Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-1505203-C-CA c.*201-5dupT splice_region ADAMTSL5 1 1872 5.34188E-4 936 0 0.0067243
19-1505811-C-T c.*200+3G>A splice_region ADAMTSL5 9 40462 2.22431E-4 20231 0 3.82093E-4
19-1505816-G-A c.*198C>T splice_region ADAMTSL5 2 42322 4.72567E-5 21161 0 NA
19-1505930-C-T n.1679G>A splice_region ADAMTSL5 2 74456 2.68615E-5 37228 0 NA
19-1506019-C-T p.Gly471Ser missense ADAMTSL5 1 79232 1.26212E-5 39616 0 NA
19-1506024-C-T p.Cys469Tyr missense ADAMTSL5 1 79248 1.26186E-5 39624 0 6.48985E-5
19-1506025-A-G p.Cys469Arg missense ADAMTSL5 16 79292 2.01786E-4 39646 0 2.77766E-4
19-1506031-G-A p.Arg467Trp missense ADAMTSL5 487 79482 0.00612717 39741 3 0.00919682
19-1506032-G-A p.Ala466Ala synonymous ADAMTSL5 1 79530 1.25739E-5 39765 0 5.88305E-5
19-1506036-G-A p.Thr465Ile missense ADAMTSL5 4 79672 5.02058E-5 39836 1 1.90498E-5
19-1506038-C-G p.Leu464Leu synonymous ADAMTSL5 6 79698 7.52842E-5 39849 2 6.37105E-5
19-1506042-C-T p.Arg463His missense ADAMTSL5 3 79610 3.76837E-5 39805 0 0.00101729
19-1506043-G-A p.Arg463Cys missense ADAMTSL5 1 79734 1.25417E-5 39867 0 5.54672E-5
19-1506048-C-T p.Arg461His missense ADAMTSL5 2 79632 2.51155E-5 39816 0 3.34925E-5
19-1506049-G-A p.Arg461Cys missense ADAMTSL5 11 79634 1.38132E-4 39817 0 6.27353E-4
19-1506049-G-C p.Arg461Gly missense ADAMTSL5 1 79634 1.25575E-5 39817 0 NA
19-1506059-C-T p.Ala457Ala synonymous ADAMTSL5 29 79780 3.635E-4 39890 0 2.8677E-4
19-1506060-G-A p.Ala457Val missense ADAMTSL5 4 79708 5.01832E-5 39854 0 6.59283E-5
19-1506063-G-A p.Pro456Leu missense ADAMTSL5 43 79862 5.38429E-4 39931 0 0.00152594
19-1506067-T-C p.Ser455Gly missense ADAMTSL5 1 79826 1.25272E-5 39913 0 NA
19-1506073-G-A p.Pro453Ser missense ADAMTSL5 1 79718 1.25442E-5 39859 0 3.95485E-4
19-1506075-CGGGCGTAGCCGGCGTG-C p.His447fs frameshift ADAMTSL5 5 79710 6.27274E-5 39855 0 6.00673E-5
19-1506075-C-T p.Arg452Gln missense ADAMTSL5 4 79710 5.01819E-5 39855 0 2.25252E-4
19-1506075-C-G p.Arg452Pro missense ADAMTSL5 1 79710 1.25455E-5 39855 0 NA
19-1506076-G-A p.Arg452Trp missense ADAMTSL5 1 79748 1.25395E-5 39874 0 8.88284E-5
19-1506079-C-T p.Ala451Thr missense ADAMTSL5 3 79682 3.76497E-5 39841 0 0.0010142
19-1506085-C-T p.Gly449Ser missense ADAMTSL5 2 79886 2.50357E-5 39943 0 0.001875
19-1506086-G-A p.Ala448Ala synonymous ADAMTSL5 27 79958 3.37677E-4 39979 0 0.0035461
19-1506088-C-A p.Ala448Ser missense ADAMTSL5 1 79890 1.25172E-5 39945 0 5.06586E-4
19-1506088-C-T p.Ala448Thr missense ADAMTSL5 1 79890 1.25172E-5 39945 0 3.98343E-5
19-1506098-C-T p.Leu444Leu synonymous ADAMTSL5 1 80142 1.24779E-5 40071 0 NA
19-1506099-A-C p.Leu444Arg missense ADAMTSL5 1 80210 1.24673E-5 40105 0 3.18613E-5
19-1506116-G-A p.Gly438Gly synonymous ADAMTSL5 2 80516 2.48398E-5 40258 0 4.22069E-6
19-1506119-G-A p.Asp437Asp synonymous ADAMTSL5 2 80504 2.48435E-5 40252 0 0.00101215
19-1506121-C-T p.Asp437Asn missense ADAMTSL5 1 80458 1.24288E-5 40229 0 1.06642E-5
19-1506122-G-A p.Pro436Pro synonymous ADAMTSL5 1 80554 1.2414E-5 40277 0 NA
19-1506127-T-A p.Ser435Cys missense ADAMTSL5 1 80626 1.24029E-5 40313 0 NA
19-1506135-C-T p.Arg432His missense ADAMTSL5 353 80758 0.00437108 40379 0 0.006875
19-1506149-C-G p.Leu427Leu synonymous ADAMTSL5 5 81120 6.16371E-5 40560 0 1.23222E-5
19-1506159-C-T p.Arg424Gln missense ADAMTSL5 9 81066 1.11021E-4 40533 1 9.56145E-5
19-1506160-G-A p.Arg424Trp missense ADAMTSL5 4 81098 4.9323E-5 40549 0 4.62603E-5
19-1506176-C-CGGGCAGGGGCAGT p.Met419fs frameshift ADAMTSL5 2 81246 2.46166E-5 40623 0 2.4478E-5
19-1506176-C-T p.Pro418Pro synonymous ADAMTSL5 6 81246 7.38498E-5 40623 0 6.37349E-5
19-1506176-C-A p.Pro418Pro synonymous ADAMTSL5 1 81246 1.23083E-5 40623 0 4.07967E-6
19-1506177-G-A p.Pro418Leu missense ADAMTSL5 1 81204 1.23147E-5 40602 0 2.70807E-5
19-1506198-G-A p.Ala411Val missense ADAMTSL5 13 81086 1.60324E-4 40543 0 1.06857E-4
19-1506206-G-A p.Tyr408Tyr synonymous ADAMTSL5 3 81120 3.69822E-5 40560 0 3.56176E-5
19-1506212-G-A p.Arg406Arg synonymous ADAMTSL5 24 81014 2.96245E-4 40507 0 1.59327E-4
19-1506214-G-C p.Arg406Gly missense ADAMTSL5 33 80946 4.07679E-4 40473 0 0.00100908
19-1506219-C-T p.Arg404Gln missense ADAMTSL5 349 80936 0.00431205 40468 7 0.0113455
19-1506220-G-A p.Arg404Trp missense ADAMTSL5 156 80890 0.00192854 40445 3 0.0027039
19-1506223-G-C p.Leu403Val missense ADAMTSL5 1 80874 1.23649E-5 40437 0 NA
19-1506228-G-A p.Ser401Leu missense ADAMTSL5 3 80740 3.71563E-5 40370 0 3.18654E-5
19-1506231-C-T p.Arg400His missense ADAMTSL5 2 80644 2.48004E-5 40322 0 9.55962E-5
19-1506244-C-T p.Val396Ile missense ADAMTSL5 2 80440 2.48633E-5 40220 0 7.24388E-5
19-1506245-G-A p.Leu395Leu synonymous ADAMTSL5 56 80396 6.96552E-4 40198 0 0.0011794
19-1506255-C-T p.Arg392His missense ADAMTSL5 1 80256 1.24601E-5 40128 0 3.18878E-5
19-1506256-G-A p.Arg392Cys missense ADAMTSL5 1 80238 1.24629E-5 40119 0 1.38927E-5
19-1506257-C-T p.Val391Val synonymous ADAMTSL5 1 80256 1.24601E-5 40128 0 NA
19-1506260-C-G p.Glu390Asp missense ADAMTSL5 1 80314 1.24511E-5 40157 0 1.85737E-5
19-1506265-A-G p.Tyr389His missense ADAMTSL5 1 80296 1.24539E-5 40148 0 6.38081E-5
19-1506267-C-T p.Arg388His missense ADAMTSL5 1 80200 1.24688E-5 40100 0 9.2302E-6
19-1506268-G-A p.Arg388Cys missense ADAMTSL5 14 80270 1.74411E-4 40135 0 0.00101112
19-1506270-G-C p.Thr387Ser missense ADAMTSL5 2 80356 2.48892E-5 40178 0 NA
19-1506276-T-C p.Gln385Arg missense ADAMTSL5 1 80400 1.24378E-5 40200 0 NA
19-1506286-G-C p.His382Asp missense ADAMTSL5 3 80426 3.73014E-5 40213 0 9.34038E-6
19-1506302-T-G p.Ser119Arg missense ADAMTSL5 1 80218 1.2466E-5 40109 0 NA
19-1506303-C-T p.Arg376Gln missense ADAMTSL5 3 80210 3.74018E-5 40105 0 7.64015E-5
19-1506307-C-A p.Gly117Val missense+splice_region ADAMTSL5 4 80138 4.99139E-5 40069 0 1.01619E-5
19-1506311-G-C p.Phe373Leu missense ADAMTSL5 2 80210 2.49345E-5 40105 0 3.18796E-5
19-1506317-T-G c.1115-2A>C splice_acceptor ADAMTSL5 1 80120 1.24813E-5 40060 0 5.16049E-6
19-1506320-T-C c.1115-5A>G splice_region ADAMTSL5 1 80028 1.24956E-5 40014 0 5.17636E-6
19-1506323-G-C c.1115-8C>G splice_region ADAMTSL5 3 79954 3.75216E-5 39977 0 6.25E-4
19-1506581-G-C c.1114+8C>G splice_region ADAMTSL5 1 78194 1.27887E-5 39097 0 NA
19-1506582-G-T c.1114+7C>A splice_region ADAMTSL5 88 78096 0.00112682 39048 0 5.30724E-4
19-1506584-C-G c.1114+5G>C splice_region ADAMTSL5 1 78066 1.28097E-5 39033 0 4.10836E-6
19-1506601-C-T p.Gly368Ser missense ADAMTSL5 4 77402 5.16783E-5 38701 0 6.25E-4
19-1506602-G-A p.Cys367Cys synonymous ADAMTSL5 1 77454 1.29109E-5 38727 0 3.06817E-5
19-1506604-A-T p.Cys367Ser missense ADAMTSL5 2 77434 2.58284E-5 38717 0 2.03824E-5
19-1506611-G-T p.Leu364Leu synonymous ADAMTSL5 181 77062 0.00234876 38531 0 0.00288295
19-1506611-G-A p.Leu364Leu synonymous ADAMTSL5 1 77082 1.29732E-5 38541 0 4.0801E-6
19-1506618-C-T p.Arg362Gln missense ADAMTSL5 3 75928 3.95111E-5 37964 0 2.05601E-5
19-1506619-G-A p.Arg362* stop_gained ADAMTSL5 3 76172 3.93846E-5 38086 0 6.16143E-5
19-1506626-G-A p.Arg359Arg synonymous ADAMTSL5 1 75210 1.32961E-5 37605 0 3.19877E-5
19-1506628-G-A p.Arg359Cys missense ADAMTSL5 1 75076 1.33198E-5 37538 0 3.21481E-5
19-1506631-C-T p.Gly358Ser missense ADAMTSL5 1 74384 1.34438E-5 37192 0 3.15365E-5
19-1506632-G-A p.Arg357Arg synonymous ADAMTSL5 7 74374 9.41189E-5 37187 0 3.20739E-4
19-1506633-C-T p.Arg357His missense ADAMTSL5 6 74066 8.10088E-5 37033 0 6.25782E-4
19-1506634-G-A p.Arg357Cys missense ADAMTSL5 3 74364 4.03421E-5 37182 0 5.07614E-4
19-1506657-G-A p.Pro349Leu missense ADAMTSL5 1 73248 1.36523E-5 36624 0 4.33377E-6
19-1506660-TCTGTGGGATGGGCGGTGCTGTGAGGGGCACAGGCCTCAGTCCCCACTCATCCCCCACCCTGGCTGTCCCCACCTCAC-T c.1042+1_1043-1delGTGAGGTGGGGACAGCCAGGGTGGGGGATGAGTGGGGACTGAGGCCTGTGCCCCTCACAGCACCGCCCATCCCACAG splice_acceptor ADAMTSL5 1 72730 1.37495E-5 36365 0 NA
19-1506664-T-C c.1043-4A>G splice_region ADAMTSL5 1 73130 1.36743E-5 36565 0 6.43956E-5
19-1506732-C-A c.1042+6G>T splice_region ADAMTSL5 3 68920 4.35287E-5 34460 0 6.39632E-5
19-1506736-AC-A c.1042+1delG splice_donor ADAMTSL5 1 68378 1.46246E-5 34189 0 3.21419E-5
19-1506748-C-A p.Thr344Thr synonymous ADAMTSL5 1 67448 1.48262E-5 33724 0 6.14349E-6
19-1506749-G-A p.Thr344Met missense ADAMTSL5 1 67828 1.47432E-5 33914 0 4.34254E-5
19-1506777-G-C p.Pro335Ala missense ADAMTSL5 2 67976 2.94221E-5 33988 0 5.24109E-4
19-1506783-C-CG p.Ala333fs frameshift ADAMTSL5 1 67012 1.49227E-5 33506 0 9.64382E-5
19-1506783-C-T p.Ala333Thr missense ADAMTSL5 3 67012 4.47681E-5 33506 0 1.28584E-4
19-1506784-G-A p.Pro332Pro synonymous ADAMTSL5 4 67760 5.90319E-5 33880 0 1.08696E-4
19-1506785-GGGGGCTGAGGCTCCACCCCCC-G p.Arg325_Pro331del disruptive_inframe_deletion ADAMTSL5 1 67960 1.47145E-5 33980 0 NA
19-1506799-C-T p.Val327Val synonymous ADAMTSL5 559 68494 0.0081613 34247 18 0.0191038
19-1506801-C-T p.Val327Met missense ADAMTSL5 3 68862 4.35654E-5 34431 0 NA
19-1506804-C-G p.Gly326Arg missense ADAMTSL5 2 69280 2.88684E-5 34640 0 5.73066E-5
19-1506804-C-A p.Gly326Trp missense ADAMTSL5 1 69280 1.44342E-5 34640 0 NA
19-1506806-C-T p.Arg325Gln missense ADAMTSL5 1 69370 1.44155E-5 34685 0 1.40463E-5
19-1506821-C-A p.Arg320Met missense ADAMTSL5 30 71628 4.18831E-4 35814 0 0.00188206
19-1506824-A-T p.Leu319Gln missense ADAMTSL5 159 71968 0.00220932 35984 0 0.00720646
19-1506833-C-T p.Gly316Asp missense ADAMTSL5 1 72668 1.37612E-5 36334 0 NA
19-1506834-C-A p.Gly316Cys missense ADAMTSL5 1 72832 1.37302E-5 36416 0 NA
19-1506835-C-T p.Leu315Leu synonymous ADAMTSL5 1 72942 1.37095E-5 36471 0 1.41295E-5
19-1506842-T-G p.Gln313Pro missense ADAMTSL5 1 73512 1.36032E-5 36756 0 NA
19-1506862-G-T p.Ser306Arg missense ADAMTSL5 1 74214 1.34745E-5 37107 0 6.6469E-6
19-1506869-C-T p.Arg304His missense ADAMTSL5 2 73872 2.70739E-5 36936 0 5.41653E-5
19-1506870-G-A p.Arg304Cys missense ADAMTSL5 2 73848 2.70827E-5 36924 0 1.32899E-5
19-1506875-C-T p.Arg302Gln missense ADAMTSL5 1 73794 1.35512E-5 36897 0 2.65203E-5
19-1506883-C-T p.Trp299* stop_gained ADAMTSL5 1 73216 1.36582E-5 36608 0 NA
19-1506887-A-T p.Phe298Tyr missense ADAMTSL5 1 73260 1.365E-5 36630 0 1.98657E-5
19-1506892-A-T p.Phe296Leu missense ADAMTSL5 2 73126 2.73501E-5 36563 0 3.20369E-5
19-1506897-C-T p.Glu295Lys missense ADAMTSL5 1 72740 1.37476E-5 36370 0 2.24072E-4
19-1506898-G-C p.Ile294Met missense ADAMTSL5 1 72644 1.37658E-5 36322 0 6.6306E-6
19-1506902-C-T p.Gly293Asp missense ADAMTSL5 4 72392 5.52547E-5 36196 0 NA
19-1506904-A-G p.Pro292Pro synonymous ADAMTSL5 1 72334 1.38248E-5 36167 0 NA
19-1506912-G-C p.Pro290Ala missense ADAMTSL5 7 71232 9.82704E-5 35616 0 5.44129E-5
19-1506915-C-CCT p.Glu289fs frameshift ADAMTSL5 2 70956 2.81865E-5 35478 0 6.71159E-6
19-1506915-C-G p.Glu289Gln missense ADAMTSL5 1 70956 1.40932E-5 35478 0 NA
19-1506918-G-T p.Gln288Lys missense ADAMTSL5 1 70544 1.41755E-5 35272 0 3.19877E-5
19-1506919-CAGG-C p.Leu287del disruptive_inframe_deletion ADAMTSL5 1 70324 1.42199E-5 35162 0 NA
19-1507234-G-T c.852+7C>A splice_region ADAMTSL5 1 81546 1.2263E-5 40773 0 5.48119E-6
19-1507235-T-G c.852+6A>C splice_region ADAMTSL5 1 81556 1.22615E-5 40778 0 9.1503E-6
19-1507246-G-A p.Leu283Leu synonymous ADAMTSL5 1 81914 1.22079E-5 40957 0 1.82428E-5
19-1507265-G-A p.Pro276Pro synonymous ADAMTSL5 1 82252 1.21578E-5 41126 0 NA
19-1507270-C-T p.Gly275Arg missense ADAMTSL5 187 82264 0.00227317 41132 0 0.00223555
19-1507270-C-CGGCTGCTTG p.Ala274_Gly275insGlnAlaAla conservative_inframe_insertion ADAMTSL5 1 82270 1.21551E-5 41135 0 NA
19-1507270-C-G p.Gly275Arg missense ADAMTSL5 1 82270 1.21551E-5 41135 0 NA
19-1507297-C-G p.Gly266Arg missense ADAMTSL5 1 82552 1.21136E-5 41276 0 1.31176E-5
19-1507303-C-T p.Asp264Asn missense ADAMTSL5 10 82550 1.21139E-4 41275 0 2.49946E-4
19-1507304-T-G p.Arg263Arg synonymous ADAMTSL5 3 82556 3.6339E-5 41278 0 1.91559E-4
19-1507305-C-T p.Arg263Gln missense ADAMTSL5 6 82550 7.26832E-5 41275 0 1.59622E-4
19-1507306-G-A p.Arg263* stop_gained ADAMTSL5 2 82516 2.42377E-5 41258 0 8.91424E-6
19-1507310-G-A p.Tyr261Tyr synonymous ADAMTSL5 1 82538 1.21156E-5 41269 0 NA
19-1507316-C-T p.Val259Val synonymous ADAMTSL5 1 82550 1.21139E-5 41275 0 6.25E-4
19-1507321-GC-CT p.ThrHis257ThrAsp missense ADAMTSL5 1 82532 1.21165E-5 41266 0 NA
19-1507322-C-T p.Thr257Thr synonymous ADAMTSL5 166 82522 0.00201158 41261 1 0.005625
19-1507323-G-A p.Thr257Met missense ADAMTSL5 4 82512 4.84778E-5 41256 0 2.96655E-5
19-1507327-C-T p.Gly256Ser missense ADAMTSL5 2 82550 2.42277E-5 41275 0 0.00125
19-1507328-G-A p.Ala255Ala synonymous ADAMTSL5 3 82528 3.63513E-5 41264 0 2.12815E-5
19-1507331-C-T p.Ala254Ala synonymous ADAMTSL5 2 82550 2.42277E-5 41275 0 1.91546E-4
19-1507332-G-A p.Ala254Val missense ADAMTSL5 7 82522 8.48259E-5 41261 0 3.19183E-5
19-1507336-C-T p.Glu253Lys missense ADAMTSL5 2 82544 2.42295E-5 41272 0 1.27673E-4
19-1507337-G-A p.Tyr252Tyr synonymous ADAMTSL5 1 82534 1.21162E-5 41267 0 5.03525E-4
19-1507341-G-A p.Thr251Ile missense ADAMTSL5 2 82568 2.42225E-5 41284 0 2.13986E-5
19-1507347-G-C p.Pro249Arg missense ADAMTSL5 1 82596 1.21071E-5 41298 0 8.893E-6
19-1507348-G-C p.Pro249Ala missense ADAMTSL5 1 82588 1.21083E-5 41294 0 NA
19-1507351-G-A p.Pro248Ser missense ADAMTSL5 1 82592 1.21077E-5 41296 0 NA
19-1507353-C-T p.Ser247Asn missense ADAMTSL5 1 82594 1.21074E-5 41297 0 NA
19-1507356-A-G p.Val246Ala missense ADAMTSL5 1 82614 1.21045E-5 41307 0 NA
19-1507357-C-T p.Val246Ile missense ADAMTSL5 1 82618 1.21039E-5 41309 0 1.33895E-5
19-1507358-C-T p.Val245Val synonymous ADAMTSL5 1 82640 1.21007E-5 41320 0 4.45955E-6
19-1507363-A-G p.Trp244Arg missense ADAMTSL5 7 82646 8.46986E-5 41323 0 1.27641E-4
19-1507373-A-G p.Leu240Leu synonymous ADAMTSL5 2 82684 2.41885E-5 41342 0 NA
19-1507383-C-A p.Arg237Leu missense ADAMTSL5 1 82656 1.20983E-5 41328 0 3.19264E-5
19-1507388-A-G p.Asp235Asp synonymous ADAMTSL5 5 82666 6.04844E-5 41333 0 1.80024E-5
19-1507391-G-C p.Gly234Gly synonymous ADAMTSL5 2 82652 2.41978E-5 41326 0 3.19224E-5
19-1507391-GC-G p.Gly234fs frameshift ADAMTSL5 2 82652 2.41978E-5 41326 0 NA
19-1507392-C-T p.Gly234Asp missense ADAMTSL5 4 82658 4.83922E-5 41329 0 1.59612E-4
19-1507392-C-A p.Gly234Val missense ADAMTSL5 1 82658 1.2098E-5 41329 0 1.27689E-4
19-1507393-C-T p.Gly234Ser missense ADAMTSL5 2 82676 2.41908E-5 41338 0 6.86116E-5
19-1507394-C-A p.Gly233Gly synonymous ADAMTSL5 1 82682 1.20945E-5 41341 0 NA
19-1507397-C-G p.Met1? start_lost ADAMTSL5 3 82656 3.6295E-5 41328 0 3.60114E-5
19-1507402-G-T p.Leu231Met missense+splice_region ADAMTSL5 90 82634 0.00108914 41317 1 0.0020106
19-1507535-TC-CG c.52+8_52+9delGAinsCG splice_region ADAMTSL5 4 82740 4.83442E-5 41370 0 NA
19-1507536-C-T c.52+8G>A splice_region ADAMTSL5 1 82740 1.20861E-5 41370 0 2.49596E-5
19-1507536-C-G c.52+8G>C splice_region ADAMTSL5 1 82740 1.20861E-5 41370 0 7.48789E-5
19-1507539-C-T c.52+5G>A splice_region ADAMTSL5 1 82800 1.20773E-5 41400 0 NA
19-1507543-C-T c.52+1G>A splice_donor ADAMTSL5 1 82830 1.20729E-5 41415 0 3.18695E-5
19-1507546-C-G p.Gly17Ala missense+splice_region ADAMTSL5 2 82834 2.41447E-5 41417 0 1.66392E-5
19-1507553-T-C p.Ile15Val missense ADAMTSL5 1 82838 1.20718E-5 41419 0 NA
19-1507557-C-T p.Leu229Leu splice_region+synonymous ADAMTSL5 16 82902 1.92999E-4 41451 0 6.25782E-4
19-1507569-G-A p.Ser225Ser synonymous ADAMTSL5 10 82878 1.20659E-4 41439 0 1.41504E-4
19-1507574-T-C p.Arg224Gly missense ADAMTSL5 4 82848 4.82812E-5 41424 0 6.37227E-5
19-1507584-GC-CG p.Arg220Pro missense ADAMTSL5 1 82792 1.20785E-5 41396 0 NA
19-1507585-C-A p.Arg220Leu missense ADAMTSL5 533 82782 0.0064386 41391 1 0.00615177
19-1507600-C-G p.Gly215Ala missense ADAMTSL5 1 82664 1.20972E-5 41332 0 NA
19-1507608-G-A p.Ile212Ile synonymous ADAMTSL5 20 82682 2.41891E-4 41341 0 0.0025
19-1507620-G-T p.Asn208Lys missense ADAMTSL5 1 82640 1.21007E-5 41320 0 NA
19-1507622-T-C p.Asn208Asp missense ADAMTSL5 1 82650 1.20992E-5 41325 0 3.98975E-6
19-1507635-G-A c.-85C>T 5_prime_UTR_premature_start_codon_gain ADAMTSL5 1 82544 1.21148E-5 41272 0 3.99485E-6
19-1507643-C-CGGCGTCACGAAACACGCGCTGCACGAAAAGGCACGAGTCGT c.602-2_602-1insACGACTCGTGCCTTTTCGTGCAGCGCGTGTTTCGTGACGCC splice_acceptor ADAMTSL5 1 82468 1.21259E-5 41234 0 NA
19-1507643-C-T c.602-1G>A splice_acceptor ADAMTSL5 1 82468 1.21259E-5 41234 0 NA
19-1507644-T-C c.602-2A>G splice_acceptor ADAMTSL5 1 82446 1.21292E-5 41223 0 3.99722E-6
19-1507648-T-C c.602-6A>G splice_region ADAMTSL5 1 82396 1.21365E-5 41198 0 NA
19-1507998-G-A c.-94C>T 5_prime_UTR_premature_start_codon_gain ADAMTSL5 8 80648 9.91965E-5 40324 0 2.18579E-4
19-1508000-C-T p.Ala200Thr missense ADAMTSL5 1 80712 1.23897E-5 40356 0 5.30335E-5
19-1508005-C-A p.Arg198Leu missense ADAMTSL5 1 80808 1.2375E-5 40404 0 2.37654E-5
19-1508028-G-T p.Cys190* stop_gained ADAMTSL5 8 81162 9.85683E-5 40581 0 8.27815E-5
19-1508031-C-T c.-127G>A 5_prime_UTR_premature_start_codon_gain ADAMTSL5 2 81150 2.46457E-5 40575 0 NA
19-1508032-G-T p.Ser189* stop_gained ADAMTSL5 1 81160 1.23213E-5 40580 0 NA
19-1508032-G-A p.Ser189Leu missense ADAMTSL5 1 81160 1.23213E-5 40580 0 0.00101729
19-1508036-CGTT-C p.Asn187del conservative_inframe_deletion ADAMTSL5 2 81124 2.46536E-5 40562 0 3.18837E-5
19-1508041-G-A p.Ala186Val missense ADAMTSL5 1 81088 1.23323E-5 40544 0 5.63412E-5
19-1508042-C-T p.Ala186Thr missense ADAMTSL5 2 81058 2.46737E-5 40529 0 1.40087E-5
19-1508044-C-T p.Gly185Asp missense ADAMTSL5 3 81062 3.70087E-5 40531 0 1.3604E-5
19-1508050-C-T p.Cys183Tyr missense ADAMTSL5 1 81050 1.23381E-5 40525 0 NA
19-1508057-C-T p.Gly181Ser missense ADAMTSL5 1 81106 1.23295E-5 40553 0 NA
19-1508061-G-A c.-157C>T 5_prime_UTR_premature_start_codon_gain ADAMTSL5 413 81072 0.00509424 40536 11 0.00921615
19-1508061-GC-TT p.Arg179Gln missense ADAMTSL5 2 81078 2.46676E-5 40539 0 NA
19-1508071-A-G p.Leu176Pro missense ADAMTSL5 1 81016 1.23432E-5 40508 0 4.75398E-5
19-1508077-C-T p.Gly174Asp missense ADAMTSL5 1 80982 1.23484E-5 40491 0 3.18918E-5
19-1508078-C-A p.Gly174Cys missense ADAMTSL5 1 81010 1.23442E-5 40505 0 8.24131E-6
19-1508080-G-A p.Ser173Leu missense ADAMTSL5 3 80970 3.70508E-5 40485 0 6.37877E-5
19-1508088-C-T p.Leu170Leu synonymous ADAMTSL5 1 80924 1.23573E-5 40462 0 4.13124E-6
19-1508102-C-T p.Gly166Ser missense ADAMTSL5 1 80666 1.23968E-5 40333 0 9.56877E-5
19-1508106-G-A p.Ser164Ser splice_region+synonymous ADAMTSL5 5 80590 6.20424E-5 40295 0 4.21056E-6
19-1508107-C-A p.Ser164Ile missense+splice_region ADAMTSL5 2 80596 2.48151E-5 40298 0 2.10169E-5
19-1508107-C-T p.Ser164Asn missense+splice_region ADAMTSL5 1 80596 1.24076E-5 40298 0 1.31999E-5
19-1508108-T-TAAGGCAGCGGCCAGCCACGCAGACCCC c.490-1_490insGGGGTCTGCGTGGCTGGCCGCTGCCTT splice_acceptor ADAMTSL5 1 80558 1.24134E-5 40279 0 NA
19-1508115-G-A c.490-7C>T splice_region ADAMTSL5 1 80368 1.24428E-5 40184 0 1.38057E-5
19-1508444-G-C p.Leu163Val missense+splice_region ADAMTSL5 2 53768 3.71968E-5 26884 0 3.15052E-5
19-1508446-C-G p.Cys162Ser missense ADAMTSL5 1 53566 1.86686E-5 26783 0 NA
19-1508446-C-A p.Cys162Phe missense ADAMTSL5 3 53566 5.60057E-5 26783 0 0.00107759
19-1508447-AG-CC p.ArgCys161ArgGly missense ADAMTSL5 2 53832 3.71526E-5 26916 0 NA
19-1508454-A-G p.Ala159Ala synonymous ADAMTSL5 1 54308 1.84135E-5 27154 0 1.15865E-5
19-1508465-C-T p.Val156Ile missense ADAMTSL5 1 55448 1.80349E-5 27724 0 NA
19-1508466-C-A p.Gly155Gly synonymous ADAMTSL5 2 55612 3.59635E-5 27806 0 1.59561E-4
19-1508468-C-T p.Gly155Arg missense ADAMTSL5 1 56016 1.7852E-5 28008 0 3.51222E-5
19-1508469-C-T p.Gln154Gln synonymous ADAMTSL5 2 56118 3.56392E-5 28059 0 3.18857E-5
19-1508470-T-A p.Gln154Leu missense ADAMTSL5 1 56160 1.78063E-5 28080 0 NA
19-1508474-C-T p.Ala153Thr missense ADAMTSL5 1 56264 1.77734E-5 28132 0 9.15639E-5
19-1508478-C-A c.-241G>T 5_prime_UTR_premature_start_codon_gain ADAMTSL5 1 56490 1.77022E-5 28245 0 NA
19-1508485-C-CA p.Cys149fs frameshift ADAMTSL5 1 57362 1.74331E-5 28681 0 NA
19-1508495-C-T p.Gly146Ser missense ADAMTSL5 1 57970 1.72503E-5 28985 0 9.5645E-5
19-1508495-C-G p.Gly146Arg missense ADAMTSL5 3 57970 5.17509E-5 28985 0 6.25E-4
19-1508501-G-A c.-264C>T 5_prime_UTR_premature_start_codon_gain ADAMTSL5 2 58702 3.40704E-5 29351 0 4.88849E-6
19-1508505-G-T p.Arg142Arg synonymous ADAMTSL5 1 58458 1.71063E-5 29229 0 NA
19-1508528-C-T p.Ala135Thr missense ADAMTSL5 2 59892 3.33934E-5 29946 0 7.22369E-5
19-1508528-C-A p.Ala135Ser missense ADAMTSL5 1 59892 1.66967E-5 29946 0 6.37389E-5
19-1508536-T-G p.Glu132Ala missense ADAMTSL5 1 60344 1.65717E-5 30172 0 NA
19-1508561-G-A p.Gln124* stop_gained ADAMTSL5 2 58774 3.40287E-5 29387 0 NA
19-1508573-A-C c.362-4T>G splice_region ADAMTSL5 4 57682 6.93457E-5 28841 0 9.56633E-5
19-1508574-G-A c.362-5C>T splice_region ADAMTSL5 1 57762 1.73124E-5 28881 0 6.9601E-6
19-1510148-C-A c.361+1G>T splice_donor ADAMTSL5 4 82492 4.84895E-5 41246 0 5.35584E-5
19-1510151-C-T p.Trp23* stop_gained ADAMTSL5 1 82524 1.21177E-5 41262 0 8.21571E-6
19-1510153-A-G p.Trp23Arg missense ADAMTSL5 1 82504 1.21206E-5 41252 0 3.18776E-5
19-1510155-G-A p.His119Tyr missense ADAMTSL5 1 82540 1.21153E-5 41270 0 NA
19-1510166-C-T p.Trp115* stop_gained ADAMTSL5 1 82578 1.21098E-5 41289 0 NA
19-1510170-G-A p.Gln114* stop_gained ADAMTSL5 1 82592 1.21077E-5 41296 0 4.06461E-6
19-1510186-G-A p.His12Tyr missense ADAMTSL5 1 82554 1.21133E-5 41277 0 8.10504E-6
19-1510192-G-A p.Pro10Ser missense ADAMTSL5 1 82658 1.2098E-5 41329 0 NA
19-1510199-C-T p.Arg104His missense ADAMTSL5 6 82664 7.2583E-5 41332 0 6.37552E-5
19-1510200-G-A p.Arg104Cys missense ADAMTSL5 1 82686 1.20939E-5 41343 0 3.18796E-5
19-1510212-G-A p.Pro3Leu missense ADAMTSL5 1 82646 1.20998E-5 41323 0 NA
19-1510219-C-G p.Gln97His missense ADAMTSL5 2 82612 2.42096E-5 41306 0 4.02881E-6
19-1510222-TA-T p.Leu96fs frameshift ADAMTSL5 1 82596 1.21071E-5 41298 0 8.66942E-6
19-1510229-C-T p.Arg94Gln missense ADAMTSL5 1 82508 1.212E-5 41254 0 2.82185E-5
19-1510241-G-T p.Ala90Asp missense ADAMTSL5 1 82434 1.21309E-5 41217 0 NA
19-1510247-G-T p.Pro88Gln missense ADAMTSL5 1 82418 1.21333E-5 41209 0 NA
19-1510250-G-A p.Pro87Leu missense ADAMTSL5 1 82396 1.21365E-5 41198 0 NA
19-1510252-G-A p.Cys86Cys synonymous ADAMTSL5 2 82386 2.4276E-5 41193 0 NA
19-1510256-TCCTAGGGACAGAGATAGGTGAGCCAGAGGCTGGGACAACCCCAAGGGGCAGGTGGTGGGCTTCAGGCAGTCTGGGGTGGGAGAGTGGTCTGGGAGGTGGGCAGGGCTTA-T p.Asp85fs frameshift ADAMTSL5 2 82332 2.42919E-5 41166 0 NA
19-1510265-C-T c.253-8G>A splice_region ADAMTSL5 1 82290 1.21521E-5 41145 0 NA
19-1510368-G-A p.Pro84Leu missense+splice_region ADAMTSL5 19 82158 2.31262E-4 41079 0 1.36261E-4
19-1510373-C-A p.Gln82His missense ADAMTSL5 1 82120 1.21773E-5 41060 0 NA
19-1510379-G-A c.-454C>T 5_prime_UTR_premature_start_codon_gain ADAMTSL5 1 82058 1.21865E-5 41029 0 NA
19-1510383-C-T p.Arg79His missense ADAMTSL5 3 81904 3.66282E-5 40952 0 1.60453E-5
19-1510384-G-A p.Arg79Cys missense ADAMTSL5 1 81936 1.22046E-5 40968 0 1.60566E-5
19-1510390-C-T p.Glu77Lys missense ADAMTSL5 5 81742 6.11681E-5 40871 0 3.6133E-5
19-1510392-T-C p.His76Arg missense ADAMTSL5 1 81694 1.22408E-5 40847 0 NA
19-1510394-G-T p.Ser75Ser synonymous ADAMTSL5 1 81656 1.22465E-5 40828 0 NA
19-1510409-C-T c.-484G>A 5_prime_UTR_premature_start_codon_gain ADAMTSL5 6 81112 7.39718E-5 40556 0 3.19305E-5
19-1510410-G-C p.Pro70Arg missense ADAMTSL5 1 81060 1.23365E-5 40530 0 NA
19-1510410-G-A p.Pro70Leu missense ADAMTSL5 9 81060 1.11029E-4 40530 0 9.2879E-5
19-1510412-T-C p.Glu69Glu synonymous ADAMTSL5 10 80984 1.23481E-4 40492 0 1.04983E-4
19-1510422-G-T p.Pro66His missense ADAMTSL5 1 80484 1.24248E-5 40242 0 9.84795E-6
19-1510423-G-A p.Pro66Ser missense ADAMTSL5 2 80440 2.48633E-5 40220 0 9.9954E-6
19-1510630-C-G c.191+8G>C splice_region ADAMTSL5 1 74708 1.33854E-5 37354 0 NA
19-1510631-C-T c.191+7G>A splice_region ADAMTSL5 3 74724 4.01477E-5 37362 0 1.54512E-4
19-1510636-ACCGGAGGCAGCGCCGG-A p.Ser59_Leu63del splice_donor ADAMTSL5 1 74990 1.33351E-5 37495 0 NA
19-1510637-C-T c.191+1G>A splice_donor ADAMTSL5 1 75038 1.33266E-5 37519 0 NA
19-1510638-C-T p.Arg64Gln missense+splice_region ADAMTSL5 86 75088 0.00114532 37544 0 0.00178914
19-1510638-C-A p.Arg64Leu missense+splice_region ADAMTSL5 1 75090 1.33174E-5 37545 0 NA
19-1510639-G-A p.Arg64Trp missense+splice_region ADAMTSL5 5 75112 6.65673E-5 37556 0 0.00129032
19-1510645-AGCGCCGGCTGC-A p.Arg58fs frameshift ADAMTSL5 2 75324 2.6552E-5 37662 0 NA
19-1510648-GC-G p.Arg61fs frameshift ADAMTSL5 1 75418 1.32594E-5 37709 0 NA
19-1510648-G-A p.Arg61Cys missense ADAMTSL5 1 75418 1.32594E-5 37709 0 NA
19-1510649-C-T p.Arg60Arg synonymous ADAMTSL5 1 75426 1.3258E-5 37713 0 NA
19-1510650-C-T p.Arg60Gln missense ADAMTSL5 1 75484 1.32478E-5 37742 0 3.19734E-5
19-1510651-G-A p.Arg60Trp missense ADAMTSL5 10 75532 1.32394E-4 37766 1 0.00127877
19-1510651-G-C p.Arg60Gly missense ADAMTSL5 1 75532 1.32394E-5 37766 0 NA
19-1510654-T-TGC p.Ser59fs frameshift ADAMTSL5 3 75626 3.96689E-5 37813 0 9.23532E-5
19-1510656-C-T p.Arg58His missense ADAMTSL5 6 75656 7.93063E-5 37828 0 5.00129E-5
19-1510657-G-A p.Arg58Cys missense ADAMTSL5 4 75674 5.28583E-5 37837 0 6.37755E-4
19-1510657-G-T p.Arg58Ser missense ADAMTSL5 1 75674 1.32146E-5 37837 0 1.426E-5
19-1510660-CA-C p.Val57fs frameshift ADAMTSL5 1 75838 1.3186E-5 37919 0 NA
19-1510661-A-G p.Ser56Ser synonymous ADAMTSL5 63650 70158 0.907238 35079 28897 0.931418
19-1510662-GA-G p.Ser56fs frameshift ADAMTSL5 1 75968 1.31634E-5 37984 0 NA
19-1510666-C-T p.Val55Ile missense ADAMTSL5 1 76080 1.31441E-5 38040 0 7.47049E-5
19-1510667-G-A p.Gly54Gly synonymous ADAMTSL5 4 76102 5.2561E-5 38051 0 7.05119E-6
19-1510671-C-T p.Arg53His missense ADAMTSL5 7 76260 9.17912E-5 38130 0 3.51672E-5
19-1510671-C-A p.Arg53Leu missense ADAMTSL5 13 76260 1.70469E-4 38130 0 0.00201342
19-1510672-G-A p.Arg53Cys missense ADAMTSL5 3 76300 3.93185E-5 38150 0 0.00199734
19-1510675-C-T p.Gly52Arg missense ADAMTSL5 1 76402 1.30887E-5 38201 0 2.97354E-4
19-1510676-G-A p.Cys51Cys synonymous ADAMTSL5 1 76414 1.30866E-5 38207 0 1.48854E-4
19-1510689-C-T p.Cys47Tyr missense ADAMTSL5 2 76738 2.60627E-5 38369 0 NA
19-1510692-C-T p.Arg46His missense ADAMTSL5 3 76760 3.90829E-5 38380 0 3.19346E-5
19-1510694-G-C p.Thr45Thr synonymous ADAMTSL5 1 76802 1.30205E-5 38401 0 NA
19-1510695-G-A p.Thr45Ile missense ADAMTSL5 2 76816 2.60362E-5 38408 0 NA
19-1510697-C-G p.Trp44Cys missense ADAMTSL5 1 76798 1.30212E-5 38399 0 3.60231E-4
19-1510709-C-T c.-574G>A 5_prime_UTR_premature_start_codon_gain ADAMTSL5 5 76888 6.50297E-5 38444 0 6.26566E-4
19-1510710-G-A p.Pro40Leu missense ADAMTSL5 1 76854 1.30117E-5 38427 0 6.96098E-6
19-1510717-A-C p.Trp38Gly missense ADAMTSL5 2 76914 2.60031E-5 38457 0 NA
19-1510720-C-T p.Glu37Lys missense ADAMTSL5 29 76932 3.76956E-4 38466 0 5.70858E-4
19-1510721-G-A p.Gly36Gly synonymous ADAMTSL5 1284 76896 0.0166979 38448 53 0.0323261
19-1510725-G-A p.Pro35Leu missense ADAMTSL5 3 77004 3.8959E-5 38502 0 3.19428E-5
19-1510728-CCCTACTTGGGGAGACAGAGGCACGGTCAGCCTTGTAGGGGGACGCTGGTGACCCCACACTGCTGACTGGGTCCCCATTCCCACTCGCCACCCCCTGGGCTCATGCCCCCCCTTA-C p.Gly34fs frameshift ADAMTSL5 2 77072 2.59498E-5 38536 0 NA
19-1510837-C-G c.99+7G>C splice_region ADAMTSL5 1 78810 1.26887E-5 39405 0 NA
19-1510837-C-A c.99+7G>T splice_region ADAMTSL5 3 78810 3.80662E-5 39405 0 3.24465E-5
19-1510838-C-G c.99+6G>C splice_region ADAMTSL5 1 78800 1.26904E-5 39400 0 3.23457E-5
19-1510839-C-G c.99+5G>C splice_region ADAMTSL5 1 78796 1.2691E-5 39398 0 5.68376E-6
19-1510839-C-T c.99+5G>A splice_region ADAMTSL5 2 78796 2.5382E-5 39398 0 1.61734E-5
19-1510846-G-T p.Gln33Lys missense+splice_region ADAMTSL5 1 78788 1.26923E-5 39394 0 NA
19-1510854-A-G p.Val30Ala missense ADAMTSL5 17 78710 2.15983E-4 39355 0 1.74233E-4
19-1510873-G-A c.-627C>T 5_prime_UTR_premature_start_codon_gain ADAMTSL5 1 78696 1.27071E-5 39348 0 3.18898E-5
19-1510874-C-T p.Leu23Leu synonymous ADAMTSL5 1 78688 1.27084E-5 39344 0 1.68731E-5
19-1510885-G-A c.-639C>T 5_prime_UTR_premature_start_codon_gain ADAMTSL5 1 78520 1.27356E-5 39260 0 NA
19-1510892-C-G p.Leu17Leu synonymous ADAMTSL5 2 78476 2.54855E-5 39238 0 NA
19-1510906-A-G p.Phe13Leu missense ADAMTSL5 1 78234 1.27822E-5 39117 0 8.42417E-6
19-1510911-TGGGGCCTGGGG-T p.Phe7fs frameshift ADAMTSL5 4 78074 5.12334E-5 39037 0 2.08829E-5
19-1510911-T-C p.His11Arg missense ADAMTSL5 3 78074 3.84251E-5 39037 0 2.42542E-4
19-1510917-CTGGGGAACAGAGG-C p.Pro5fs frameshift ADAMTSL5 1 78046 1.2813E-5 39023 0 NA
19-1510923-AACAGAGGGGCC-A p.Ala4fs frameshift ADAMTSL5 4 77682 5.1492E-5 38841 0 1.29089E-5
19-1510925-C-T p.Leu6Leu synonymous ADAMTSL5 1 77680 1.28733E-5 38840 0 NA
19-1510933-C-T p.Ala4Thr missense ADAMTSL5 3 77334 3.87928E-5 38667 0 NA
19-1510934-C-T p.Ser3Ser synonymous ADAMTSL5 18 77212 2.33124E-4 38606 0 0.00125
19-1510935-G-A p.Ser3Leu missense ADAMTSL5 1 77320 1.29333E-5 38660 0 6.64364E-5
19-1510936-A-G p.Ser3Pro missense ADAMTSL5 1 77226 1.2949E-5 38613 0 NA
19-1510976-G-A c.-34C>T 5_prime_UTR_premature_start_codon_gain ADAMTSL5 5 73978 6.75877E-5 36989 0 NA
19-1511008-A-C c.-66T>G 5_prime_UTR_premature_start_codon_gain ADAMTSL5 3 66386 4.51903E-5 33193 0 NA
19-1511029-C-T n.101+6G>A splice_region ADAMTSL5 3 56686 5.29231E-5 28343 0 1.27478E-4
19-1511035-C-T n.101G>A splice_region ADAMTSL5 2 53798 3.71761E-5 26899 0 NA
19-1511072-T-C n.61+3A>G splice_region ADAMTSL5 1 40428 2.47353E-5 20214 0 NA
19-1511159-T-TCGG c.-217-1_-217insCCG splice_acceptor ADAMTSL5 1 13888 7.20046E-5 6944 0 NA
19-1511163-C-T c.-217-4G>A splice_region ADAMTSL5 1 12874 7.76759E-5 6437 0 NA
19-1511616-G-A c.56+8C>T splice_region ADAMTSL5 1 34216 2.92261E-5 17108 0 0.00114181
19-1511617-C-T c.56+7G>A splice_region ADAMTSL5 1 34198 2.92415E-5 17099 0 NA
19-1511623-C-T c.56+1G>A splice_donor ADAMTSL5 1 34116 2.93118E-5 17058 0 7.06558E-5
19-1511629-C-T p.Thr17Thr synonymous ADAMTSL5 2 34100 5.8651E-5 17050 0 5.25541E-4
19-1511630-G-A p.Thr17Met missense ADAMTSL5 26 33950 7.65832E-4 16975 0 0.00156838
19-1511648-C-T p.Trp11* stop_gained ADAMTSL5 1 33886 2.95107E-5 16943 0 7.04303E-5
19-1511679-T-C p.Met1? start_lost ADAMTSL5 1 35072 2.85128E-5 17536 0 NA
19-1511727-CTGCGGA-C n.137-7_137-2delTCCGCA splice_acceptor ADAMTSL5 1 36718 2.72346E-5 18359 0 NA
19-1511730-C-T n.137-4G>A splice_region ADAMTSL5 1 36234 2.75984E-5 18117 0 6.37146E-5
19-1511772-C-T n.58-1G>A splice_acceptor ADAMTSL5 4 35322 1.13244E-4 17661 0 NA
19-1512963-G-A c.-219C>T 5_prime_UTR_premature_start_codon_gain ADAMTSL5 251 2052 0.12232 1026 5 0.12484
19-1513066-G-A c.-322C>T 5_prime_UTR_premature_start_codon_gain ADAMTSL5 1 126 0.00793651 63 0 4.22709E-4