2-25095590-T-TCCC c.676-3_676-2insGGG splice_region ADCY3 4 83066 4.81545E-5 41533 2 NA
2-25095593-AC-A c.676-6delG splice_region ADCY3 1 83008 1.2047E-5 41504 0 NA
2-25095595-C-A c.676-7G>T splice_region ADCY3 1 82990 1.20496E-5 41495 0 NA
2-25100790-C-T c.9+1G>A splice_donor ADCY3 1 53222 1.87892E-5 26611 0 NA
2-25100796-C-A p.Gly2Cys missense ADCY3 2 53230 3.75728E-5 26615 0 6.37389E-5
2-25100798-A-G p.Met1? start_lost ADCY3 1 53230 1.87864E-5 26615 0 6.22123E-5
2-25100876-C-T c.-77G>A 5_prime_UTR_premature_start_codon_gain ADCY3 2 52924 3.779E-5 26462 0 NA
2-25100877-G-A c.-78C>T 5_prime_UTR_premature_start_codon_gain ADCY3 7 52912 1.32295E-4 26456 0 3.1841E-5
2-25141191-C-T p.Leu222Leu synonymous ADCY3 2 80722 2.47764E-5 40361 0 4.59533E-6
2-25141195-T-A p.Gln221Leu missense ADCY3 1 80948 1.23536E-5 40474 0 NA
2-25141209-C-G p.Glu216Asp missense ADCY3 1 81112 1.23286E-5 40556 0 NA
2-25141216-T-A p.Gln214Leu missense ADCY3 1 81262 1.23059E-5 40631 0 NA
2-25141225-T-G p.Gln211Pro missense ADCY3 3 81464 3.68261E-5 40732 0 NA
2-25141238-C-T p.Val207Ile missense ADCY3 41 81840 5.00978E-4 40920 0 0.00165679
2-25141238-C-A p.Val207Phe missense ADCY3 1 81842 1.22187E-5 40921 0 NA
2-25141245-G-C p.Val204Val synonymous ADCY3 2 82094 2.43623E-5 41047 0 4.41728E-5
2-25141251-C-T p.Thr202Thr synonymous ADCY3 50 82230 6.08051E-4 41115 0 0.00312891
2-25141256-G-A p.His201Tyr missense ADCY3 3 82396 3.64095E-5 41198 0 NA
2-25141264-C-T p.Cys198Tyr missense ADCY3 1 82512 1.21194E-5 41256 0 NA
2-25141273-A-G p.Val195Ala missense ADCY3 1 82686 1.20939E-5 41343 0 3.18573E-5
2-25141274-C-T p.Val195Met missense ADCY3 2 82684 2.41885E-5 41342 0 1.1957E-5
2-25141275-G-A p.Ser194Ser synonymous ADCY3 15 82720 1.81335E-4 41360 0 8.60092E-4
2-25141287-G-C p.Ile190Met missense ADCY3 1 82888 1.20645E-5 41444 0 NA
2-25141300-C-T p.Ser186Asn missense ADCY3 13 82974 1.56676E-4 41487 0 0.00125
2-25141302-G-T p.Leu185Leu synonymous ADCY3 3 82986 3.61507E-5 41493 0 NA
2-25141321-A-G p.Phe179Ser missense ADCY3 10 83054 1.20404E-4 41527 0 8.75699E-5
2-25141322-A-G p.Phe179Leu missense ADCY3 11 83060 1.32434E-4 41530 0 8.27719E-6
2-25141329-G-C p.Val176Val synonymous ADCY3 7 83068 8.42683E-5 41534 0 5.03525E-4
2-25141341-C-G p.Gln172His missense ADCY3 1 83118 1.20311E-5 41559 0 NA
2-25141354-G-A p.Thr168Met missense ADCY3 2 83130 2.40587E-5 41565 0 NA
2-25141362-A-G p.Ala165Ala synonymous ADCY3 24 83142 2.88663E-4 41571 0 7.64331E-4
2-25141365-C-A p.Ala164Ala synonymous ADCY3 3 83132 3.60872E-5 41566 0 1.6547E-5
2-25141368-G-C p.His163Gln missense ADCY3 2 83146 2.40541E-5 41573 0 0.00100806
2-25141368-G-A p.His163His synonymous ADCY3 1 83146 1.2027E-5 41573 0 8.27198E-6
2-25141377-C-T p.Ala160Ala synonymous ADCY3 2 83128 2.40593E-5 41564 0 3.18593E-5
2-25141377-C-G p.Ala160Ala synonymous ADCY3 11 83128 1.32326E-4 41564 0 6.37186E-5
2-25141380-G-A p.Phe159Phe synonymous ADCY3 1 83138 1.20282E-5 41569 0 2.39057E-5
2-25141396-T-C p.Tyr154Cys missense ADCY3 2 83134 2.40575E-5 41567 0 3.98438E-6
2-25141396-TAGG-T p.Ser153del disruptive_inframe_deletion ADCY3 1 83134 1.20288E-5 41567 0 8.26556E-6
2-25141398-G-A p.Ser153Ser synonymous ADCY3 2 83142 2.40552E-5 41571 0 3.58529E-5
2-25141400-A-T p.Ser153Thr missense ADCY3 1 83150 1.20265E-5 41575 0 NA
2-25141412-C-T p.Ala149Thr missense ADCY3 1 83140 1.20279E-5 41570 0 3.18573E-5
2-25141433-C-T p.Val142Met missense ADCY3 2 83144 2.40547E-5 41572 0 8.25464E-6
2-25141434-G-A p.Tyr141Tyr synonymous ADCY3 8349 83036 0.100547 41518 507 0.117981
2-25141450-C-T p.Arg136His missense ADCY3 3 83102 3.61002E-5 41551 0 5.77624E-5
2-25141452-G-A p.Thr135Thr synonymous ADCY3 1 83106 1.20328E-5 41553 0 NA
2-25141457-C-G p.Val134Leu missense ADCY3 1 83110 1.20322E-5 41555 0 3.97864E-6
2-25141462-T-C p.Asp132Gly missense ADCY3 5 83096 6.01714E-5 41548 0 1.98937E-5
2-25141464-C-G p.Pro131Pro synonymous ADCY3 1 83110 1.20322E-5 41555 0 3.97874E-6
2-25141480-T-C p.Lys126Arg missense ADCY3 1 83140 1.20279E-5 41570 0 NA
2-25141481-T-C p.Lys126Glu missense ADCY3 2 83128 2.40593E-5 41564 0 NA
2-25141484-A-G p.Cys125Arg missense ADCY3 2 83144 2.40547E-5 41572 0 8.24783E-6
2-25141485-G-C p.Leu124Leu synonymous ADCY3 90 83140 0.00108251 41570 0 0.00239204
2-25141502-T-C p.Ile119Val missense ADCY3 1 83134 1.20288E-5 41567 0 3.97839E-6
2-25141508-A-T p.Leu117Met missense ADCY3 1 83122 1.20305E-5 41561 0 NA
2-25141508-A-G p.Leu117Leu synonymous ADCY3 1 83122 1.20305E-5 41561 0 2.47398E-5
2-25141516-C-T p.Gly114Glu missense ADCY3 3 83142 3.60828E-5 41571 0 NA
2-25141516-C-A p.Gly114Val missense ADCY3 1 83142 1.20276E-5 41571 0 7.9564E-6
2-25141529-C-T p.Val110Met missense ADCY3 29 83126 3.48868E-4 41563 0 0.00112139
2-25141530-G-A p.Ala109Ala synonymous ADCY3 46 83140 5.53284E-4 41570 0 9.23979E-4
2-25141535-G-A p.Leu108Phe missense ADCY3 3 83146 3.60811E-5 41573 0 3.18532E-5
2-25141538-A-G p.Ser107Pro missense ADCY3 41291 82840 0.498443 41420 11031 0.562784
2-25141546-T-C p.Lys104Arg missense ADCY3 4 83122 4.8122E-5 41561 0 9.55962E-5
2-25141567-G-A p.Ala97Val missense ADCY3 1 83060 1.20395E-5 41530 0 8.24674E-6
2-25141573-A-G p.Met95Thr missense ADCY3 1 83048 1.20412E-5 41524 0 0.00125
2-25141581-C-A p.Val92Val synonymous ADCY3 2 83046 2.4083E-5 41523 0 4.12412E-5
2-25141599-G-C p.Ala86Ala synonymous ADCY3 1 83048 1.20412E-5 41524 0 NA
2-25141620-C-G p.Leu79Leu synonymous ADCY3 9 83066 1.08348E-4 41533 0 5.96906E-5
2-25141634-G-A p.His75Tyr missense ADCY3 3 83040 3.61272E-5 41520 0 1.65216E-5
2-25141645-T-C p.Lys71Arg missense ADCY3 1 83018 1.20456E-5 41509 0 8.26638E-6
2-25141646-T-C p.Lys71Glu missense ADCY3 7 83008 8.43292E-5 41504 0 2.0712E-4
2-25141654-G-A p.Thr68Ile missense ADCY3 1 82924 1.20592E-5 41462 0 NA
2-25141675-G-T p.Ser61Tyr missense ADCY3 1 82670 1.20963E-5 41335 0 NA
2-25141677-C-G p.Glu60Asp missense ADCY3 10 82614 1.21045E-4 41307 0 9.55779E-5
2-25141678-T-C p.Glu60Gly missense ADCY3 1 82584 1.21089E-5 41292 0 NA
2-25141685-C-A p.Val58Leu missense ADCY3 1 82440 1.213E-5 41220 0 NA
2-25141697-G-T p.Arg54Arg synonymous ADCY3 1 82222 1.21622E-5 41111 0 3.18715E-5
2-25141702-A-C p.Phe52Cys missense ADCY3 2 82234 2.43208E-5 41117 0 NA
2-25141716-C-G p.Leu47Leu synonymous ADCY3 11 82030 1.34097E-4 41015 0 1.36638E-4
2-25141717-A-G p.Leu47Pro missense ADCY3 1 82004 1.21945E-5 41002 0 NA
2-25141724-A-G p.Ser45Pro missense ADCY3 1 81704 1.22393E-5 40852 0 3.18796E-5
2-25141726-C-G p.Gly44Ala missense ADCY3 1 81664 1.22453E-5 40832 0 NA
2-25141728-C-G p.Ser43Ser synonymous ADCY3 3 81666 3.6735E-5 40833 0 2.86716E-4
2-25141731-G-A p.Asn42Asn synonymous ADCY3 4 81550 4.90497E-5 40775 0 6.3743E-5
2-25141749-A-G p.His36His synonymous ADCY3 5 80936 6.17772E-5 40468 0 7.76558E-5
2-25141750-T-G p.His36Pro missense ADCY3 1 80942 1.23545E-5 40471 0 1.2158E-5
2-25141752-G-A p.Thr35Thr synonymous ADCY3 2 80836 2.47415E-5 40418 0 NA
2-25141753-G-A p.Thr35Ile missense ADCY3 1 80766 1.23814E-5 40383 0 NA
2-25141766-C-T p.Gly31Arg missense ADCY3 1 80096 1.2485E-5 40048 0 NA
2-25141767-G-A p.Arg30Arg synonymous ADCY3 6 79874 7.51183E-5 39937 0 5.05051E-4
2-25141768-C-T p.Arg30His missense ADCY3 1 79816 1.25288E-5 39908 0 6.27353E-4
2-25141794-G-A p.Ser21Ser synonymous ADCY3 14 78078 1.79308E-4 39039 0 1.81822E-4
2-25141794-G-C p.Ser21Ser synonymous ADCY3 1 78080 1.28074E-5 39040 0 2.02024E-5
2-25141794-GGAGTACTCGGCT-G p.Ala18_Ser21del disruptive_inframe_deletion ADCY3 2 78080 2.56148E-5 39040 0 NA
2-25141797-G-A p.Tyr20Tyr synonymous ADCY3 4 77878 5.13624E-5 38939 0 NA
2-25141803-G-A p.Ala18Ala synonymous ADCY3 1 77312 1.29346E-5 38656 0 NA
2-25141806-TGAGTACTCGGCC-T p.Ala14_Ser17del disruptive_inframe_deletion ADCY3 1 77052 1.29782E-5 38526 0 3.18918E-5
2-25141812-C-G p.Glu15Asp missense ADCY3 2 76396 2.61794E-5 38198 0 4.2629E-6
2-25141821-G-A p.Tyr12Tyr synonymous ADCY3 1 75120 1.3312E-5 37560 0 NA
2-25141822-T-C p.Tyr12Cys missense ADCY3 1 74916 1.33483E-5 37458 0 5.15464E-4
2-25142060-A-C c.-197-7T>G splice_region ADCY3 2 22996 8.69716E-5 11498 0 1.59439E-4
2-25142192-C-T c.-336G>A 5_prime_UTR_premature_start_codon_gain ADCY3 1 3408 2.93427E-4 1704 0 NA
2-25142213-C-T c.-357G>A 5_prime_UTR_premature_start_codon_gain ADCY3 1 2870 3.48432E-4 1435 0 NA