Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
7-937583-C-T n.2235G>A splice_region ADAP1 1 2608 3.83436E-4 1304 0 NA
7-937584-G-A n.2234C>T splice_region ADAP1 40 2636 0.0151745 1318 1 0.0236484
7-938555-T-C c.*3A>G splice_region ADAP1 109 81952 0.00133005 40976 0 0.00357325
7-938556-C-T c.*2G>A splice_region ADAP1 26 81968 3.17197E-4 40984 0 3.33533E-4
7-938570-C-T p.Lys371Lys synonymous ADAP1 1 82224 1.21619E-5 41112 0 4.16861E-6
7-938579-C-T p.Ala368Ala synonymous ADAP1 2 82224 2.43238E-5 41112 0 6.29691E-5
7-938582-C-T p.Glu367Glu synonymous ADAP1 1 82262 1.21563E-5 41131 0 3.62293E-5
7-938586-ACTGCAACGGAACAGGGTCCAGCGTTGTCACAGCGGCGGGGAGCTGGGAGCCCTTCCAGGCCGCCGGCCGCCCGCCCCCCTCAC-A c.1096+1_1097-1delGTGAGGGGGGCGGGCGGCCGGCGGCCTGGAAGGGCTCCCAGCTCCCCGCCGCTGTGACAACGCTGGACCCTGTTCCGTTGCAG splice_acceptor ADAP1 13 82270 1.58016E-4 41135 5 NA
7-938589-G-A c.1097-3C>T splice_region ADAP1 3 82248 3.64751E-5 41124 0 4.1087E-6
7-938593-C-T c.1097-7G>A splice_region ADAP1 18 82274 2.18781E-4 41137 0 1.68082E-4
7-938593-C-G c.1097-7G>C splice_region ADAP1 1 82274 1.21545E-5 41137 0 1.12055E-5
7-938594-G-A c.1097-8C>T splice_region ADAP1 11 82282 1.33687E-4 41141 0 2.23214E-4
7-938664-C-A c.1096+6G>T splice_region ADAP1 142 81152 0.0017498 40576 1 0.00199852
7-938664-C-T c.1096+6G>A splice_region ADAP1 1 81156 1.23219E-5 40578 0 9.00236E-6
7-938674-G-A p.Tyr364Tyr synonymous ADAP1 11 81158 1.35538E-4 40579 0 1.27649E-4
7-938680-C-T p.Gln362Gln synonymous ADAP1 1 81550 1.22624E-5 40775 0 NA
7-938686-C-A p.Leu360Leu synonymous ADAP1 1 81614 1.22528E-5 40807 0 3.494E-5
7-938701-C-T p.Val355Val synonymous ADAP1 1 81960 1.22011E-5 40980 0 8.69051E-6
7-938704-C-T p.Ala354Ala synonymous ADAP1 3 82008 3.65818E-5 41004 0 9.56145E-5
7-938705-G-A p.Ala354Val missense ADAP1 1 81988 1.21969E-5 40994 0 3.18939E-5
7-938711-T-C p.Gln352Arg missense ADAP1 2 82124 2.43534E-5 41062 0 8.69112E-6
7-938716-G-T p.Ala350Ala synonymous ADAP1 3 82074 3.65524E-5 41037 0 1.91351E-4
7-938716-G-A p.Ala350Ala synonymous ADAP1 1 82074 1.21841E-5 41037 0 3.18918E-5
7-938719-C-T p.Ala349Ala synonymous ADAP1 17 82062 2.0716E-4 41031 0 0.00125
7-938734-C-G p.Gln344His missense ADAP1 2 82184 2.43356E-5 41092 0 3.18837E-5
7-938737-G-A p.Asp343Asp synonymous ADAP1 1 82124 1.21767E-5 41062 0 NA
7-938740-G-A p.Ser342Ser synonymous ADAP1 7 82104 8.52577E-5 41052 0 9.56633E-5
7-938740-G-C p.Ser342Ser synonymous ADAP1 1 82104 1.21797E-5 41052 0 NA
7-938741-G-A p.Ser342Phe missense ADAP1 1 82094 1.21812E-5 41047 0 NA
7-938743-C-G p.Glu341Asp missense ADAP1 1 82094 1.21812E-5 41047 0 NA
7-938744-T-G p.Glu341Ala missense ADAP1 1 82082 1.21829E-5 41041 0 8.61104E-6
7-938746-C-T p.Thr340Thr synonymous ADAP1 12 82074 1.4621E-4 41037 0 2.2433E-4
7-938747-G-A p.Thr340Met missense ADAP1 1 82036 1.21898E-5 41018 0 2.03897E-5
7-938752-G-A p.Cys338Cys synonymous ADAP1 1 81940 1.22041E-5 40970 0 1.27535E-4
7-938761-CAG-C p.Leu335fs frameshift ADAP1 3 81952 3.66068E-5 40976 0 3.18735E-5
7-938776-G-A p.Pro330Pro synonymous ADAP1 2 81630 2.45008E-5 40815 0 6.3743E-5
7-938779-C-T p.Thr329Thr synonymous ADAP1 8 81540 9.81114E-5 40770 0 1.71078E-4
7-938782-G-A p.Val328Val synonymous ADAP1 1 81568 1.22597E-5 40784 0 NA
7-938785-G-A p.Ile327Ile synonymous ADAP1 3 81544 3.679E-5 40772 0 6.37227E-5
7-938788-G-A p.Thr326Thr synonymous ADAP1 1 81544 1.22633E-5 40772 0 9.55597E-5
7-938793-T-C p.Ile325Val missense ADAP1 1 81494 1.22708E-5 40747 0 NA
7-938794-G-A p.Gly324Gly synonymous ADAP1 2 81466 2.45501E-5 40733 0 5.03525E-4
7-938809-G-T p.His319Gln missense ADAP1 1 81388 1.22868E-5 40694 0 NA
7-938814-C-T p.Gly318Ser missense ADAP1 1 81302 1.22998E-5 40651 0 NA
7-938824-C-T p.Pro314Pro synonymous ADAP1 5 81194 6.15809E-5 40597 0 1.03024E-4
7-938825-G-A p.Pro314Leu missense ADAP1 2 81204 2.46293E-5 40602 0 NA
7-938827-C-T p.Pro313Pro synonymous ADAP1 19 81138 2.34169E-4 40569 0 4.4682E-4
7-938839-C-T p.Leu309Leu synonymous ADAP1 1 81134 1.23253E-5 40567 0 3.18674E-5
7-938841-G-A p.Leu309Leu synonymous ADAP1 1 81102 1.23302E-5 40551 0 4.06286E-6
7-938845-C-T p.Thr307Thr synonymous ADAP1 1028 81088 0.0126776 40544 41 0.0264618
7-938845-C-G p.Thr307Thr synonymous ADAP1 1 81108 1.23292E-5 40554 0 NA
7-938846-G-A p.Thr307Met missense ADAP1 2 81122 2.46542E-5 40561 0 9.56328E-5
7-938851-G-A p.Gly305Gly synonymous ADAP1 1 81316 1.22977E-5 40658 0 1.70885E-5
7-938881-C-T p.Gly295Gly synonymous ADAP1 1 81206 1.23144E-5 40603 0 4.03949E-6
7-938887-G-A p.Ala293Ala synonymous ADAP1 2 80950 2.47066E-5 40475 0 3.18817E-5
7-938888-G-A p.Ala293Val missense ADAP1 1 80936 1.23554E-5 40468 0 4.04469E-6
7-938889-C-T p.Ala293Thr missense ADAP1 1 80888 1.23628E-5 40444 0 NA
7-938890-G-A p.Phe292Phe synonymous ADAP1 3 80938 3.70654E-5 40469 0 1.65831E-4
7-938893-G-A p.Ala291Ala synonymous ADAP1 1 80930 1.23564E-5 40465 0 NA
7-938896-G-A p.Asp290Asp splice_region+synonymous ADAP1 3 80842 3.71094E-5 40421 0 1.01201E-4
7-938901-G-A c.868-3C>T splice_region ADAP1 25 80844 3.09238E-4 40422 2 1.1955E-4
7-939059-G-A p.Pro288Pro synonymous ADAP1 1 82494 1.21221E-5 41247 0 6.78058E-5
7-939064-C-T p.Asp287Asn missense ADAP1 1 82544 1.21148E-5 41272 0 NA
7-939077-G-C p.Leu282Leu synonymous ADAP1 1 82610 1.21051E-5 41305 0 7.61486E-5
7-939085-G-A p.Arg280Cys missense ADAP1 1 82598 1.21068E-5 41299 0 3.18613E-5
7-939086-G-A p.Asp279Asp synonymous ADAP1 443 82582 0.00536436 41291 7 0.012492
7-939086-G-T p.Asp279Glu missense ADAP1 1 82594 1.21074E-5 41297 0 NA
7-939092-C-T p.Met277Ile missense ADAP1 2 82576 2.42201E-5 41288 0 NA
7-939098-G-A p.Phe275Phe synonymous ADAP1 1 82530 1.21168E-5 41265 0 NA
7-939107-C-T p.Lys272Lys synonymous ADAP1 1 82502 1.21209E-5 41251 0 NA
7-939111-C-T p.Arg271Gln missense ADAP1 1 82428 1.21318E-5 41214 0 4.00824E-6
7-939116-G-C p.Gly269Gly synonymous ADAP1 2 82276 2.43084E-5 41138 0 3.18593E-5
7-939122-C-T p.Thr267Thr synonymous ADAP1 270 82238 0.00328315 41119 1 0.00605449
7-939123-G-C p.Thr267Arg missense ADAP1 2 82214 2.43268E-5 41107 0 3.61795E-5
7-939130-G-A c.796-3C>T splice_region ADAP1 2 82070 2.43694E-5 41035 0 8.05555E-6
7-939132-G-C c.796-5C>G splice_region ADAP1 2 82052 2.43748E-5 41026 0 9.37348E-6
7-939742-G-C p.Pro264Pro synonymous ADAP1 8 82144 9.739E-5 41072 0 6.63878E-5
7-939745-C-T p.Gly263Gly synonymous ADAP1 1 82180 1.21684E-5 41090 0 1.65964E-5
7-939745-C-A p.Gly263Gly synonymous ADAP1 1 82180 1.21684E-5 41090 0 NA
7-939748-C-A p.Thr262Thr synonymous ADAP1 5 82240 6.07977E-5 41120 0 6.37186E-5
7-939748-C-T p.Thr262Thr synonymous ADAP1 1 82240 1.21595E-5 41120 0 3.18593E-5
7-939772-C-T p.Leu254Leu synonymous ADAP1 1 82334 1.21457E-5 41167 0 3.9873E-6
7-939784-G-A p.Ser250Ser synonymous ADAP1 1 82276 1.21542E-5 41138 0 1.59565E-5
7-939785-G-A p.Ser250Phe missense ADAP1 2 82254 2.43149E-5 41127 0 1.59556E-5
7-939787-G-A p.Leu249Leu synonymous ADAP1 6 82266 7.29341E-5 41133 0 3.18613E-5
7-939798-C-G p.Val246Leu missense ADAP1 1 82126 1.21764E-5 41063 0 8.31504E-6
7-939806-G-A c.733-5C>T splice_region ADAP1 169 82062 0.00205942 41031 0 0.00379247
7-940175-C-T p.Ala243Thr missense ADAP1 2 74924 2.66937E-5 37462 0 1.2576E-5
7-940176-G-A p.Asp242Asp synonymous ADAP1 7 74938 9.34106E-5 37469 0 1.91184E-4
7-940178-C-T p.Asp242Asn missense ADAP1 8 75460 1.06016E-4 37730 0 1.05941E-4
7-940179-G-A p.Gly241Gly synonymous ADAP1 5 75444 6.62743E-5 37722 0 1.03877E-4
7-940181-C-T p.Gly241Ser missense ADAP1 63991 74076 0.863856 37038 27789 0.901515
7-940182-G-A p.Ala240Ala synonymous ADAP1 7 76238 9.18177E-5 38119 0 1.53291E-4
7-940182-G-C p.Ala240Ala synonymous ADAP1 3 76238 3.93505E-5 38119 0 NA
7-940197-C-T p.Val235Val synonymous ADAP1 1 77656 1.28773E-5 38828 0 8.16613E-6
7-940206-G-A p.Tyr232Tyr synonymous ADAP1 1 77826 1.28492E-5 38913 0 NA
7-940213-A-T p.Phe230Tyr missense ADAP1 1 77928 1.28324E-5 38964 0 4.18897E-6
7-940230-T-C p.Ala224Ala synonymous ADAP1 1 77444 1.29126E-5 38722 0 NA
7-940234-T-C p.Asn223Ser missense ADAP1 1 77306 1.29356E-5 38653 0 4.8522E-6
7-940248-A-T p.Ile218Ile synonymous ADAP1 1 76150 1.3132E-5 38075 0 NA
7-940252-T-G p.Glu217Ala missense+splice_region ADAP1 1 75404 1.32619E-5 37702 0 NA
7-940255-T-G c.649-2A>C splice_acceptor ADAP1 1 74698 1.33872E-5 37349 0 NA
7-940257-G-GGGGCAAAGGC c.649-5_649-4insGCCTTTGCCC splice_region ADAP1 6578 73676 0.0892828 36838 447 0.225141
7-940257-G-GGGGCAAAGGT c.649-14_649-5dupACCTTTGCCC splice_region ADAP1 5 74418 6.7188E-5 37209 0 1.77536E-4
7-940257-G-GGGGCAAAGGCGGGCAAAGGC c.649-5_649-4insGCCTTTGCCCGCCTTTGCCC splice_region ADAP1 23 74406 3.09115E-4 37203 0 0.00183647
7-940257-G-GGTGCAAAGGC c.649-5_649-4insGCCTTTGCAC splice_region ADAP1 1 74418 1.34376E-5 37209 0 NA
7-940257-G-GA c.649-5_649-4insT splice_region ADAP1 1 74418 1.34376E-5 37209 0 NA
7-940257-G-GGGGCAAAGGCAGGCAAAGGC c.649-5_649-4insGCCTTTGCCTGCCTTTGCCC splice_region ADAP1 3 74418 4.03128E-5 37209 0 2.01349E-5
7-940257-G-GGGGCAAAGGGGGGCAAAGGC c.649-5_649-4insGCCTTTGCCCCCCTTTGCCC splice_region ADAP1 3 74418 4.03128E-5 37209 0 NA
7-940258-G-GGGCAAAGGCA c.649-6_649-5insTGCCTTTGCC splice_region ADAP1 41178 72942 0.564531 36471 12293 0.61004
7-940258-G-GGGCAAAGGCGGGCAAAGGCA c.649-6_649-5insTGCCTTTGCCCGCCTTTGCC splice_region ADAP1 12 74382 1.61329E-4 37191 0 3.22991E-4
7-940258-G-GGGCAAAGGCAGGCAAAGGCA c.649-6_649-5insTGCCTTTGCCTGCCTTTGCC splice_region ADAP1 55 74380 7.39446E-4 37190 1 0.00185474
7-940258-G-GGGCAAAGGCAGGCAAAGGCGGGCAAAGGCA c.649-6_649-5insTGCCTTTGCCCGCCTTTGCCTGCCTTTGCC splice_region ADAP1 5 74384 6.72188E-5 37192 1 7.11288E-5
7-940258-G-GGCAAAGGCA c.649-6_649-5insTGCCTTTGC splice_region ADAP1 1 74388 1.3443E-5 37194 0 NA
7-940258-G-GGGCAAAGACA c.649-6_649-5insTGTCTTTGCC splice_region ADAP1 1 74388 1.3443E-5 37194 0 NA
7-940258-G-GGACAAAGGCA c.649-6_649-5insTGCCTTTGTC splice_region ADAP1 2 74388 2.68861E-5 37194 0 3.55644E-5
7-940258-G-GGTCAAAGGCA c.649-6_649-5insTGCCTTTGAC splice_region ADAP1 1 74388 1.3443E-5 37194 0 NA
7-940258-G-GGGAAAGGCA c.649-6_649-5insTGCCTTTCC splice_region ADAP1 1 74388 1.3443E-5 37194 0 NA
7-940568-C-G c.261+5G>C splice_region ADAP1 1 53458 1.87063E-5 26729 0 NA
7-940574-C-G p.Arg87Thr missense+splice_region ADAP1 2 53456 3.74139E-5 26728 0 NA
7-940579-G-C p.Gly85Gly synonymous ADAP1 1 53442 1.87119E-5 26721 0 NA
7-940585-G-A p.His83His synonymous ADAP1 1 53440 1.87126E-5 26720 0 NA
7-940589-T-TGCTGGG p.Pro80_Gln81dup conservative_inframe_insertion ADAP1 2 53414 3.74434E-5 26707 0 NA
7-940589-T-C p.Gln82Arg missense ADAP1 1 53414 1.87217E-5 26707 0 NA
7-940590-G-C p.Gln82Glu missense ADAP1 3 53420 5.61587E-5 26710 0 NA
7-940594-G-A p.Pro80Pro synonymous ADAP1 12 53394 2.24744E-4 26697 0 6.37064E-5
7-940595-G-A p.Pro80Leu missense ADAP1 2 53378 3.74686E-5 26689 0 0.001875
7-940603-C-T p.Trp77* stop_gained ADAP1 3 53306 5.62788E-5 26653 0 6.08125E-5
7-940608-T-C p.Ser76Gly missense ADAP1 2 53304 3.75206E-5 26652 0 NA
7-940609-T-C p.Ala75Ala synonymous ADAP1 3 53286 5.63E-5 26643 0 3.18573E-5
7-940611-C-T p.Ala75Thr missense ADAP1 5 53276 9.38509E-5 26638 0 3.18593E-5
7-940612-C-T p.Lys74Lys synonymous ADAP1 1 53296 1.87631E-5 26648 0 NA
7-940616-CTT-C p.Arg73fs frameshift ADAP1 1 53256 1.87772E-5 26628 0 6.68074E-6
7-940633-T-G p.Lys67Asn missense ADAP1 1 53146 1.88161E-5 26573 0 6.68012E-6
7-940639-G-T p.Phe65Leu missense ADAP1 1 53094 1.88345E-5 26547 0 6.67985E-6
7-940653-T-C p.Lys61Glu missense ADAP1 1 52988 1.88722E-5 26494 0 NA
7-940655-T-C p.Tyr60Cys missense ADAP1 2 52964 3.77615E-5 26482 0 4.67852E-5
7-940663-G-T p.Cys57* stop_gained ADAP1 262 52848 0.00495761 26424 1 0.0061991
7-940663-G-A p.Cys57Cys synonymous ADAP1 1 52868 1.8915E-5 26434 0 NA
7-940663-G-C p.Cys57Trp missense ADAP1 1 52868 1.8915E-5 26434 0 NA
7-940667-G-A p.Thr56Ile missense+splice_region ADAP1 1 52802 1.89387E-5 26401 0 6.6912E-6
7-940673-G-GGGT c.166-8_166-6dupACC splice_region ADAP1 1 52700 1.89753E-5 26350 0 1.82838E-4
7-943559-TGCTGCCCGGCGCCAGTGCCCACACTCCCACACGTCCAAGCACCCGCCTTCCCAC-T n.376_*34delGTGGGAAGGCGGGTGCTTGGACGTGTGGGAGTGTGGGCACTGGCGCCGGGCAGC splice_region ADAP1 1 36776 2.71916E-5 18388 0 NA
7-943590-ACGTCCAAGCACCCGCCTTCCCACGCTGCCCAGCCCGACTTCCCGCCTTCTCATGCCGCCTAGCTCAAGTGCCTACCCTCCCGTAC-A n.314_*3delGTACGGGAGGGTAGGCACTTGAGCTAGGCGGCATGAGAAGGCGGGAAGTCGGGCTGGGCAGCGTGGGAAGGCGGGTGCTTGGACG splice_region ADAP1 1 50570 1.97746E-5 25285 0 9.5761E-5
7-943595-C-T n.394G>A splice_region ADAP1 1 52978 1.88758E-5 26489 0 NA
7-943757-A-C c.648+6T>G splice_region ADAP1 1 82044 1.21886E-5 41022 0 NA
7-943760-C-A c.648+3G>T splice_region ADAP1 3 82114 3.65346E-5 41057 0 6.37227E-5
7-943764-T-C p.Lys216Arg missense+splice_region ADAP1 1 82138 1.21746E-5 41069 0 8.38546E-6
7-943769-G-A p.Asp214Asp synonymous ADAP1 6 82210 7.29838E-5 41105 0 2.23015E-4
7-943771-C-G p.Asp214His missense ADAP1 1 82274 1.21545E-5 41137 0 6.37064E-5
7-943775-A-G p.His212His synonymous ADAP1 1 82284 1.2153E-5 41142 0 3.51476E-4
7-943781-G-A p.Ile210Ile synonymous ADAP1 1 82392 1.21371E-5 41196 0 9.55657E-5
7-943783-T-C p.Ile210Val missense ADAP1 2 82408 2.42695E-5 41204 0 1.20169E-5
7-943790-G-A n.594C>T splice_region ADAP1 3 82464 3.63795E-5 41232 0 1.67199E-5
7-943793-A-AC p.Asn207fs frameshift ADAP1 1 82492 1.21224E-5 41246 0 NA
7-943794-C-T p.Arg206His missense ADAP1 3 82476 3.63742E-5 41238 0 2.5079E-5
7-943795-G-A p.Arg206Cys missense ADAP1 2 82504 2.42412E-5 41252 0 4.17927E-5
7-943814-G-A p.Tyr199Tyr synonymous ADAP1 408 82568 0.00494138 41284 5 0.00828659
7-943817-G-A p.Thr198Thr synonymous ADAP1 8 82594 9.68593E-5 41297 0 1.59307E-4
7-943817-G-C p.Thr198Thr synonymous ADAP1 3 82594 3.63222E-5 41297 0 4.00773E-6
7-943832-G-A p.His193His synonymous ADAP1 23 82626 2.78363E-4 41313 0 6.25E-4
7-943834-G-A p.His193Tyr missense ADAP1 1 82646 1.20998E-5 41323 0 2.51885E-5
7-943835-G-A p.Pro192Pro synonymous ADAP1 3 82640 3.6302E-5 41320 0 1.67915E-5
7-943835-G-C p.Pro192Pro synonymous ADAP1 1 82640 1.21007E-5 41320 0 4.19787E-5
7-943841-G-C p.Gly190Gly synonymous ADAP1 4 82604 4.84238E-5 41302 0 5.90488E-5
7-943841-G-T p.Gly190Gly synonymous ADAP1 1 82604 1.2106E-5 41302 0 1.91192E-4
7-943843-C-T p.Gly190Ser missense ADAP1 6 82594 7.26445E-5 41297 0 9.28035E-5
7-943844-G-A p.Ile189Ile synonymous ADAP1 41 82618 4.9626E-4 41309 0 4.14329E-4
7-943853-C-T p.Pro186Pro synonymous ADAP1 9 82646 1.08898E-4 41323 0 0.00125
7-943854-G-A p.Pro186Leu missense ADAP1 1 82652 1.20989E-5 41326 0 3.18756E-5
7-943862-G-A p.Thr183Thr synonymous ADAP1 2 82626 2.42055E-5 41313 0 2.02174E-5
7-943863-G-T p.Thr183Asn missense ADAP1 1 82616 1.21042E-5 41308 0 4.04642E-6
7-943865-G-T p.Ala182Ala synonymous ADAP1 14 82556 1.69582E-4 41278 0 4.85897E-5
7-943867-C-T p.Ala182Thr missense ADAP1 1 82522 1.2118E-5 41261 0 4.062E-6
7-943868-G-A p.Asn181Asn synonymous ADAP1 5039 82334 0.0612019 41167 199 0.0644512
7-943874-G-A p.His179His synonymous ADAP1 1 82560 1.21124E-5 41280 0 3.18573E-5
7-943879-C-T p.Glu178Lys missense ADAP1 1 82494 1.21221E-5 41247 0 8.65696E-6
7-943880-G-A p.Ile177Ile synonymous ADAP1 13 82508 1.5756E-4 41254 0 6.25E-4
7-943880-G-T p.Ile177Ile synonymous ADAP1 1 82512 1.21194E-5 41256 0 3.18715E-5
7-943886-C-T p.Met162Ile missense+splice_region ADAP1 4 82482 4.84954E-5 41241 0 4.13722E-6
7-943891-C-T p.Val174Met missense ADAP1 11 82360 1.3356E-4 41180 0 5.03525E-4
7-943892-G-A p.Ala173Ala synonymous ADAP1 56 82316 6.80305E-4 41158 1 0.00302115
7-943905-T-G p.Lys169Thr missense ADAP1 3 82032 3.65711E-5 41016 0 8.88273E-6
7-943907-G-C p.Ala168Ala splice_region+synonymous ADAP1 4 81950 4.88102E-5 40975 0 3.18715E-5
7-943917-G-T c.502-8C>A splice_region ADAP1 2 81576 2.4517E-5 40788 0 9.05896E-6
7-943917-G-A c.502-8C>T splice_region ADAP1 1 81576 1.22585E-5 40788 0 4.52948E-6
7-944688-GT-G c.501+8delA splice_region ADAP1 2 82278 2.43078E-5 41139 0 NA
7-944689-T-C c.501+8A>G splice_region ADAP1 565 82292 0.00686579 41146 14 0.0156081
7-944689-TG-CA c.501+7_501+8delCAinsTG splice_region ADAP1 1 82312 1.21489E-5 41156 0 NA
7-944697-A-G p.Asp167Asp splice_region+synonymous ADAP1 2 82550 2.42277E-5 41275 0 8.07109E-6
7-944701-T-C p.Asn166Ser missense ADAP1 1 82638 1.2101E-5 41319 0 NA
7-944709-G-T p.Phe163Leu missense ADAP1 2 82804 2.41534E-5 41402 0 NA
7-944715-C-T p.Lys161Lys synonymous ADAP1 256 82834 0.00309052 41417 3 0.00442675
7-944718-C-G p.Leu160Leu synonymous ADAP1 1 82868 1.20674E-5 41434 0 4.01577E-6
7-944720-G-C p.Leu160Val missense ADAP1 1 82874 1.20665E-5 41437 0 2.50807E-5
7-944722-G-C p.Ala159Gly missense ADAP1 1 82878 1.20659E-5 41439 0 8.35995E-6
7-944726-C-A p.Gly158Cys missense ADAP1 1 82888 1.20645E-5 41444 0 4.01252E-6
7-944729-C-G p.Glu157Gln missense ADAP1 1 82926 1.20589E-5 41463 0 4.0113E-6
7-944731-C-T p.Arg156Gln missense ADAP1 8 82924 9.64739E-5 41462 0 6.36821E-5
7-944732-G-C p.Arg156Gly missense ADAP1 1 82924 1.20592E-5 41462 0 NA
7-944732-G-T p.Arg156Arg synonymous ADAP1 1 82924 1.20592E-5 41462 0 8.35743E-6
7-944751-C-T p.Arg149Arg synonymous ADAP1 2 82968 2.41057E-5 41484 0 5.20892E-5
7-944752-C-T p.Arg149Gln missense ADAP1 6 82964 7.23205E-5 41482 0 1.27405E-4
7-944753-G-A p.Arg149Trp missense ADAP1 1 82954 1.20549E-5 41477 0 NA
7-944757-C-G p.Leu147Phe missense ADAP1 1 82960 1.2054E-5 41480 0 4.00831E-6
7-944766-C-A p.Gly144Gly synonymous ADAP1 1 82954 1.20549E-5 41477 0 6.37024E-5
7-944769-G-A p.Asn143Asn synonymous ADAP1 13 82952 1.56717E-4 41476 0 1.42233E-4
7-944770-T-C p.Asn143Ser missense ADAP1 2 82944 2.41127E-5 41472 0 8.3668E-6
7-944770-T-A p.Asn143Ile missense ADAP1 1 82944 1.20563E-5 41472 0 NA
7-944776-C-T p.Arg141Gln missense ADAP1 2 82928 2.41173E-5 41464 0 3.18674E-5
7-944777-G-A p.Arg141Trp missense ADAP1 1 82920 1.20598E-5 41460 0 8.3717E-6
7-944778-G-C p.Gly140Gly synonymous ADAP1 1 82926 1.20589E-5 41463 0 6.25E-4
7-944782-C-A p.Arg139Leu missense ADAP1 2 82934 2.41156E-5 41467 0 1.60472E-5
7-944783-G-A p.Arg139Cys missense ADAP1 1 82924 1.20592E-5 41462 0 3.18695E-5
7-944790-G-C p.Leu136Leu synonymous ADAP1 2 82886 2.41295E-5 41443 0 8.38378E-6
7-944792-G-A p.Leu136Phe missense ADAP1 1 82890 1.20642E-5 41445 0 NA
7-944797-C-T p.Gly134Asp missense ADAP1 1 82852 1.20697E-5 41426 0 NA
7-944799-C-G p.Glu133Asp missense ADAP1 1 82832 1.20726E-5 41416 0 3.18695E-5
7-944803-C-T p.Arg132His missense ADAP1 5 82776 6.0404E-5 41388 0 1.09359E-4
7-944804-G-A p.Arg132Cys missense ADAP1 2 82736 2.41733E-5 41368 0 6.3743E-5
7-944805-G-T p.Tyr131* stop_gained ADAP1 1 82704 1.20913E-5 41352 0 NA
7-944806-T-C p.Tyr131Cys missense ADAP1 2 82616 2.42084E-5 41308 0 6.38407E-5
7-944806-T-G p.Tyr131Ser missense ADAP1 2 82616 2.42084E-5 41308 0 1.27681E-4
7-944808-C-T p.Gly130Gly splice_region+synonymous ADAP1 2 82650 2.41984E-5 41325 0 2.52721E-5
7-944812-G-A c.389-3C>T splice_region ADAP1 1 82526 1.21174E-5 41263 0 4.2192E-5
7-944813-TG-T c.389-5delC splice_region ADAP1 2 82388 2.42754E-5 41194 0 9.74722E-5
7-944814-G-GGGGGAAAGGGGACACGAGTC c.389-25_389-6dupGACTCGTGTCCCCTTTCCCC splice_region ADAP1 2 82558 2.42254E-5 41279 0 8.45094E-6
7-944815-G-C c.389-6C>G splice_region ADAP1 1 82554 1.21133E-5 41277 0 7.67509E-5
7-944816-G-A c.389-7C>T splice_region ADAP1 3 82532 3.63495E-5 41266 0 4.22754E-5
7-944817-G-C c.389-8C>G splice_region ADAP1 337 82494 0.00408515 41247 1 0.0151119
7-944817-G-A c.389-8C>T splice_region ADAP1 2 82510 2.42395E-5 41255 0 2.5373E-5
7-959598-G-A c.388+7C>T splice_region ADAP1 44 80952 5.43532E-4 40476 0 0.00132677
7-959609-C-G p.Ser128Ser synonymous ADAP1 2 81334 2.459E-5 40667 0 9.8495E-6
7-959609-C-T p.Ser128Ser synonymous ADAP1 2 81334 2.459E-5 40667 0 4.92475E-5
7-959610-G-A p.Ser128Leu missense ADAP1 1 81346 1.22932E-5 40673 0 2.92609E-5
7-959610-G-C p.Ser128Trp missense ADAP1 1 81346 1.22932E-5 40673 0 NA
7-959617-G-A p.Pro126Ser missense ADAP1 6 81522 7.35998E-5 40761 0 1.23325E-5
7-959618-C-T p.Glu125Glu synonymous ADAP1 1 81524 1.22663E-5 40762 0 NA
7-959623-G-C p.Gln124Glu missense ADAP1 31 81646 3.79688E-4 40823 0 3.03555E-4
7-959627-C-T p.Glu122Glu synonymous ADAP1 1 81690 1.22414E-5 40845 0 NA
7-959630-C-T p.Pro121Pro synonymous ADAP1 6 81686 7.3452E-5 40843 0 6.42137E-5
7-959631-G-A p.Pro121Leu missense ADAP1 9 81660 1.10213E-4 40830 0 5.04032E-4
7-959633-G-A p.Tyr120Tyr synonymous ADAP1 1 81724 1.22363E-5 40862 0 9.05158E-6
7-959636-G-A p.Ile119Ile synonymous ADAP1 1 81748 1.22327E-5 40874 0 NA
7-959646-T-C p.Gln116Arg missense ADAP1 1 81832 1.22202E-5 40916 0 1.22299E-5
7-959651-C-T p.Glu114Glu synonymous ADAP1 1 81830 1.22205E-5 40915 0 NA
7-959654-G-A p.Tyr113Tyr synonymous ADAP1 3 81792 3.66784E-5 40896 0 3.56113E-5
7-959657-C-T p.Lys112Lys synonymous ADAP1 2 81844 2.44367E-5 40922 0 2.03815E-5
7-959664-C-T p.Arg110Gln missense ADAP1 1 81808 1.22237E-5 40904 0 6.2432E-5
7-959665-G-A p.Arg110Trp missense ADAP1 31 81796 3.78992E-4 40898 0 5.45186E-4
7-959666-GATCCACT-G p.Gln107fs frameshift ADAP1 1 81778 1.22282E-5 40889 0 NA
7-959666-G-C p.Ile109Met missense ADAP1 1 81778 1.22282E-5 40889 0 NA
7-959674-G-GCTTTA p.Gln107fs frameshift ADAP1 1 81672 1.22441E-5 40836 0 NA
7-959680-G-A p.Arg105* stop_gained ADAP1 1 81474 1.22739E-5 40737 0 NA
7-959684-G-T p.Leu103Leu synonymous ADAP1 1 81438 1.22793E-5 40719 0 4.11913E-6
7-959692-G-A c.306-5C>T splice_region ADAP1 4133 81134 0.0509404 40567 197 0.074852
7-959692-G-C c.306-5C>G splice_region ADAP1 5 81316 6.14885E-5 40658 0 6.43335E-5
7-959694-G-C c.306-7C>G splice_region ADAP1 2 81296 2.46015E-5 40648 0 4.14786E-6
7-960414-G-C c.104+7C>G splice_region ADAP1 1 77160 1.29601E-5 38580 0 NA
7-960420-C-G c.104+1G>C splice_donor ADAP1 2 77184 2.59121E-5 38592 0 1.276E-4
7-960420-C-T c.104+1G>A splice_donor ADAP1 1 77184 1.29561E-5 38592 0 6.72106E-6
7-960422-C-T p.Glu35Lys missense+splice_region ADAP1 1 77184 1.29561E-5 38592 0 6.38121E-5
7-960426-T-G p.Ser33Ser synonymous ADAP1 1 77200 1.29534E-5 38600 0 1.34958E-5
7-960431-C-A p.Ala32Ser missense ADAP1 3 77296 3.88118E-5 38648 0 3.18898E-5
7-960434-A-T p.Leu31Met missense ADAP1 1 77290 1.29383E-5 38645 0 NA
7-960434-A-G p.Leu31Leu synonymous ADAP1 1 77290 1.29383E-5 38645 0 NA
7-960440-T-C p.Met29Val missense ADAP1 3 77294 3.88128E-5 38647 0 6.70673E-6
7-960445-G-C p.Ser27Cys missense ADAP1 2 77284 2.58786E-5 38642 0 6.27038E-5
7-960450-C-T p.Val25Val synonymous ADAP1 1363 77264 0.0176408 38632 14 0.030094
7-960452-C-T p.Val25Met missense ADAP1 5 77246 6.47283E-5 38623 0 3.35647E-5
7-960452-C-A p.Val25Leu missense ADAP1 2 77246 2.58913E-5 38623 0 NA
7-960453-G-A p.Val24Val synonymous ADAP1 3 77232 3.8844E-5 38616 0 6.25E-4
7-960454-A-T p.Val24Asp missense ADAP1 4 77214 5.18041E-5 38607 0 6.25E-4
7-960456-CCA-C p.Trp23fs frameshift ADAP1 1 77238 1.2947E-5 38619 0 1.34207E-5
7-960466-G-A p.Ala20Val missense ADAP1 2 77214 2.5902E-5 38607 0 NA
7-960466-G-T p.Ala20Asp missense ADAP1 7 77214 9.06571E-5 38607 0 1.27453E-4
7-960470-G-A p.Arg19Trp missense ADAP1 2 77182 2.59128E-5 38591 0 3.35949E-5
7-960474-C-T p.Pro17Pro synonymous ADAP1 3 77146 3.88873E-5 38573 0 1.00789E-4
7-960475-G-T p.Pro17Gln missense ADAP1 2 77130 2.59302E-5 38565 0 NA
7-960476-GCCCAGGTGCACAGGCAGCCGC-G p.Ala10_Gly16del conservative_inframe_deletion ADAP1 3 77132 3.88944E-5 38566 0 NA
7-960480-A-G p.Pro15Pro synonymous ADAP1 1 77122 1.29665E-5 38561 0 6.72179E-6
7-960481-G-A p.Pro15Leu missense ADAP1 2 77112 2.59363E-5 38556 0 1.34401E-5
7-960486-A-C p.Cys13Trp missense ADAP1 2 77088 2.59444E-5 38544 0 2.01819E-4
7-960487-C-T p.Cys13Tyr missense ADAP1 2 77092 2.5943E-5 38546 0 3.18735E-5
7-960495-C-T p.Ala10Ala synonymous ADAP1 3 77050 3.89358E-5 38525 0 1.31199E-4
7-960496-G-A p.Ala10Val missense ADAP1 2 77012 2.597E-5 38506 0 3.37254E-5
7-960499-C-T p.Gly9Glu missense ADAP1 2 77066 2.59518E-5 38533 0 NA
7-960512-C-G p.Val5Leu missense ADAP1 1 77006 1.2986E-5 38503 0 1.35245E-5
7-960512-C-A p.Val5Leu missense ADAP1 3 77006 3.8958E-5 38503 0 NA
7-960517-AG-A p.Leu3fs frameshift ADAP1 1 76972 1.29917E-5 38486 0 NA
7-966181-G-A c.305+8C>T splice_region ADAP1 1 80852 1.23683E-5 40426 0 7.26755E-6
7-966196-C-T p.Asp100Asn missense ADAP1 1 80992 1.23469E-5 40496 0 NA
7-966204-G-A p.Thr97Met missense ADAP1 2 81026 2.46834E-5 40513 0 3.18756E-5
7-966207-G-A p.Pro96Leu missense ADAP1 1 81038 1.23399E-5 40519 0 NA
7-966210-C-T p.Arg95Gln missense ADAP1 12 81068 1.48024E-4 40534 0 1.44676E-4
7-966216-T-C p.Tyr93Cys missense ADAP1 1 81090 1.2332E-5 40545 0 NA
7-966224-G-A p.Pro90Pro synonymous ADAP1 10 81164 1.23207E-4 40582 0 4.05976E-5
7-966251-C-T p.Ala81Ala synonymous ADAP1 4 81176 4.92756E-5 40588 0 2.46621E-4
7-966252-G-A p.Ala81Val missense ADAP1 5 81150 6.16143E-5 40575 0 9.86875E-5
7-966252-G-T p.Ala81Glu missense ADAP1 1 81150 1.23229E-5 40575 0 3.1904E-5
7-966253-C-T p.Ala81Thr missense ADAP1 2 81150 2.46457E-5 40575 0 6.37959E-5
7-966254-G-A p.Ala80Ala synonymous ADAP1 3 81156 3.69658E-5 40578 0 4.94071E-5
7-966255-G-T p.Ala80Asp missense ADAP1 1 81152 1.23226E-5 40576 0 9.56694E-5
7-966257-G-A p.Asp79Asp synonymous ADAP1 1 81146 1.23235E-5 40573 0 1.99461E-4
7-966260-G-A p.Asn78Asn synonymous ADAP1 351 81136 0.00432607 40568 4 0.010846
7-966266-G-A p.His76His synonymous ADAP1 13 81116 1.60264E-4 40558 0 9.57121E-5
7-966685-A-G c.159+7T>C splice_region ADAP1 1 76466 1.30777E-5 38233 0 NA
7-966687-C-A c.159+5G>T splice_region ADAP1 4 76476 5.2304E-5 38238 1 8.96411E-6
7-966689-C-T c.159+3G>A splice_region ADAP1 2 76474 2.61527E-5 38237 0 3.18532E-5
7-966705-C-T p.Gly49Asp missense ADAP1 2 76530 2.61335E-5 38265 0 1.91131E-4
7-966713-C-T p.Ala46Ala synonymous ADAP1 6 76552 7.83781E-5 38276 0 3.60324E-5
7-966720-C-T p.Cys44Tyr missense ADAP1 1 76580 1.30582E-5 38290 0 6.36862E-5
7-966722-C-T c.-34G>A 5_prime_UTR_premature_start_codon_gain ADAP1 9 76576 1.1753E-4 38288 1 3.50297E-5
7-966723-G-A p.Pro43Leu missense ADAP1 3 76586 3.91716E-5 38293 0 3.18512E-5
7-966727-G-C p.Pro42Ala missense ADAP1 1 76598 1.30552E-5 38299 0 6.25E-4
7-966727-G-A p.Pro42Ser missense ADAP1 1 76598 1.30552E-5 38299 0 NA
7-966736-T-C p.Ile39Val missense ADAP1 2 76634 2.60981E-5 38317 0 NA
7-966740-C-G p.Gln37His missense ADAP1 2 76636 2.60974E-5 38318 0 6.25E-4
7-966745-G-A p.His36Tyr missense ADAP1 2 76634 2.60981E-5 38317 0 2.04488E-5
7-966746-A-T p.Ala35Ala synonymous ADAP1 1 76628 1.30501E-5 38314 0 6.37105E-5
7-966748-C-T p.Ala35Thr missense ADAP1 1 76612 1.30528E-5 38306 0 6.37227E-5
7-966748-C-A p.Ala35Ser missense ADAP1 3 76612 3.91584E-5 38306 0 NA
7-966749-G-T p.Leu34Leu synonymous ADAP1 174 76616 0.00227107 38308 0 0.00375
7-966753-G-GA p.Ser33fs frameshift ADAP1 1 76634 1.3049E-5 38317 0 7.05916E-5
7-966764-G-A p.Ala29Ala synonymous ADAP1 1 76622 1.30511E-5 38311 0 NA
7-966766-C-T p.Ala29Thr missense ADAP1 1 76604 1.30541E-5 38302 0 3.18654E-5
7-966769-G-C p.Leu28Val missense ADAP1 1 76568 1.30603E-5 38284 0 9.56206E-5
7-966786-G-C p.Pro22Arg missense ADAP1 1 76570 1.30599E-5 38285 0 6.8526E-6
7-966790-TCTGCAGGGACACA-T p.Ser16fs frameshift ADAP1 1 76552 1.3063E-5 38276 0 NA
7-966795-A-AG p.Leu19fs frameshift ADAP1 1 76588 1.30569E-5 38294 0 3.18674E-5
7-966797-G-T p.Ser18Ser synonymous ADAP1 1 76590 1.30565E-5 38295 0 NA
7-966817-G-A c.-129C>T 5_prime_UTR_premature_start_codon_gain ADAP1 2 76622 2.61022E-5 38311 0 NA
7-966820-C-T p.Val11Ile missense ADAP1 2 76642 2.60954E-5 38321 0 8.12216E-5
7-966823-G-A p.His10Tyr missense ADAP1 1 76642 1.30477E-5 38321 0 NA
7-966828-C-T p.Arg8His missense ADAP1 118 76626 0.00153995 38313 0 0.00191302
7-966829-G-A p.Arg8Cys missense ADAP1 9 76644 1.17426E-4 38322 0 9.56267E-5
7-967117-C-T p.Ser11Asn missense ADAP1 1 60650 1.6488E-5 30325 0 9.5584E-5
7-967130-C-A p.Val7Leu missense ADAP1 5 59262 8.43711E-5 29631 0 0.001875
7-967131-TC-T p.Arg6fs frameshift ADAP1 1 58974 1.69566E-5 29487 0 6.71673E-6
7-967132-C-T p.Arg6Gln missense ADAP1 107 58822 0.00181905 29411 0 0.00382287
7-967142-C-G p.Gly3Arg missense ADAP1 2 57684 3.46717E-5 28842 0 NA
7-967143-G-T p.Cys2* stop_gained ADAP1 1 57516 1.73865E-5 28758 0 NA
7-967144-C-A p.Cys2Phe missense ADAP1 2 57456 3.48092E-5 28728 0 6.73174E-6
7-967147-C-T p.Gly1Asp missense ADAP1 1 57208 1.74801E-5 28604 0 3.18573E-5
7-974782-C-G c.33+1G>C splice_donor ADAP1 2 63184 3.16536E-5 31592 0 NA
7-974788-G-A p.Leu10Phe missense ADAP1 8 63662 1.25664E-4 31831 0 9.56694E-5
7-974802-G-A p.Pro5Leu missense ADAP1 153 65134 0.002349 32567 1 0.00350721
7-974804-T-C p.Gln4Gln synonymous ADAP1 1 65130 1.53539E-5 32565 0 7.00133E-6
7-974805-T-A p.Gln4Leu missense ADAP1 1 65246 1.53266E-5 32623 0 NA
7-974809-C-A p.Val3Phe missense ADAP1 1 65514 1.52639E-5 32757 0 3.18898E-5
7-974810-C-T p.Arg2Arg synonymous ADAP1 2 65498 3.05353E-5 32749 0 7.01892E-6
7-974810-C-A p.Arg2Arg synonymous ADAP1 2 65498 3.05353E-5 32749 0 NA
7-974811-C-T p.Arg2Gln missense ADAP1 9 65504 1.37396E-4 32752 0 9.55871E-4
7-974812-G-C p.Arg2Gly missense ADAP1 2 65764 3.04118E-5 32882 0 1.40736E-5
7-974812-G-A p.Arg2Trp missense ADAP1 1 65764 1.52059E-5 32882 0 2.11104E-5
7-975003-C-T c.213+8G>A splice_region ADAP1 2 79628 2.51168E-5 39814 0 3.2041E-4
7-975003-C-G c.213+8G>C splice_region ADAP1 2 79628 2.51168E-5 39814 0 NA
7-975007-G-T c.213+4C>A splice_region ADAP1 1 79582 1.25657E-5 39791 0 5.21213E-5
7-975022-C-T p.Ala68Thr missense ADAP1 2 80044 2.49863E-5 40022 0 NA
7-975024-T-C p.Glu67Gly missense ADAP1 1 80112 1.24825E-5 40056 0 NA
7-975035-G-A p.Asp63Asp synonymous ADAP1 41 80224 5.11069E-4 40112 0 0.01
7-975041-G-A p.Arg61Arg synonymous ADAP1 1 80294 1.24542E-5 40147 0 NA
7-975042-C-G p.Arg61Pro missense ADAP1 1 80258 1.24598E-5 40129 0 NA
7-975043-G-A p.Arg61Cys missense ADAP1 2 80248 2.49227E-5 40124 0 9.0212E-5
7-975046-C-G p.Val60Leu missense ADAP1 25 80280 3.1141E-4 40140 0 6.25E-4
7-975065-C-T p.Gln53Gln synonymous ADAP1 1 80132 1.24794E-5 40066 0 4.43262E-5
7-975065-CT-AC p.Gln53Arg missense ADAP1 1 80132 1.24794E-5 40066 0 NA
7-975084-A-C p.Ile47Ser missense ADAP1 1 79326 1.26062E-5 39663 0 NA
7-975089-C-G p.Ser45Ser synonymous ADAP1 153 78892 0.00193936 39446 2 0.00722394
7-975109-A-G p.Phe39Leu missense ADAP1 1 76242 1.31161E-5 38121 0 NA
7-975112-C-T p.Val38Ile missense ADAP1 6 75294 7.96876E-5 37647 0 1.74911E-5
7-975112-C-G p.Val38Leu missense ADAP1 1 75296 1.32809E-5 37648 0 NA
7-975139-G-C p.Pro29Ala missense+splice_region ADAP1 2 67428 2.96613E-5 33714 0 6.37592E-5
7-975139-G-A p.Pro29Ser missense+splice_region ADAP1 1 67428 1.48306E-5 33714 0 4.51549E-5
7-985399-T-G n.54A>C splice_region ADAP1 1 24370 4.10341E-5 12185 0 NA
7-994033-C-T p.Pro27Pro splice_region+synonymous ADAP1 2 28656 6.97934E-5 14328 0 1.91924E-4
7-994035-G-A p.Pro27Ser missense ADAP1 3 28818 1.04102E-4 14409 0 6.1222E-5
7-994037-G-A p.Ala26Val missense ADAP1 4 28944 1.38198E-4 14472 0 1.18497E-4
7-994041-C-T p.Gly25Ser missense ADAP1 1 29146 3.431E-5 14573 0 NA
7-994042-G-A p.Cys24Cys synonymous ADAP1 1 28754 3.47778E-5 14377 0 0.00892857
7-994080-G-C p.Leu12Val missense ADAP1 2 29700 6.73401E-5 14850 0 NA
7-994090-C-T p.Ala8Ala synonymous ADAP1 10 28778 3.47488E-4 14389 0 8.54634E-4
7-994106-T-C p.Lys3Arg missense ADAP1 2 26608 7.51654E-5 13304 0 3.89166E-5
7-994193-C-A c.-80G>T 5_prime_UTR_premature_start_codon_gain ADAP1 1 21404 4.67202E-5 10702 0 NA
7-994906-A-G n.74+7T>C splice_region ADAP1 43 77370 5.55771E-4 38685 0 0.00101982
7-994930-T-G p.Arg14Ser missense+splice_region ADAP1 3 77506 3.87067E-5 38753 0 3.18552E-5
7-994943-G-T p.Ala10Glu missense ADAP1 3 77528 3.86957E-5 38764 0 1.3398E-5
7-994945-G-A p.His9His synonymous ADAP1 3 77540 3.86897E-5 38770 0 8.03859E-5
7-994958-GCACAC-G p.Cys4fs frameshift ADAP1 1 77548 1.28952E-5 38774 0 NA
7-994959-C-T p.Ala5Thr missense ADAP1 1 77554 1.28942E-5 38777 0 6.05327E-5
7-994961-C-T p.Cys4Tyr missense ADAP1 6 77552 7.73674E-5 38776 0 1.59215E-4
7-994964-C-T p.Gly3Glu missense ADAP1 1 77560 1.28932E-5 38780 0 6.37024E-5
7-994968-G-A p.Leu2Leu synonymous ADAP1 1 77566 1.28922E-5 38783 0 NA
7-994993-T-G p.Arg17Ser missense ADAP1 1 77570 1.28916E-5 38785 0 6.69999E-6
7-994994-C-T p.Arg17Lys missense ADAP1 1 77568 1.28919E-5 38784 0 1.21227E-4
7-994998-T-C p.Arg16Gly missense ADAP1 2 77556 2.57878E-5 38778 0 NA
7-995003-G-C p.Pro14Arg missense ADAP1 1717 77464 0.0221651 38732 46 0.043125
7-995004-G-T p.Pro14Thr missense ADAP1 86 77534 0.00110919 38767 0 6.63459E-4
7-995007-T-A p.Asn13Tyr missense ADAP1 1 77530 1.28982E-5 38765 0 NA
7-995022-G-A p.Arg8Trp missense ADAP1 1 77486 1.29056E-5 38743 0 6.7034E-6
7-995027-A-C p.Phe6Cys missense ADAP1 1 77460 1.29099E-5 38730 0 NA
7-995031-C-A p.Val5Phe missense ADAP1 121 77442 0.00156246 38721 0 0.00337558
7-995037-G-A p.Gln3* stop_gained ADAP1 121 77386 0.00156359 38693 0 0.00158711