Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
6-143749615-T-A p.Glu187Asp missense ADAT2 1600 83118 0.0192497 41559 91 0.0406551
6-143749615-T-C p.Glu187Glu synonymous ADAT2 2 83148 2.40535E-5 41574 0 NA
6-143749624-C-A p.Arg184Arg synonymous ADAT2 1 83176 1.20227E-5 41588 0 NA
6-143749625-C-T p.Arg184Gln missense ADAT2 1 83158 1.20253E-5 41579 0 5.03525E-4
6-143749626-G-A p.Arg184Trp missense ADAT2 1 83160 1.2025E-5 41580 0 5.03525E-4
6-143749628-A-C p.Val183Gly missense ADAT2 1 83162 1.20247E-5 41581 0 8.29036E-6
6-143749633-C-G p.Ser181Ser synonymous ADAT2 1 83162 1.20247E-5 41581 0 5.03525E-4
6-143749643-GCTGTGAAAAGAATAGAAAAGAAAAAGAAAATGAAGAGGTAAGCTCATAGCAGATTCTCTTTGTATGGATTTAAGGGAAGGACATTATCCACAACAGAAAACTGAC-G c.532+1_533-1del splice_acceptor ADAT2 10 83160 1.2025E-4 41580 5 NA
6-143749646-G-C c.533-3C>G splice_region ADAT2 3 83146 3.60811E-5 41573 0 8.02182E-6
6-143749745-T-G c.532+4A>C splice_region ADAT2 2 83122 2.4061E-5 41561 0 NA
6-143749754-G-T p.Pro176Gln missense ADAT2 1 83130 1.20294E-5 41565 0 NA
6-143749756-A-G p.Asn175Asn synonymous ADAT2 1 83138 1.20282E-5 41569 0 1.27437E-4
6-143749762-T-C p.Gln173Gln synonymous ADAT2 195 83140 0.00234544 41570 3 0.00401172
6-143749765-T-A p.Lys172Asn missense ADAT2 6 83152 7.2157E-5 41576 0 2.49273E-5
6-143749766-T-C p.Lys172Arg missense ADAT2 1 83148 1.20267E-5 41574 0 8.30979E-6
6-143749767-T-G p.Lys172Gln missense ADAT2 3 83148 3.60802E-5 41574 0 NA
6-143749769-TAGA-T p.Phe170del disruptive_inframe_deletion ADAT2 1 83152 1.20262E-5 41576 0 6.36862E-5
6-143749784-A-G p.Met166Thr missense ADAT2 1 83188 1.2021E-5 41594 0 6.66667E-5
6-143749805-C-T p.Arg159Gln missense ADAT2 1 83186 1.20213E-5 41593 0 3.18532E-5
6-143749806-G-A p.Arg159Trp missense ADAT2 1 83176 1.20227E-5 41588 0 6.25E-4
6-143749818-T-C p.Ile155Val missense ADAT2 21 83150 2.52556E-4 41575 0 2.86551E-4
6-143749821-A-G p.Cys154Arg missense+splice_region ADAT2 3 83144 3.6082E-5 41572 0 NA
6-143749829-A-G c.460-8T>C splice_region ADAT2 1 83098 1.2034E-5 41549 0 NA
6-143753634-T-C c.459+8A>G splice_region ADAT2 1 83200 1.20192E-5 41600 0 NA
6-143753641-C-T c.459+1G>A splice_donor ADAT2 1 83230 1.20149E-5 41615 0 4.00821E-6
6-143753656-C-CAGTGTT p.Thr148_Gly149insAsnThr conservative_inframe_insertion ADAT2 1 83294 1.20057E-5 41647 0 NA
6-143753657-A-C p.Thr148Thr synonymous ADAT2 2 83300 2.40096E-5 41650 0 8.28308E-6
6-143753658-G-A p.Thr148Ile missense ADAT2 1 83300 1.20048E-5 41650 0 NA
6-143753662-T-C p.Asn147Asp missense ADAT2 1 83314 1.20028E-5 41657 0 NA
6-143753667-A-G p.Leu145Pro missense ADAT2 2 83316 2.4005E-5 41658 0 NA
6-143753669-G-A p.Asp144Asp synonymous ADAT2 1 83318 1.20022E-5 41659 0 NA
6-143753673-G-A p.Ala143Val missense ADAT2 1 83334 1.19999E-5 41667 0 NA
6-143753675-A-G p.Ser142Ser synonymous ADAT2 1 83340 1.1999E-5 41670 0 3.1837E-5
6-143753694-G-A p.Ser136Phe missense ADAT2 2 83340 2.39981E-5 41670 0 7.45317E-5
6-143753710-A-G p.Phe131Leu missense ADAT2 2 83330 2.4001E-5 41665 0 8.28144E-6
6-143753713-G-T p.Arg130Arg synonymous ADAT2 1 83308 1.20036E-5 41654 0 8.0141E-6
6-143753715-T-A p.Glu129Val missense ADAT2 1 83318 1.20022E-5 41659 0 NA
6-143753724-C-G p.Cys126Ser missense ADAT2 1 83312 1.20031E-5 41656 0 8.2824E-6
6-143753741-C-T p.Pro120Pro synonymous ADAT2 5 83242 6.00658E-5 41621 0 6.25E-4
6-143753748-T-TTCATCAGGCGGAGAGCAGCTGCACAC c.353-1_353insGTGTGCAGCTGCTCTCCGCCTGATGA splice_acceptor ADAT2 2 83196 2.40396E-5 41598 0 NA
6-143753750-T-C c.353-2A>G splice_acceptor ADAT2 3 83180 3.60664E-5 41590 0 3.18492E-5
6-143754964-A-G c.352+4T>C splice_region ADAT2 1 83128 1.20296E-5 41564 0 1.67311E-5
6-143754977-G-A p.Arg115Cys missense ADAT2 4 83228 4.80607E-5 41614 0 1.24665E-4
6-143754985-G-A p.Ala112Val missense ADAT2 113 83252 0.00135732 41626 0 0.00119197
6-143754986-C-G p.Ala112Pro missense ADAT2 1 83270 1.20091E-5 41635 0 NA
6-143754987-T-C p.Ala111Ala synonymous ADAT2 4 83278 4.80319E-5 41639 0 2.73682E-4
6-143754991-C-T p.Cys110Tyr missense ADAT2 2 83296 2.40108E-5 41648 0 8.02317E-6
6-143755002-C-T p.Pro106Pro synonymous ADAT2 3 83302 3.60135E-5 41651 0 NA
6-143755007-C-T p.Glu105Lys missense ADAT2 2 83308 2.40073E-5 41654 0 NA
6-143755010-C-G p.Val104Leu missense ADAT2 2 83314 2.40056E-5 41657 0 NA
6-143755017-A-G p.Tyr101Tyr synonymous ADAT2 5 83322 6.00082E-5 41661 0 NA
6-143755021-AAC-A p.Leu100fs frameshift ADAT2 1 83330 1.20005E-5 41665 0 8.28171E-6
6-143755049-G-A p.Pro91Ser missense ADAT2 1 83338 1.19993E-5 41669 0 NA
6-143755056-G-A p.Gly88Gly synonymous ADAT2 1 83342 1.19988E-5 41671 0 8.28061E-6
6-143755067-G-A p.Arg85Cys missense ADAT2 3 83346 3.59945E-5 41673 0 4.00769E-6
6-143755076-C-T p.Asp82Asn missense ADAT2 6 83350 7.19856E-5 41675 0 9.93822E-5
6-143755085-G-C p.Gln79Glu missense ADAT2 3 83348 3.59937E-5 41674 0 1.91058E-4
6-143755086-A-G p.Asp78Asp synonymous ADAT2 161 83340 0.00193185 41670 0 0.009375
6-143755088-C-T p.Asp78Asn missense ADAT2 6 83346 7.19891E-5 41673 0 1.20246E-4
6-143755089-G-A p.Ile77Ile synonymous ADAT2 1 83350 1.19976E-5 41675 0 1.65651E-5
6-143755090-AT-A p.Ile77fs frameshift ADAT2 4 83352 4.79893E-5 41676 0 9.55536E-5
6-143755090-A-T p.Ile77Asn missense ADAT2 1 83352 1.19973E-5 41676 0 NA
6-143755092-G-A p.Ala76Ala synonymous ADAT2 1 83350 1.19976E-5 41675 0 8.28308E-6
6-143755098-C-G p.Met74Ile missense ADAT2 1 83324 1.20013E-5 41662 0 5.79873E-5
6-143755108-T-A p.His71Leu missense ADAT2 1 83338 1.19993E-5 41669 0 NA
6-143755112-G-C p.Arg70Gly missense ADAT2 1 83332 1.20002E-5 41666 0 NA
6-143755118-C-CATTTTTGGTTTGGTTAA c.202-1_202insTTAACCAAACCAAAAAT splice_acceptor ADAT2 2 83326 2.40021E-5 41663 0 NA
6-143755118-C-CATTTTTGGTTTGGTTAACTTCATTTCTCCCCTT c.202-1_202insAAGGGGAGAAATGAAGTTAACCAAACCAAAAAT splice_acceptor ADAT2 2 83326 2.40021E-5 41663 1 NA
6-143755122-A-T c.202-4T>A splice_region ADAT2 1 83302 1.20045E-5 41651 0 3.31614E-5
6-143759719-T-A c.201+8A>T splice_region ADAT2 5 82776 6.0404E-5 41388 1 8.31891E-6
6-143759724-T-C c.201+3A>G splice_region ADAT2 1 82834 1.20723E-5 41417 0 8.30551E-6
6-143759728-T-A p.Asn67Ile missense+splice_region ADAT2 1 82862 1.20683E-5 41431 0 NA
6-143759737-T-G p.Gln64Pro missense ADAT2 1 82960 1.2054E-5 41480 0 NA
6-143759745-T-C p.Glu61Glu synonymous ADAT2 1 83008 1.2047E-5 41504 0 NA
6-143759754-C-A p.Gly58Gly synonymous ADAT2 1 83030 1.20438E-5 41515 0 NA
6-143759757-C-T p.Lys57Lys synonymous ADAT2 1 83050 1.20409E-5 41525 0 4.81186E-5
6-143759763-T-C p.Val55Val synonymous ADAT2 1 83064 1.20389E-5 41532 0 6.3678E-5
6-143759768-C-T p.Val54Ile missense ADAT2 1 83080 1.20366E-5 41540 0 NA
6-143759773-T-C p.Asn52Ser missense ADAT2 9 83084 1.08324E-4 41542 0 1.56388E-4
6-143759785-A-G p.Met1? start_lost ADAT2 1 83068 1.20383E-5 41534 0 8.28418E-6
6-143759786-T-C p.Met1? start_lost ADAT2 1 83070 1.2038E-5 41535 0 3.18451E-5
6-143759790-A-T p.Cys46* stop_gained ADAT2 2 83068 2.40767E-5 41534 0 3.18451E-5
6-143759791-C-T p.Cys46Tyr missense ADAT2 1 83072 1.20378E-5 41536 0 8.28418E-6
6-143759798-C-T p.Val44Ile missense ADAT2 4 83050 4.81638E-5 41525 0 2.00533E-5
6-143759798-C-G p.Val44Leu missense ADAT2 2 83050 2.40819E-5 41525 0 1.2032E-5
6-143759809-G-A p.Thr40Ile missense ADAT2 1 82988 1.20499E-5 41494 0 NA
6-143759820-G-T p.Ala36Ala synonymous ADAT2 1 82904 1.20621E-5 41452 0 NA
6-143759831-C-CAGTT c.97-1_97insAACT splice_acceptor ADAT2 2 82776 2.41616E-5 41388 0 NA
6-143759831-C-CAGTTCTCCAGACTGTACAAGAAGTATGGTATCAGCATCTGCTT c.97-1_97insAAGCAGATGCTGATACCATACTTCTTGTACAGTCTGGAGAACT splice_acceptor ADAT2 1 82776 1.20808E-5 41388 0 NA
6-143759832-C-G c.97-1G>C splice_acceptor ADAT2 1 82772 1.20814E-5 41386 0 NA
6-143759832-C-CATGTGCATCGCCTCCTCCA c.97-2_97-1insTGGAGGAGGCGATGCACAT splice_acceptor ADAT2 1 82772 1.20814E-5 41386 0 NA
6-143766106-C-T n.112G>A splice_region ADAT2 2 75536 2.64774E-5 37768 0 5.96374E-5
6-143771692-C-G c.96+8G>C splice_region ADAT2 1 82128 1.21761E-5 41064 0 8.29518E-6
6-143771704-T-G p.His31Pro missense ADAT2 4 82338 4.85802E-5 41169 0 3.18552E-5
6-143771706-C-T p.Met30Ile missense ADAT2 2 82356 2.42848E-5 41178 0 4.01168E-6
6-143771708-T-C p.Met30Val missense ADAT2 3 82348 3.64308E-5 41174 0 2.48789E-5
6-143771724-C-G p.Lys24Asn missense ADAT2 8 82534 9.69297E-5 41267 0 9.12167E-5
6-143771735-C-G p.Glu21Gln missense ADAT2 1 82544 1.21148E-5 41272 0 NA
6-143771736-C-G p.Glu20Asp missense ADAT2 1 82544 1.21148E-5 41272 0 NA
6-143771749-G-A p.Ser16Leu missense ADAT2 3 82420 3.63989E-5 41210 0 2.80719E-5
6-143771763-T-C p.Ala11Ala synonymous ADAT2 1 82300 1.21507E-5 41150 0 1.99355E-4
6-143771766-A-C p.Ala10Ala synonymous ADAT2 2 82240 2.43191E-5 41120 0 NA
6-143771770-G-C p.Pro9Arg missense ADAT2 1 82150 1.21729E-5 41075 0 3.18471E-5
6-143771776-G-A p.Pro7Leu missense ADAT2 1 81930 1.22055E-5 40965 0 6.25E-4
6-143771779-G-A p.Ala6Val missense ADAT2 1 81802 1.22246E-5 40901 0 NA
6-143771782-G-A p.Ala5Val missense ADAT2 4 81710 4.89536E-5 40855 0 6.37146E-5
6-143771795-T-C p.Met1? start_lost ADAT2 1 81264 1.23056E-5 40632 0 5.03525E-4