Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
8-145597744-A-G c.-41A>G 5_prime_UTR_premature_start_codon_gain ADCK5 1 58756 1.70195E-5 29378 0 NA
8-145597753-C-T c.-32C>T 5_prime_UTR_premature_start_codon_gain ADCK5 1 60168 1.66201E-5 30084 0 NA
8-145597758-G-T c.-27G>T 5_prime_UTR_premature_start_codon_gain ADCK5 1 61454 1.62723E-5 30727 0 NA
8-145597769-G-T c.-16G>T 5_prime_UTR_premature_start_codon_gain ADCK5 4 63034 6.34578E-5 31517 0 3.19142E-5
8-145597780-C-T c.-5C>T 5_prime_UTR_premature_start_codon_gain ADCK5 122 64158 0.00190156 32079 0 0.0062167
8-145597793-A-T p.Arg3Arg synonymous ADCK5 6 64650 9.28074E-5 32325 0 0.00218818
8-145597794-C-G p.Pro4Ala missense+splice_region ADCK5 1 64802 1.54316E-5 32401 0 NA
8-145597799-G-GCAGCTCTGTCATTTCCACTCTGCTCTGCTGCACAGAAGGC c.12+3_12+4insCAGCTCTGTCATTTCCACTCTGCTCTGCTGCACAGAAGGC splice_region ADCK5 2 65026 3.07569E-5 32513 0 NA
8-145599325-G-T n.224G>T splice_region ADCK5 2 24254 8.24606E-5 12127 0 NA
8-145603089-A-G p.His9Arg missense ADCK5 1 82312 1.21489E-5 41156 0 NA
8-145603089-A-T p.His9Leu missense ADCK5 1 82312 1.21489E-5 41156 0 4.06121E-6
8-145603101-C-T p.Ala13Val missense ADCK5 3 82476 3.63742E-5 41238 0 NA
8-145603108-G-A p.Cys48Tyr missense ADCK5 1 82562 1.21121E-5 41281 0 NA
8-145603113-G-T p.Glu50* stop_gained ADCK5 2 82552 2.42272E-5 41276 0 6.37186E-5
8-145603114-A-C p.Arg17Ser missense ADCK5 39259 81696 0.48055 40848 9994 0.543299
8-145603124-C-G p.Pro21Ala missense ADCK5 1 82606 1.21057E-5 41303 0 NA
8-145603131-C-T p.Pro23Leu missense ADCK5 8 82566 9.68922E-5 41283 0 0.0025
8-145603132-G-A p.Arg56His missense ADCK5 3 82548 3.63425E-5 41274 0 1.75211E-5
8-145603157-A-T p.Asn32Tyr missense ADCK5 1 82294 1.21516E-5 41147 0 9.23532E-6
8-145603159-C-T p.Thr65Met missense ADCK5 4 82240 4.86381E-5 41120 0 2.80794E-5
8-145603160-G-A p.Val33Ile missense ADCK5 1 82208 1.21643E-5 41104 0 3.18532E-5
8-145603168-C-T p.Ala68Val missense ADCK5 5 81960 6.10054E-5 40980 0 3.50341E-4
8-145603169-C-G p.Leu36Val missense ADCK5 1 81964 1.22005E-5 40982 0 9.77842E-6
8-145603181-T-TTCTCC c.116+2_116+3insTCTCC splice_region ADCK5 2 81586 2.4514E-5 40793 1 NA
8-145603184-C-T c.116+5C>T splice_region ADCK5 1 81350 1.22926E-5 40675 0 6.37227E-5
8-145603185-G-A c.116+6G>A splice_region ADCK5 2 81262 2.46117E-5 40631 0 3.34865E-5
8-145608282-G-T p.Arg39Ser missense+splice_region ADCK5 2 80724 2.47758E-5 40362 0 9.79989E-6
8-145608311-A-G p.Lys49Arg missense ADCK5 2 81110 2.46579E-5 40555 0 2.52169E-5
8-145608313-G-A p.Val50Met missense ADCK5 3 81088 3.69968E-5 40544 0 1.96626E-5
8-145608323-C-T p.Thr53Ile missense ADCK5 4 81158 4.92866E-5 40579 0 3.18674E-5
8-145608324-C-T p.Pro86Leu missense ADCK5 7 81164 8.62451E-5 40582 0 1.23536E-4
8-145608325-G-A p.Ala54Thr missense ADCK5 2 81148 2.46463E-5 40574 0 NA
8-145608326-C-T p.Ala54Val missense ADCK5 3 81160 3.6964E-5 40580 0 2.46153E-5
8-145608327-G-A p.Arg87Gln missense ADCK5 4 81184 4.92708E-5 40592 0 4.90316E-5
8-145608330-A-G p.Ter88Trpext*? stop_lost ADCK5 2 81146 2.46469E-5 40573 0 NA
8-145608338-C-T p.Ala58Val missense ADCK5 3 81170 3.69595E-5 40585 0 1.91883E-4
8-145608339-G-A p.Ala58Ala synonymous ADCK5 102 81172 0.00125659 40586 0 0.00716479
8-145608346-C-T p.Leu61Phe missense ADCK5 1 81254 1.23071E-5 40627 0 NA
8-145608348-C-T p.Leu61Leu synonymous ADCK5 1 81250 1.23077E-5 40625 0 NA
8-145608351-C-T p.Leu62Leu synonymous ADCK5 17 81252 2.09226E-4 40626 0 0.00102354
8-145608358-C-T p.Arg65Cys missense ADCK5 4 81272 4.92174E-5 40636 0 4.0391E-5
8-145608377-C-A p.Ala71Glu missense ADCK5 2 81192 2.4633E-5 40596 0 3.44305E-5
8-145608379-C-T p.Arg72Trp missense ADCK5 1 81130 1.23259E-5 40565 0 9.56206E-5
8-145608380-G-A p.Arg72Gln missense ADCK5 2 81158 2.46433E-5 40579 0 4.36334E-5
8-145608392-G-C p.Arg76Thr missense ADCK5 1 80950 1.23533E-5 40475 0 4.93713E-5
8-145608400-C-T p.Leu79Phe missense ADCK5 6 80626 7.44177E-5 40313 0 1.54666E-4
8-145608402-CGTG-C p.Val81del disruptive_inframe_deletion ADCK5 1 80464 1.24279E-5 40232 0 4.487E-6
8-145608403-G-A p.Val80Met missense ADCK5 1 80128 1.248E-5 40064 0 3.18837E-5
8-145608403-G-C p.Val80Leu missense ADCK5 4 80126 4.99214E-5 40063 0 4.81129E-4
8-145608405-G-T p.Val80Val synonymous ADCK5 1 80092 1.24856E-5 40046 0 NA
8-145608413-G-C p.Gly83Ala missense ADCK5 1 79974 1.25041E-5 39987 0 NA
8-145608422-G-T p.Arg86Leu missense ADCK5 1 79658 1.25537E-5 39829 0 NA
8-145608424-T-C p.Phe87Leu missense ADCK5 1 79646 1.25556E-5 39823 0 NA
8-145608433-TAGGAGGGC-T c.266+3_266+10delAGGAGGGC splice_region ADCK5 3 79422 3.77729E-5 39711 0 NA
8-145614470-C-T p.Leu92Phe missense ADCK5 4 9660 4.14079E-4 4830 0 3.93938E-4
8-145614515-C-T p.Pro107Ser missense ADCK5 1 9640 1.03734E-4 4820 0 9.1191E-5
8-145615866-C-T c.267-5C>T splice_region ADCK5 1 81368 1.22898E-5 40684 0 3.18634E-5
8-145615867-G-A c.267-4G>A splice_region ADCK5 2 81372 2.45785E-5 40686 0 2.78257E-5
8-145615889-G-A p.Leu95Leu synonymous ADCK5 2 82076 2.43677E-5 41038 0 8.55857E-6
8-145615891-A-G p.Gln96Arg missense ADCK5 16 82102 1.9488E-4 41051 0 2.22916E-4
8-145615895-C-A p.Ile97Ile synonymous ADCK5 10 82132 1.21755E-4 41066 0 6.36862E-4
8-145615901-G-A p.Leu99Leu synonymous ADCK5 1 82162 1.21711E-5 41081 0 3.99926E-6
8-145615904-C-T p.Asp100Asp synonymous ADCK5 1 82208 1.21643E-5 41104 0 3.99821E-6
8-145615932-C-T p.Arg110* stop_gained ADCK5 2 82356 2.42848E-5 41178 0 1.19913E-5
8-145615940-G-A p.Val112Val synonymous ADCK5 281 82380 0.00341102 41190 2 0.00503525
8-145615941-G-A p.Glu113Lys missense ADCK5 7 82358 8.49948E-5 41179 0 1.27437E-4
8-145615944-GAGGTTTGTCCTGGTGCCCTGGGCACACAGTGGTGGGCATGAGGTGGTGGGCTGGGTGGGACTGAGGAGGCAGCCACCTGTCCCCATGTGTTCTCCCCATGCCTGTGGTC-G c.342+1_343-1del splice_acceptor ADCK5 7 82404 8.49473E-5 41202 0 NA
8-145615946-G-C p.Glu114Asp missense+splice_region ADCK5 1 82414 1.21339E-5 41207 0 8.38729E-6
8-145616057-A-G p.Asn115Ser missense+splice_region ADCK5 1 82064 1.21856E-5 41032 0 NA
8-145616063-C-T p.Pro117Leu missense ADCK5 3 82020 3.65764E-5 41010 0 3.18634E-5
8-145616066-G-C p.Gly118Ala missense ADCK5 7 82032 8.53326E-5 41016 0 0.0020141
8-145616078-T-C p.Val122Ala missense ADCK5 2 82052 2.43748E-5 41026 0 NA
8-145616079-G-C p.Asp121His missense ADCK5 1 82102 1.218E-5 41051 0 4.00173E-6
8-145616088-G-A p.Val124Met missense ADCK5 7 82132 8.52287E-5 41066 0 1.41386E-4
8-145616098-C-T p.Arg129Trp missense ADCK5 1 82182 1.21681E-5 41091 0 NA
8-145616102-C-T p.Ala130Val missense ADCK5 1 82198 1.21657E-5 41099 0 3.18776E-5
8-145616103-G-A p.Gly129Ser missense ADCK5 2 82216 2.43262E-5 41108 0 6.40985E-5
8-145616124-G-A p.Gly137Gly synonymous ADCK5 1 82462 1.21268E-5 41231 0 NA
8-145616128-A-G p.Ile139Val missense ADCK5 2 82454 2.42559E-5 41227 0 8.3375E-5
8-145616129-T-C p.Ile139Thr missense ADCK5 1 82458 1.21274E-5 41229 0 NA
8-145616136-C-T p.Asn141Asn synonymous ADCK5 2 82482 2.42477E-5 41241 0 8.00897E-6
8-145616139-G-C p.Gly142Gly synonymous ADCK5 1 82562 1.21121E-5 41281 0 NA
8-145616142-C-A p.Gly143Gly synonymous ADCK5 2 82564 2.42236E-5 41282 0 4.00314E-6
8-145616148-C-T p.Tyr145Tyr synonymous ADCK5 3 82592 3.63231E-5 41296 0 7.50926E-5
8-145616149-G-T p.Val146Leu missense ADCK5 3 82608 3.63161E-5 41304 0 NA
8-145616185-C-T p.Leu158Leu synonymous ADCK5 2 82766 2.41645E-5 41383 0 NA
8-145616207-G-A p.Arg165Gln missense ADCK5 2 82726 2.41762E-5 41363 0 3.34767E-5
8-145616209-A-G p.Thr166Ala missense ADCK5 1 82746 1.20852E-5 41373 0 NA
8-145616211-C-A p.Thr166Thr synonymous ADCK5 1 82742 1.20858E-5 41371 0 8.37142E-6
8-145616216-G-A p.Arg168His missense ADCK5 3 82746 3.62555E-5 41373 0 6.37389E-5
8-145616217-C-T p.Arg168Arg synonymous ADCK5 25 82744 3.02137E-4 41372 0 2.09335E-4
8-145616218-G-A p.Val169Met missense ADCK5 17 82728 2.05493E-4 41364 0 4.49002E-4
8-145616233-G-A p.Ala174Thr missense ADCK5 1 82690 1.20934E-5 41345 0 NA
8-145616238-C-T p.Leu175Leu synonymous ADCK5 3 82694 3.62783E-5 41347 0 4.01681E-6
8-145616242-C-T p.Arg177Trp missense ADCK5 174 82656 0.00210511 41328 2 0.00573577
8-145616243-G-A p.Arg177Gln missense ADCK5 1 82676 1.20954E-5 41338 0 8.39476E-6
8-145616250-C-A p.Phe179Leu missense ADCK5 2 82630 2.42043E-5 41315 0 NA
8-145616254-GAGGTGAGTGTGCGCTCAGGCCGAGGGAGGTGGGGCCTCCAGCAGTGGCCCCAGGCTGCTCTGAGCACCTGTCCTTCC-G p.Glu181fs frameshift ADCK5 9 82630 1.08919E-4 41315 1 NA
8-145616256-G-A p.Glu181Glu splice_region+synonymous ADCK5 4 82630 4.84086E-5 41315 0 4.42627E-5
8-145616260-A-T c.543+4A>T splice_region ADCK5 1 82598 1.21068E-5 41299 0 NA
8-145616261-G-A c.543+5G>A splice_region ADCK5 1 82610 1.21051E-5 41305 0 8.39067E-6
8-145616263-G-T c.543+7G>T splice_region ADCK5 1 82580 1.21095E-5 41290 0 8.39053E-5
8-145616263-GT-TA p.Gln180Leu missense ADCK5 1 82580 1.21095E-5 41290 0 NA
8-145616264-T-A c.543+8T>A splice_region ADCK5 1 82572 1.21106E-5 41286 0 8.39109E-5
8-145616349-CT-C p.Glu188fs frameshift ADCK5 1 82054 1.21871E-5 41027 0 NA
8-145616372-C-G p.Pro194Pro synonymous ADCK5 1 81972 1.21993E-5 40986 0 1.66508E-5
8-145616375-C-G p.His195Gln missense ADCK5 3 81912 3.66247E-5 40956 0 1.20265E-5
8-145616396-C-CT p.Tyr203fs frameshift ADCK5 1 82184 1.21678E-5 41092 0 NA
8-145616406-A-G p.Ile206Val missense ADCK5 2 82372 2.42801E-5 41186 0 3.18613E-5
8-145616414-C-T p.Ala208Ala synonymous ADCK5 1 82374 1.21398E-5 41187 0 8.31587E-6
8-145616435-C-T p.His215His synonymous ADCK5 5 82498 6.06075E-5 41249 0 1.59276E-4
8-145616445-C-T p.Leu219Leu synonymous ADCK5 30 82574 3.6331E-4 41287 0 0.00151057
8-145616447-G-A p.Leu219Leu synonymous ADCK5 1 82594 1.21074E-5 41297 0 8.31753E-6
8-145616450-C-T p.His220His synonymous ADCK5 2 82606 2.42113E-5 41303 0 1.66353E-5
8-145616462-C-T p.Ser224Ser synonymous ADCK5 2 82618 2.42078E-5 41309 0 6.37024E-5
8-145616471-G-A p.Val227Val synonymous ADCK5 10 82682 1.20945E-4 41341 0 0.00151057
8-145616472-AAGGTATATGGGGGCTGCCTTGTTCAGCAGTGGGCTGGGGCGGGGCACAGTGGGGCCCCAAGTTCTCACCACACCCTCGCCCAGTGC-A p.Lys228fs frameshift ADCK5 10 82668 1.20966E-4 41334 3 NA
8-145616558-C-T c.685-3C>T splice_region ADCK5 1 82868 1.20674E-5 41434 0 3.18654E-5
8-145616572-C-T p.Ile232Ile synonymous ADCK5 1 82888 1.20645E-5 41444 0 1.20058E-5
8-145616573-G-A p.Asp233Asn missense ADCK5 1 82886 1.20648E-5 41443 0 2.40088E-5
8-145616574-A-G p.Asp233Gly missense ADCK5 2 82880 2.41313E-5 41440 0 NA
8-145616580-G-A p.Arg235Gln missense ADCK5 2 82908 2.41231E-5 41454 0 1.67448E-5
8-145616594-G-A p.Gly240Arg missense ADCK5 1 82912 1.2061E-5 41456 0 NA
8-145616597-G-A p.Asp241Asn missense ADCK5 1 82898 1.2063E-5 41449 0 NA
8-145616607-C-A p.Thr244Asn missense ADCK5 1 82886 1.20648E-5 41443 0 8.44951E-6
8-145616635-G-A p.Glu253Glu synonymous ADCK5 1 82538 1.21156E-5 41269 0 NA
8-145616648-A-G p.Ser258Gly missense ADCK5 1 82412 1.21342E-5 41206 0 4.03307E-6
8-145616668-C-T p.Val264Val synonymous ADCK5 1 82242 1.21592E-5 41121 0 6.25E-4
8-145616670-TCCAGGTACAGCCCCACCCCTTCCCCGGCCAGCAGGAGCAAACACGTAGGCAGAGCTGGTAGGAGCAGCTGGTAGGCAGAGCTGGTCTTCAACCGCCATCTGGCCC-T p.Gln266fs frameshift ADCK5 8 82244 9.72715E-5 41122 1 NA
8-145616671-C-T p.Leu265Leu synonymous ADCK5 1 82264 1.2156E-5 41132 0 1.00422E-5
8-145616679-A-G c.798+5A>G splice_region ADCK5 1 82142 1.2174E-5 41071 0 NA
8-145616783-C-T p.Leu268Leu synonymous ADCK5 2 80638 2.48022E-5 40319 0 NA
8-145616791-G-A p.Gly270Gly synonymous ADCK5 1 80622 1.24036E-5 40311 0 2.54544E-5
8-145616815-C-T p.Phe278Phe synonymous ADCK5 2 80522 2.48379E-5 40261 0 NA
8-145616816-G-A p.Glu279Lys missense ADCK5 5 80526 6.20917E-5 40263 0 NA
8-145616827-C-T p.Gly282Gly synonymous ADCK5 1 80428 1.24335E-5 40214 0 NA
8-145616828-C-T p.Arg283Cys missense ADCK5 3 80382 3.73218E-5 40191 0 NA
8-145616829-G-A p.Arg283His missense ADCK5 2 80348 2.48917E-5 40174 0 NA
8-145616833-C-T p.Asn284Asn synonymous ADCK5 1 80370 1.24425E-5 40185 0 0.00101937
8-145616834-G-A p.Ala285Thr missense ADCK5 1 80320 1.24502E-5 40160 0 6.00601E-6
8-145616840-C-T p.Arg287Cys missense ADCK5 2 80186 2.4942E-5 40093 0 4.14388E-5
8-145616844-G-C p.Cys288Ser missense ADCK5 1 80206 1.24679E-5 40103 0 NA
8-145616859-C-T p.Ala293Val missense ADCK5 3 79764 3.7611E-5 39882 0 6.61131E-6
8-145616864-T-C p.Phe295Leu missense ADCK5 1 79742 1.25404E-5 39871 0 NA
8-145616866-C-T p.Phe295Phe synonymous ADCK5 1 79698 1.25474E-5 39849 0 3.18593E-5
8-145616870-T-G p.Tyr297Asp missense ADCK5 2 79620 2.51193E-5 39810 0 6.72929E-6
8-145616873-G-T p.Val298Phe missense ADCK5 1 79462 1.25846E-5 39731 0 5.26316E-4
8-145616876-G-A p.Val299Met missense ADCK5 1 79248 1.26186E-5 39624 0 6.77167E-6
8-145616882-C-G p.Pro301Ala missense ADCK5 1 79002 1.26579E-5 39501 0 3.18573E-5
8-145616886-G-A p.Arg302His missense ADCK5 1 78860 1.26807E-5 39430 0 3.18593E-5
8-145616887-C-T p.Arg302Arg synonymous ADCK5 38 78772 4.82405E-4 39386 0 7.79285E-4
8-145616888-G-A p.Val303Met missense ADCK5 2 78734 2.5402E-5 39367 0 6.83882E-6
8-145616909-AAGGTGGGCTGGGCCAGGCCCTTGGGGTGGGCACAGCGCTGGGCCTGCTGAGCCCAGCCTCTTGCTCTCCCC-A c.930+1_931-1delGTGGGCTGGGCCAGGCCCTTGGGGTGGGCACAGCGCTGGGCCTGCTGAGCCCAGCCTCTTGCTCTCCCCAG splice_acceptor ADCK5 1 77522 1.28996E-5 38761 0 NA
8-145616977-C-T c.931-6C>T splice_region ADCK5 4 69144 5.78503E-5 34572 0 NA
8-145616985-C-T p.Arg311Arg splice_region+synonymous ADCK5 4 66724 5.99484E-5 33362 0 5.82886E-5
8-145616997-C-T p.Ala315Ala synonymous ADCK5 1 63694 1.57001E-5 31847 0 9.92359E-5
8-145617007-G-A p.Ala319Thr missense ADCK5 3 60286 4.97628E-5 30143 0 3.1998E-5
8-145617018-G-A p.Lys322Lys synonymous ADCK5 1 58108 1.72093E-5 29054 0 5.20356E-6
8-145617023-A-G p.Asn324Ser missense ADCK5 9 56698 1.58736E-4 28349 0 0.005625
8-145617044-G-A p.Ser331Asn missense ADCK5 6 52038 1.153E-4 26019 1 2.84787E-4
8-145617056-C-T p.Ala335Val missense ADCK5 1 49958 2.00168E-5 24979 0 8.35282E-5
8-145617066-CGTGAGTGCGGGGGGGCGGGGGCGGGTCAGGGCGGGCTGGTGCTGTGTCCACTGCAATGCCTCTCCTCTCCCCAG-C c.1014+1_1015-1delGTGAGTGCGGGGGGGCGGGGGCGGGTCAGGGCGGGCTGGTGCTGTGTCCACTGCAATGCCTCTCCTCTCCCCAG splice_acceptor ADCK5 7 47550 1.47213E-4 23775 0 NA
8-145617072-T-TGCGGGGGG c.1014+6_1014+7insGCGGGGGG splice_region ADCK5 1 46266 2.16141E-5 23133 0 2.784E-5
8-145617074-C-T c.1014+8C>T splice_region ADCK5 2 45074 4.43715E-5 22537 0 2.43191E-4
8-145617138-C-CAGAT c.1015-3_1015-2insAGAT splice_acceptor ADCK5 1 60522 1.65229E-5 30261 0 4.06832E-6
8-145617141-A-G p.Ile339Val missense+splice_region ADCK5 4 60878 6.57052E-5 30439 0 6.7769E-5
8-145617142-T-C p.Ile339Thr missense+splice_region ADCK5 1 61126 1.63597E-5 30563 0 NA
8-145617153-CTCA-C p.Ile344del disruptive_inframe_deletion ADCK5 1 62432 1.60174E-5 31216 0 NA
8-145617177-A-T p.Ile351Leu missense ADCK5 1 66542 1.50281E-5 33271 0 2.01849E-5
8-145617188-C-T p.Thr354Thr synonymous ADCK5 3 67832 4.42269E-5 33916 0 9.57549E-5
8-145617217-G-C p.Gly364Ala missense ADCK5 1 71034 1.40778E-5 35517 0 NA
8-145617221-CGGTAGGAATTTACCCCAGGGGTGGGGGTCTCGGGGTGGGCGCAGCGCGACCTAAGAGGCTGTATCCCTA-C p.Val366fs frameshift ADCK5 7 71280 9.82043E-5 35640 0 NA
8-145617285-T-A c.1097-7T>A splice_region ADCK5 1 75174 1.33025E-5 37587 0 NA
8-145617299-G-C p.Val368Val synonymous ADCK5 1 74570 1.34102E-5 37285 0 9.04945E-6
8-145617310-C-T p.Pro372Leu missense ADCK5 5 73706 6.78371E-5 36853 0 3.78372E-5
8-145617311-G-C p.Pro372Pro synonymous ADCK5 1 73744 1.35604E-5 36872 0 1.21834E-5
8-145617311-G-A p.Pro372Pro synonymous ADCK5 1 73744 1.35604E-5 36872 0 2.86867E-5
8-145617314-C-T p.Asp373Asp synonymous ADCK5 2 73296 2.72866E-5 36648 0 3.21337E-5
8-145617323-G-A p.Ala376Ala synonymous ADCK5 23 72378 3.17776E-4 36189 0 5.05561E-4
8-145617323-G-C p.Ala376Ala synonymous ADCK5 1 72378 1.38164E-5 36189 0 8.17488E-6
8-145617344-C-T p.His383His synonymous ADCK5 1 68938 1.45058E-5 34469 0 4.27453E-6
8-145617366-G-A p.Glu391Lys missense ADCK5 6 63670 9.42359E-5 31835 0 6.3597E-5
8-145617370-AGTGAGCGCGGGTGGGTGGGCGTGGGGCAGGGCAAGCCTCTCCTGCCGCAGGGAGCTCATGGCTGCGGGCCCATCCACACCCAG-A c.1175+1_1176-1delGTGAGCGCGGGTGGGTGGGCGTGGGGCAGGGCAAGCCTCTCCTGCCGCAGGGAGCTCATGGCTGCGGGCCCATCCACACCCAG splice_acceptor ADCK5 6 61932 9.68805E-5 30966 0 NA
8-145617370-A-C p.Lys392Thr missense+splice_region ADCK5 2 61934 3.22924E-5 30967 0 1.39558E-4
8-145617376-C-CGGGG c.1175+6_1175+7insGGGG splice_region ADCK5 1 56980 1.755E-5 28490 0 NA
8-145617377-G-A c.1175+7G>A splice_region ADCK5 1 56624 1.76604E-5 28312 0 3.2396E-5
8-145617448-A-C c.1176-6A>C splice_region ADCK5 1 54532 1.83379E-5 27266 0 NA
8-145617458-C-T p.Arg394Cys missense ADCK5 1 52870 1.89143E-5 26435 0 7.34948E-6
8-145617460-C-T p.Arg394Arg synonymous ADCK5 3 52258 5.74075E-5 26129 0 2.95003E-5
8-145617467-C-T p.Leu397Phe missense ADCK5 1 51770 1.93162E-5 25885 0 NA
8-145617504-A-C p.Asp409Ala missense ADCK5 6 47320 1.26796E-4 23660 0 9.09256E-5
8-145617506-G-A p.Ala410Thr missense ADCK5 1 47000 2.12766E-5 23500 0 9.26647E-6
8-145617507-C-G p.Ala410Gly missense ADCK5 13 47146 2.75739E-4 23573 0 0.00119644
8-145617508-C-G p.Ala410Ala synonymous ADCK5 2 47148 4.24196E-5 23574 0 3.19101E-5
8-145617512-A-G p.Met412Val missense ADCK5 1 47024 2.12657E-5 23512 0 NA
8-145617519-C-G p.Ala414Gly missense ADCK5 1 46368 2.15666E-5 23184 0 NA
8-145617530-G-A p.Ala418Thr missense ADCK5 1 45404 2.20245E-5 22702 0 3.11721E-5
8-145617534-TGGGGGTGCAAGGTGA-T p.Gly420fs frameshift ADCK5 20644 44758 0.461236 22379 5144 0.545293
8-145617534-T-TGGGGGTGCAAGGTGA c.1267+4_1267+5insGGGGGTGCAAGGTGA splice_region ADCK5 3 45238 6.63159E-5 22619 0 9.7056E-5
8-145617553-G-C c.1267+8G>C splice_region ADCK5 2 43846 4.56142E-5 21923 0 3.07427E-5
8-145617653-T-C c.1268-7T>C splice_region ADCK5 4 37388 1.06986E-4 18694 0 0.213041
8-145617653-T-TCCCC c.1268-7_1268-6insCCCC splice_region ADCK5 2 39954 5.00576E-5 19977 0 2.6096E-4
8-145617653-T-TCCCTCCCC c.1268-7_1268-6insCCCTCCCC splice_region ADCK5 1 39954 2.50288E-5 19977 0 NA
8-145617657-CAGACTA-C p.Asp423fs frameshift ADCK5 2 39516 5.06124E-5 19758 0 0.0196346
8-145617657-CAGA-C p.Asp423fs frameshift ADCK5 3 40162 7.46975E-5 20081 0 0.00172056
8-145617657-CAG-C c.1268-2_1268-1delAG splice_acceptor ADCK5 1 40226 2.48595E-5 20113 0 2.53024E-5
8-145617657-C-T c.1268-3C>T splice_region ADCK5 1 40228 2.48583E-5 20114 0 NA
8-145617659-G-C c.1268-1G>C splice_acceptor ADCK5 13 40032 3.2474E-4 20016 0 6.04566E-5
8-145617659-G-A c.1268-1G>A splice_acceptor ADCK5 5 40090 1.24719E-4 20045 0 NA
8-145617661-CTA-C p.Tyr424fs frameshift ADCK5 6 40158 1.4941E-4 20079 0 0.00131644
8-145617662-T-C p.Tyr424His missense+splice_region ADCK5 2 40206 4.97438E-5 20103 0 8.1818E-5
8-145617666-T-C p.Leu425Pro missense ADCK5 20 40250 4.96894E-4 20125 0 0.00170428
8-145617676-C-T p.Ala428Ala synonymous ADCK5 1 40756 2.45363E-5 20378 0 7.89815E-6
8-145617692-C-T p.Arg434Cys missense ADCK5 1 41508 2.40917E-5 20754 0 1.53969E-5
8-145617696-C-A p.Pro435His missense ADCK5 1 41936 2.38459E-5 20968 0 NA
8-145617697-C-T p.Pro435Pro synonymous ADCK5 5 41962 1.19155E-4 20981 0 3.79991E-5
8-145617698-G-A p.Val436Met missense ADCK5 1 41992 2.38141E-5 20996 0 NA
8-145617701-C-T p.Arg437Cys missense ADCK5 3 42130 7.12082E-5 21065 0 NA
8-145617704-C-G p.Leu438Val missense ADCK5 2 42510 4.70478E-5 21255 0 NA
8-145617706-G-T p.Leu438Leu synonymous ADCK5 1 42672 2.34346E-5 21336 0 3.53903E-4
8-145617710-C-A p.Gln440Lys missense ADCK5 1 42890 2.33155E-5 21445 0 NA
8-145617720-G-T p.Gly443Val missense ADCK5 1 43606 2.29326E-5 21803 0 NA
8-145617724-G-A p.Ser444Ser synonymous ADCK5 1 43890 2.27842E-5 21945 0 6.26566E-4
8-145617728-C-G p.Leu446Val missense ADCK5 3 44536 6.73612E-5 22268 0 1.27992E-4
8-145617735-G-A p.Ser448Asn missense ADCK5 1 45380 2.20361E-5 22690 0 6.39632E-5
8-145617739-C-T p.Arg449Arg synonymous ADCK5 3 45832 6.54565E-5 22916 0 1.3637E-4
8-145617749-G-A p.Ala453Thr missense ADCK5 42 48018 8.74672E-4 24009 0 0.00666667
8-145617782-G-A p.Glu464Lys missense ADCK5 1 53068 1.88437E-5 26534 0 6.37633E-5
8-145617784-G-T p.Glu464Asp missense ADCK5 2 53480 3.73972E-5 26740 0 4.02771E-5
8-145617787-C-T p.Ala465Ala synonymous ADCK5 2 53930 3.70851E-5 26965 0 0.0020555
8-145617788-G-A p.Val466Ile missense ADCK5 1 54096 1.84857E-5 27048 0 1.1716E-4
8-145617793-G-A p.Met467Ile missense ADCK5 1 54940 1.82017E-5 27470 0 2.67277E-5
8-145617794-G-A p.Ala468Thr missense ADCK5 1 54956 1.81964E-5 27478 0 NA
8-145617796-G-A p.Ala468Ala synonymous ADCK5 2 54980 3.63769E-5 27490 0 1.0618E-4
8-145617802-C-G p.Leu470Leu synonymous ADCK5 1 55400 1.80505E-5 27700 0 NA
8-145617803-A-G p.Arg471Gly missense ADCK5 1 55354 1.80655E-5 27677 0 NA
8-145617806-G-A p.Glu472Lys missense ADCK5 1 55584 1.79908E-5 27792 0 3.23353E-5
8-145617808-G-A p.Glu472Glu synonymous ADCK5 2 55408 3.60959E-5 27704 0 NA
8-145617809-C-T p.Leu473Leu synonymous ADCK5 3 55330 5.42201E-5 27665 0 1.58058E-4
8-145617811-G-C p.Leu473Leu synonymous ADCK5 1 55706 1.79514E-5 27853 0 NA
8-145617813-C-T p.Pro474Leu missense ADCK5 1 55832 1.79109E-5 27916 0 NA
8-145617821-A-G p.Met477Val missense ADCK5 1 56664 1.76479E-5 28332 0 NA
8-145617829-G-C p.Leu479Leu synonymous ADCK5 1 56562 1.76797E-5 28281 0 4.94917E-6
8-145617844-C-T p.Ile484Ile synonymous ADCK5 1 56882 1.75803E-5 28441 0 NA
8-145617850-C-G p.Thr486Thr synonymous ADCK5 2 56418 3.54497E-5 28209 0 3.94104E-5
8-145617850-C-T p.Thr486Thr synonymous ADCK5 3 56416 5.31764E-5 28208 0 1.97052E-5
8-145617854-C-T p.Arg488Cys missense ADCK5 2 56018 3.57028E-5 28009 0 NA
8-145617866-G-A p.Val492Met missense ADCK5 2 54924 3.6414E-5 27462 0 2.98974E-4
8-145617872-C-T p.Leu494Phe missense ADCK5 1 54142 1.84699E-5 27071 0 6.25E-4
8-145617878-G-A p.Ala496Thr missense ADCK5 1 52386 1.90891E-5 26193 0 1.49178E-5
8-145617891-G-A p.Arg500His missense ADCK5 3 51342 5.84317E-5 25671 1 1.31593E-5
8-145617895-C-T p.Tyr501Tyr synonymous ADCK5 7 51368 1.36272E-4 25684 0 6.25782E-4
8-145617899-C-T p.Leu503Phe missense ADCK5 2 50808 3.93639E-5 25404 0 NA
8-145617907-TAA-T p.Arg507fs frameshift ADCK5 2 49994 4.00048E-5 24997 0 NA
8-145617910-A-G p.Lys506Lys splice_region+synonymous ADCK5 4198 49606 0.0846269 24803 326 0.144168
8-145617910-AAGGTCGGTGGCCCGAGGAGGCGCCCGGGCCGTGGTGGGGCTGGTGTGGGGCTGACGCGGCGCTAACGCGGGTGTGTGC-A p.Arg507fs frameshift ADCK5 6 49786 1.20516E-4 24893 0 NA
8-145617912-GGTCGGTGGCCCGAGGAGGCGCCCGGGCCGTGGTGGGGCTGGTGTGGGGCTGACGCGGCGCTAACGCGGGTGTGTGC-G c.1520+1_1521-3delGTCGGTGGCCCGAGGAGGCGCCCGGGCCGTGGTGGGGCTGGTGTGGGGCTGACGCGGCGCTAACGCGGGTGTGTGC splice_donor ADCK5 1 49530 2.01898E-5 24765 0 NA
8-145617915-C-T c.1520+3C>T splice_region ADCK5 1 48878 2.04591E-5 24439 0 8.90535E-6
8-145617983-G-C c.1521-8G>C splice_region ADCK5 23 49782 4.62014E-4 24891 0 3.50475E-4
8-145618010-C-CGGACA p.Leu515fs frameshift ADCK5 1 50538 1.97871E-5 25269 0 NA
8-145618012-C-G p.Arg514Arg synonymous ADCK5 1 50646 1.97449E-5 25323 0 2.84333E-5
8-145618017-C-T p.Ala516Val missense ADCK5 2 50554 3.95617E-5 25277 0 NA
8-145618018-G-A p.Ala516Ala synonymous ADCK5 83 50588 0.00164071 25294 0 0.00197884
8-145618018-G-C p.Ala516Ala synonymous ADCK5 1 50588 1.97675E-5 25294 0 NA
8-145618021-C-T p.Gly517Gly synonymous ADCK5 2 50294 3.97662E-5 25147 0 5.73197E-5
8-145618022-G-C p.Ala518Pro missense ADCK5 5 50454 9.91002E-5 25227 0 1.59388E-4
8-145618022-G-A p.Ala518Thr missense ADCK5 3 50454 5.94601E-5 25227 0 6.37552E-5
8-145618032-G-A p.Arg521Gln missense ADCK5 1 51072 1.95802E-5 25536 0 3.81639E-5
8-145618035-G-A p.Gly522Asp missense ADCK5 1 51338 1.94787E-5 25669 0 NA
8-145618039-C-T p.Val523Val synonymous ADCK5 1 51424 1.94462E-5 25712 0 6.25E-4
8-145618050-G-A p.Ser527Asn missense ADCK5 4 51738 7.73126E-5 25869 0 8.06644E-4
8-145618068-A-G p.Lys533Arg missense ADCK5 3 52848 5.67666E-5 26424 0 2.91316E-5
8-145618074-T-C p.Val535Ala missense ADCK5 1 53108 1.88296E-5 26554 0 NA
8-145618094-G-A p.Glu542Lys missense ADCK5 2 55678 3.59208E-5 27839 0 NA
8-145618101-C-T p.Ala544Val missense ADCK5 2 55742 3.58796E-5 27871 0 2.86862E-5
8-145618102-G-A p.Ala544Ala synonymous ADCK5 2 56196 3.55897E-5 28098 0 6.0579E-4
8-145618104-TCAGGTGAGTGGCCGCGGGGCAGGTGGGTGGCGGGGGCCTGCTCCCCACCCACCTGTGACCTGTGACCTGACCCACG-T p.Arg546del splice_donor ADCK5 8 56458 1.41698E-4 28229 0 NA
8-145618105-C-T p.Leu545Leu splice_region+synonymous ADCK5 55 56690 9.70189E-4 28345 0 0.00455466
8-145618114-G-A c.1637+7G>A splice_region ADCK5 1 57826 1.72933E-5 28913 0 NA
8-145618176-C-G c.1638-8C>G splice_region ADCK5 2 68680 2.91206E-5 34340 0 6.47082E-5
8-145618179-C-T c.1638-5C>T splice_region ADCK5 2 69028 2.89737E-5 34514 0 1.28849E-4
8-145618184-G-A p.Arg546Arg splice_region+synonymous ADCK5 5 69846 7.15861E-5 34923 0 6.4E-5
8-145618190-G-A p.Glu548Glu synonymous ADCK5 1 70530 1.41784E-5 35265 0 NA
8-145618196-G-C p.Leu550Phe missense ADCK5 2 71140 2.81136E-5 35570 0 1.98075E-5
8-145618200-A-G p.Met552Val missense ADCK5 1 71422 1.40013E-5 35711 0 3.18918E-5
8-145618203-C-T p.Arg553Trp missense ADCK5 1 71222 1.40406E-5 35611 0 9.84737E-6
8-145618211-C-T p.Thr555Thr synonymous ADCK5 2 72120 2.77316E-5 36060 0 4.83218E-6
8-145618212-G-A p.Ala556Thr missense ADCK5 2 71956 2.77948E-5 35978 0 4.84088E-6
8-145618217-C-T p.Leu557Leu synonymous ADCK5 2 72764 2.74861E-5 36382 0 NA
8-145618219-T-A p.Leu558Gln missense ADCK5 1 72730 1.37495E-5 36365 0 NA
8-145618220-G-A p.Leu558Leu synonymous ADCK5 1 72656 1.37635E-5 36328 0 NA
8-145618222-C-G p.Ala559Gly missense ADCK5 1 72664 1.3762E-5 36332 0 NA
8-145618222-C-T p.Ala559Val missense ADCK5 1 72664 1.3762E-5 36332 0 NA
8-145618248-G-T p.Val568Leu missense ADCK5 94 72964 0.00128831 36482 0 0.00189641
8-145618254-C-T p.Pro570Ser missense ADCK5 1 73426 1.36192E-5 36713 0 NA
8-145618269-T-C p.Tyr575His missense ADCK5 1 73356 1.36322E-5 36678 0 NA
8-145618271-C-T p.Tyr575Tyr synonymous ADCK5 7 73268 9.55397E-5 36634 0 0.00152439
8-145618283-G-T p.Glu579Asp missense ADCK5 1 72962 1.37058E-5 36481 0 NA
8-145618451-CA-C c.*1587delA splice_region ADCK5 1 78778 1.26939E-5 39389 0 NA