Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-150522313-C-T c.-143C>T 5_prime_UTR_premature_start_codon_gain ADAMTSL4 17 5488 0.00309767 2744 0 0.0125279
1-150523084-C-T n.535-7C>T splice_region ADAMTSL4 2 51306 3.89818E-5 25653 0 NA
1-150523091-C-T n.535C>T splice_region ADAMTSL4 2 51320 3.89712E-5 25660 0 3.18695E-5
1-150524611-C-G c.-154C>G 5_prime_UTR_premature_start_codon_gain ADAMTSL4 2 76320 2.62055E-5 38160 0 NA
1-150524694-C-T c.-71C>T 5_prime_UTR_premature_start_codon_gain ADAMTSL4 4 79822 5.01115E-5 39911 0 NA
1-150524774-T-C p.Trp4Arg missense ADAMTSL4 1 80038 1.24941E-5 40019 0 6.14137E-6
1-150524788-A-G c.20+4A>G splice_region ADAMTSL4 2 79576 2.51332E-5 39788 0 0.00423004
1-150525024-G-C p.Trp9Ser missense ADAMTSL4 1 82276 1.21542E-5 41138 0 3.19163E-5
1-150525028-G-GT p.Tyr11fs frameshift ADAMTSL4 1 82240 1.21595E-5 41120 0 NA
1-150525034-G-C p.Leu12Leu synonymous ADAMTSL4 1 82204 1.21649E-5 41102 0 NA
1-150525053-C-T p.Pro19Ser missense ADAMTSL4 14 82208 1.703E-4 41104 0 8.35981E-5
1-150525076-G-A p.Glu26Glu splice_region+synonymous ADAMTSL4 1 81982 1.21978E-5 40991 0 3.5536E-5
1-150525382-C-T p.Ser29Ser synonymous ADAMTSL4 2 80854 2.47359E-5 40427 0 1.21378E-4
1-150525383-G-A p.Gly30Arg missense ADAMTSL4 5 80854 6.18399E-5 40427 0 2.8506E-5
1-150525387-A-G p.His31Arg missense ADAMTSL4 2 80924 2.47145E-5 40462 0 NA
1-150525390-C-CT p.Leu33fs frameshift ADAMTSL4 1 81004 1.23451E-5 40502 0 4.06342E-6
1-150525403-T-A p.Pro36Pro synonymous ADAMTSL4 2 81174 2.46384E-5 40587 0 8.1082E-6
1-150525412-G-A p.Glu39Glu synonymous ADAMTSL4 1 81322 1.22968E-5 40661 0 1.72429E-5
1-150525417-A-G p.Gln41Arg missense ADAMTSL4 1 81424 1.22814E-5 40712 0 8.61831E-6
1-150525425-G-A p.Glu44Lys missense ADAMTSL4 3501 81492 0.0429613 40746 91 0.0306633
1-150525457-C-T p.Ala54Ala synonymous ADAMTSL4 28 82292 3.40252E-4 41146 0 5.03525E-4
1-150525476-G-A p.Gly61Arg missense ADAMTSL4 1 82260 1.21566E-5 41130 0 4.43087E-5
1-150525478-G-A p.Gly61Gly synonymous ADAMTSL4 1 82242 1.21592E-5 41121 0 6.38325E-5
1-150525485-G-A p.Val64Met missense ADAMTSL4 3 82294 3.64547E-5 41147 0 2.56445E-5
1-150525491-C-T p.Arg66Cys missense ADAMTSL4 10 82250 1.21581E-4 41125 0 1.59724E-4
1-150525492-G-A p.Arg66His missense ADAMTSL4 2 82242 2.43185E-5 41121 0 1.70984E-5
1-150525520-A-G p.Thr75Thr synonymous ADAMTSL4 1 81962 1.22008E-5 40981 0 4.01807E-6
1-150525521-G-A p.Val76Met missense ADAMTSL4 2 81930 2.44111E-5 40965 0 NA
1-150525522-T-G p.Val76Gly missense ADAMTSL4 1 81884 1.22124E-5 40942 0 NA
1-150525527-C-T p.Leu78Phe missense ADAMTSL4 41 81692 5.01885E-4 40846 0 0.00813517
1-150525529-C-T p.Leu78Leu synonymous ADAMTSL4 1 81620 1.22519E-5 40810 0 NA
1-150525532-C-A p.His79Gln missense ADAMTSL4 1 81530 1.22654E-5 40765 0 6.39182E-5
1-150525534-C-T p.Pro80Leu missense ADAMTSL4 4 81440 4.91159E-5 40720 0 4.26964E-5
1-150525535-G-A p.Pro80Pro synonymous ADAMTSL4 1 81404 1.22844E-5 40702 0 1.70666E-5
1-150525537-G-A p.Ser81Asn missense ADAMTSL4 1 81386 1.22871E-5 40693 0 NA
1-150525544-C-T p.Pro83Pro synonymous ADAMTSL4 4 81224 4.92465E-5 40612 0 3.1957E-5
1-150525547-C-T p.Leu84Leu synonymous ADAMTSL4 1 81188 1.23171E-5 40594 0 NA
1-150525554-C-T p.Arg87Trp missense ADAMTSL4 2 81056 2.46743E-5 40528 0 1.21132E-5
1-150525555-G-A p.Arg87Gln missense ADAMTSL4 9 80860 1.11303E-4 40430 0 1.85799E-4
1-150525575-G-C p.Ala94Pro missense ADAMTSL4 1 80822 1.23729E-5 40411 0 1.21179E-5
1-150525583-C-T p.Leu96Leu synonymous ADAMTSL4 47 80770 5.81899E-4 40385 0 7.66675E-4
1-150525587-C-T p.Arg98Trp missense ADAMTSL4 110 80710 0.0013629 40355 1 0.00130832
1-150525588-G-A p.Arg98Gln missense ADAMTSL4 4 80636 4.96056E-5 40318 0 1.60328E-4
1-150525591-G-A p.Gly99Asp missense ADAMTSL4 3 80728 3.71618E-5 40364 0 3.1953E-5
1-150525601-C-G p.Pro102Pro synonymous ADAMTSL4 1 80812 1.23744E-5 40406 0 NA
1-150525607-C-G p.Pro104Pro synonymous ADAMTSL4 1 80844 1.23695E-5 40422 0 NA
1-150525643-A-T p.Thr116Thr synonymous ADAMTSL4 1 80832 1.23713E-5 40416 0 NA
1-150525644-CA-C p.Gln117fs frameshift ADAMTSL4 1 80852 1.23683E-5 40426 0 8.61475E-6
1-150525647-T-C p.Ser118Pro missense ADAMTSL4 1 80726 1.23876E-5 40363 0 8.61816E-6
1-150525650-C-T p.Arg119Trp missense ADAMTSL4 6 80668 7.43789E-5 40334 0 1.20858E-4
1-150525658-G-A p.Arg121Arg synonymous ADAMTSL4 3 80730 3.71609E-5 40365 0 6.37633E-5
1-150525672-G-A p.Arg126Gln missense ADAMTSL4 2 80604 2.48127E-5 40302 0 3.18939E-5
1-150525677-C-T p.Pro128Ser missense ADAMTSL4 27 80572 3.35104E-4 40286 0 6.06138E-4
1-150525679-C-T p.Pro128Pro synonymous ADAMTSL4 2 80576 2.48213E-5 40288 0 3.18898E-5
1-150525680-G-A p.Ala129Thr missense ADAMTSL4 2 80526 2.48367E-5 40263 0 2.08946E-5
1-150525684-C-T p.Ser130Phe missense ADAMTSL4 1 80540 1.24162E-5 40270 0 NA
1-150525699-AG-A p.Glu136fs frameshift ADAMTSL4 1 80584 1.24094E-5 40292 0 NA
1-150525700-G-A p.Glu135Glu synonymous ADAMTSL4 1 80572 1.24113E-5 40286 0 NA
1-150525717-G-A p.Arg141Gln missense ADAMTSL4 1 80302 1.2453E-5 40151 0 1.66077E-5
1-150525720-C-T p.Ala142Val missense ADAMTSL4 1 80230 1.24642E-5 40115 0 7.90569E-5
1-150525720-C-G p.Ala142Gly missense ADAMTSL4 1 80230 1.24642E-5 40115 0 4.15275E-6
1-150525721-G-A p.Ala142Ala synonymous ADAMTSL4 4 80256 4.98405E-5 40128 0 4.3855E-5
1-150525721-G-C p.Ala142Ala synonymous ADAMTSL4 1 80256 1.24601E-5 40128 0 NA
1-150525733-A-G c.434+4A>G splice_region ADAMTSL4 3 80272 3.73729E-5 40136 0 1.76081E-5
1-150525906-C-G p.Arg147Gly missense ADAMTSL4 2 82766 2.41645E-5 41383 0 NA
1-150525906-C-T p.Arg147Trp missense ADAMTSL4 2 82766 2.41645E-5 41383 0 1.9941E-5
1-150525907-G-A p.Arg147Gln missense ADAMTSL4 39 82796 4.71037E-4 41398 0 0.003125
1-150525913-G-A p.Arg149Gln missense ADAMTSL4 13 82952 1.56717E-4 41476 0 5.17986E-5
1-150525922-T-A p.Ile152Asn missense ADAMTSL4 4 83066 4.81545E-5 41533 0 9.58405E-5
1-150525922-T-C p.Ile152Thr missense ADAMTSL4 2 83066 2.40772E-5 41533 0 3.98086E-6
1-150525927-C-A p.Pro154Thr missense ADAMTSL4 9 83104 1.08298E-4 41552 0 3.19366E-5
1-150525933-A-G p.Met156Val missense ADAMTSL4 1 83198 1.20195E-5 41599 0 NA
1-150525935-G-A p.Met156Ile missense ADAMTSL4 9 83196 1.08178E-4 41598 0 2.55722E-4
1-150525939-G-A p.Gly158Ser missense ADAMTSL4 3 83190 3.6062E-5 41595 0 1.19348E-5
1-150525942-T-C p.Tyr159His missense ADAMTSL4 1 83206 1.20184E-5 41603 0 2.47194E-5
1-150525954-C-A p.Pro163Thr missense ADAMTSL4 1 83252 1.20117E-5 41626 0 NA
1-150525954-C-G p.Pro163Ala missense ADAMTSL4 1 83252 1.20117E-5 41626 0 NA
1-150525974-C-G p.His169Gln missense ADAMTSL4 2 83244 2.40258E-5 41622 0 0.00100705
1-150525975-C-T p.Arg170Trp missense ADAMTSL4 1 83248 1.20123E-5 41624 0 6.25E-4
1-150525976-G-A p.Arg170Gln missense ADAMTSL4 4 83252 4.80469E-5 41626 0 1.27885E-4
1-150525981-C-T p.Arg172Cys missense ADAMTSL4 4 83246 4.80504E-5 41623 0 1.27853E-4
1-150525982-G-A p.Arg172His missense ADAMTSL4 2 83242 2.40263E-5 41621 0 6.59076E-5
1-150525994-G-A p.Arg176Gln missense ADAMTSL4 2 83244 2.40258E-5 41622 0 8.23805E-6
1-150525998-C-T p.Ser177Ser synonymous ADAMTSL4 7 83210 8.41245E-5 41605 0 2.14189E-4
1-150526019-C-T p.Ser184Ser synonymous ADAMTSL4 2 83244 2.40258E-5 41622 0 3.97655E-6
1-150526025-C-A p.Ile186Ile synonymous ADAMTSL4 1 83246 1.20126E-5 41623 0 NA
1-150526035-G-C p.Gly190Arg missense ADAMTSL4 1 83234 1.20143E-5 41617 0 NA
1-150526035-G-A p.Gly190Arg missense ADAMTSL4 1 83234 1.20143E-5 41617 0 3.19734E-5
1-150526042-AGG-CGC p.GluAla192AlaPro missense ADAMTSL4 1 83224 1.20158E-5 41612 0 NA
1-150526042-A-C p.Glu192Ala missense ADAMTSL4 2 83224 2.40315E-5 41612 0 6.25E-4
1-150526044-G-C p.Ala193Pro missense ADAMTSL4 41697 82712 0.504123 41356 10658 0.550917
1-150526051-C-T p.Pro195Leu missense ADAMTSL4 90 83226 0.00108139 41613 0 0.00185493
1-150526058-T-C p.Pro197Pro synonymous ADAMTSL4 1 83254 1.20114E-5 41627 0 NA
1-150526062-C-T p.Pro199Ser missense ADAMTSL4 1 83256 1.20111E-5 41628 0 9.0617E-5
1-150526063-C-T p.Pro199Leu missense ADAMTSL4 1 83252 1.20117E-5 41626 0 NA
1-150526071-G-C p.Glu202Gln missense ADAMTSL4 1 83254 1.20114E-5 41627 0 7.95323E-6
1-150526082-C-T p.Ser205Ser synonymous ADAMTSL4 20 83256 2.40223E-4 41628 0 1.15344E-4
1-150526083-G-A p.Ala206Thr missense ADAMTSL4 1 83240 1.20135E-5 41620 0 2.4717E-5
1-150526088-C-T p.Asn207Asn synonymous ADAMTSL4 6 83252 7.20703E-5 41626 0 9.59386E-5
1-150526089-G-A p.Gly208Ser missense ADAMTSL4 123 83236 0.00147773 41618 0 0.00365057
1-150526102-C-A p.Thr212Asn missense ADAMTSL4 2 83240 2.40269E-5 41620 0 3.19734E-5
1-150526110-C-T p.Pro215Ser missense ADAMTSL4 19 83218 2.28316E-4 41609 0 NA
1-150526118-A-G p.Thr217Thr synonymous ADAMTSL4 5 83210 6.00889E-5 41605 0 1.19312E-5
1-150526122-CTG-C p.Ser220fs frameshift ADAMTSL4 1 83212 1.20175E-5 41606 0 NA
1-150526134-A-T p.Thr223Ser missense ADAMTSL4 23 83134 2.76662E-4 41567 0 0.00100705
1-150526138-C-T p.Pro224Leu missense ADAMTSL4 2 83160 2.405E-5 41580 0 7.9576E-6
1-150526145-C-G p.Pro226Pro synonymous ADAMTSL4 1 83094 1.20346E-5 41547 0 6.59652E-5
1-150526146-C-A p.Gln227Lys missense ADAMTSL4 6 83086 7.22143E-5 41543 0 4.94731E-5
1-150526146-C-CA p.Ala228fs frameshift ADAMTSL4 1 83088 1.20354E-5 41544 0 NA
1-150526148-A-G p.Gln227Gln synonymous ADAMTSL4 1 83048 1.20412E-5 41524 0 3.26499E-5
1-150526163-C-A p.Ser232Arg missense ADAMTSL4 4 83012 4.81858E-5 41506 0 3.21937E-5
1-150526167-G-A p.Glu234Lys missense ADAMTSL4 3 82988 3.61498E-5 41494 0 3.9833E-6
1-150526182-G-C p.Glu239Gln missense ADAMTSL4 1 82912 1.2061E-5 41456 0 3.98552E-6
1-150526203-C-A p.Pro246Thr missense ADAMTSL4 1 82768 1.2082E-5 41384 0 3.98718E-6
1-150526210-C-T p.Pro248Leu missense ADAMTSL4 2 82774 2.41622E-5 41387 0 3.98654E-6
1-150526210-C-A p.Pro248His missense ADAMTSL4 1 82774 1.20811E-5 41387 0 8.26214E-6
1-150526211-C-T p.Pro248Pro synonymous ADAMTSL4 1 82778 1.20805E-5 41389 0 4.13134E-5
1-150526211-C-G p.Pro248Pro synonymous ADAMTSL4 2 82778 2.4161E-5 41389 0 1.19612E-5
1-150526215-C-T p.Arg250Trp missense ADAMTSL4 3 82728 3.62634E-5 41364 0 8.2631E-5
1-150526216-G-A p.Arg250Gln missense ADAMTSL4 54 82718 6.5282E-4 41359 0 0.00125
1-150526216-G-T p.Arg250Leu missense ADAMTSL4 1 82722 1.20887E-5 41361 0 NA
1-150526221-C-A p.His252Asn missense ADAMTSL4 9 82760 1.08748E-4 41380 0 4.48948E-4
1-150526223-C-T p.His252His synonymous ADAMTSL4 1 82748 1.20849E-5 41374 0 NA
1-150526225-CCAGAGCCCAGGCCTCTGGCA-C p.Gln256fs frameshift ADAMTSL4 107 82764 0.00129283 41382 0 0.00141308
1-150526231-C-T p.Ala255Val missense ADAMTSL4 9 82742 1.08772E-4 41371 0 6.62811E-5
1-150526246-C-G p.Thr260Arg missense ADAMTSL4 1 82728 1.20878E-5 41364 0 NA
1-150526255-C-T p.Pro263Leu missense ADAMTSL4 6 82754 7.2504E-5 41377 0 6.38651E-5
1-150526261-C-T p.Pro265Leu missense ADAMTSL4 2 82776 2.41616E-5 41388 0 3.19305E-5
1-150526264-C-T p.Thr266Met missense ADAMTSL4 1 82782 1.20799E-5 41391 0 5.03525E-4
1-150526265-G-A p.Thr266Thr synonymous ADAMTSL4 3 82746 3.62555E-5 41373 0 2.78611E-5
1-150526270-C-T p.Ser268Phe missense ADAMTSL4 931 82798 0.0112442 41399 9 0.010574
1-150526271-C-A p.Ser268Ser synonymous ADAMTSL4 2 82844 2.41418E-5 41422 0 NA
1-150526282-G-A p.Gly272Asp missense ADAMTSL4 2 82848 2.41406E-5 41424 0 NA
1-150526288-T-G p.Phe274Cys missense ADAMTSL4 2 82886 2.41295E-5 41443 0 3.97985E-6
1-150526293-C-T p.Arg276Cys missense ADAMTSL4 3 82832 3.62179E-5 41416 0 8.28007E-6
1-150526294-G-A p.Arg276His missense ADAMTSL4 8 82842 9.65694E-5 41421 0 9.57732E-5
1-150526312-G-A p.Arg282Gln missense ADAMTSL4 4 82834 4.82893E-5 41417 1 7.9628E-6
1-150526347-G-C p.Val294Leu missense ADAMTSL4 2 82640 2.42014E-5 41320 0 2.50606E-5
1-150526359-C-T p.Arg298Cys missense ADAMTSL4 1 82494 1.21221E-5 41247 0 1.63756E-4
1-150526376-T-C p.Pro303Pro synonymous ADAMTSL4 2 82326 2.42937E-5 41163 0 3.18979E-5
1-150526378-C-T p.Ser304Leu missense ADAMTSL4 1 82222 1.21622E-5 41111 0 6.25782E-4
1-150526379-G-C p.Ser304Ser synonymous ADAMTSL4 4 82224 4.86476E-5 41112 0 5.03525E-4
1-150526383-C-T p.Pro306Ser missense ADAMTSL4 4 82208 4.86571E-5 41104 0 3.19101E-5
1-150526387-G-A p.Arg307Gln missense ADAMTSL4 44 82122 5.35788E-4 41061 0 0.00250313
1-150526392-C-T p.Arg309* stop_gained ADAMTSL4 1 82034 1.21901E-5 41017 0 NA
1-150526393-G-A p.Arg309Gln missense ADAMTSL4 960 81982 0.0117099 40991 58 0.0314441
1-150526395-G-A p.Gly310Ser missense ADAMTSL4 1 82072 1.21844E-5 41036 0 4.16413E-6
1-150526396-G-A p.Gly310Asp missense ADAMTSL4 1 82022 1.21919E-5 41011 0 NA
1-150526403-G-A p.Gln312Gln synonymous ADAMTSL4 1 82068 1.2185E-5 41034 0 4.16983E-6
1-150526406-C-T p.Gly313Gly synonymous ADAMTSL4 24857 81180 0.306196 40590 4190 0.349533
1-150526406-C-G p.Gly313Gly synonymous ADAMTSL4 44 81992 5.36638E-4 40996 1 0.00147172
1-150526417-G-A p.Trp317* stop_gained ADAMTSL4 1 81972 1.21993E-5 40986 0 NA
1-150526420-G-T p.Gly318Val missense ADAMTSL4 1 81918 1.22073E-5 40959 0 NA
1-150526423-C-T p.Thr319Met missense ADAMTSL4 4 81828 4.8883E-5 40914 0 7.26359E-5
1-150526423-C-CG p.Thr322fs frameshift ADAMTSL4 4 81826 4.88842E-5 40913 0 6.38978E-5
1-150526423-CG-C p.Thr322fs frameshift ADAMTSL4 1 81830 1.22205E-5 40915 0 1.28181E-5
1-150526424-G-A p.Thr319Thr synonymous ADAMTSL4 2 81830 2.44409E-5 40915 0 6.27353E-4
1-150526424-G-C p.Thr319Thr synonymous ADAMTSL4 1 81830 1.22205E-5 40915 0 3.02042E-5
1-150526427-G-A p.Gly320Gly synonymous ADAMTSL4 1 81820 1.2222E-5 40910 0 6.28141E-4
1-150526430-G-A p.Gly321Gly synonymous ADAMTSL4 3 81716 3.67125E-5 40858 0 1.89055E-4
1-150526439-C-T p.His324His synonymous ADAMTSL4 4 81642 4.89944E-5 40821 0 9.05633E-5
1-150526446-C-T p.Arg327Cys missense ADAMTSL4 16 81648 1.95963E-4 40824 0 6.30517E-4
1-150526447-G-A p.Arg327His missense ADAMTSL4 2 81570 2.45188E-5 40785 1 6.02845E-5
1-150526459-A-G p.Asp331Gly missense ADAMTSL4 1 81616 1.22525E-5 40808 0 7.94392E-5
1-150526465-A-G p.Gln333Arg missense ADAMTSL4 1 81674 1.22438E-5 40837 0 1.97223E-5
1-150526471-C-T p.Pro335Leu missense ADAMTSL4 6 81610 7.35204E-5 40805 0 0.00188917
1-150526472-G-A p.Pro335Pro synonymous ADAMTSL4 3 81610 3.67602E-5 40805 0 6.28931E-4
1-150526473-G-C p.Gly336Arg missense ADAMTSL4 1 81568 1.22597E-5 40784 0 4.15666E-6
1-150526474-G-A p.Gly336Asp missense ADAMTSL4 281 81506 0.0034476 40753 7 0.00553877
1-150526475-C-T p.Gly336Gly synonymous ADAMTSL4 5 81526 6.13301E-5 40763 0 1.28913E-4
1-150526476-G-A p.Ala337Thr missense ADAMTSL4 15 81542 1.83954E-4 40771 0 1.12085E-4
1-150526477-C-T p.Ala337Val missense ADAMTSL4 4 81566 4.904E-5 40783 0 6.38244E-5
1-150526478-C-T p.Ala337Ala synonymous ADAMTSL4 7 81616 8.57675E-5 40808 0 6.37999E-5
1-150526484-G-T p.Leu339Leu synonymous ADAMTSL4 1 81592 1.22561E-5 40796 0 NA
1-150526499-C-T p.Asn344Asn synonymous ADAMTSL4 28 81572 3.43255E-4 40786 1 2.52104E-4
1-150526500-G-A p.Gly345Ser missense ADAMTSL4 8 81538 9.81138E-5 40769 0 1.03321E-4
1-150526507-A-G p.His347Arg missense ADAMTSL4 5 81522 6.13331E-5 40761 0 3.19142E-5
1-150526527-C-T p.Leu354Phe missense ADAMTSL4 1 81406 1.22841E-5 40703 0 1.27567E-4
1-150526535-T-C p.Ala356Ala synonymous ADAMTSL4 5 81354 6.14598E-5 40677 0 7.96714E-5
1-150526537-C-T p.Pro357Leu missense ADAMTSL4 2 81364 2.45809E-5 40682 0 8.84783E-6
1-150526565-G-A p.Gly366Gly synonymous ADAMTSL4 322 81304 0.00396044 40652 5 0.00903107
1-150526572-G-A p.Glu369Lys missense ADAMTSL4 1 81300 1.23001E-5 40650 0 4.27219E-6
1-150526585-C-A p.Ala373Asp missense ADAMTSL4 2 81236 2.46196E-5 40618 0 6.37877E-5
1-150526592-C-T p.Ser375Ser synonymous ADAMTSL4 1 81200 1.23153E-5 40600 0 NA
1-150526597-C-T p.Ala377Val missense+splice_region ADAMTSL4 1 81130 1.23259E-5 40565 0 4.2889E-6
1-150526597-C-A p.Ala377Glu missense+splice_region ADAMTSL4 6 81130 7.39554E-5 40565 0 6.86224E-5
1-150526598-G-A p.Ala377Ala splice_region+synonymous ADAMTSL4 1 81122 1.23271E-5 40561 0 1.28652E-5
1-150526598-G-C p.Ala377Ala splice_region+synonymous ADAMTSL4 2 81122 2.46542E-5 40561 0 NA
1-150526837-G-A c.1132-4G>A splice_region ADAMTSL4 8 82220 9.72999E-5 41110 0 6.39141E-5
1-150526845-G-T p.Cys379Phe missense ADAMTSL4 1 82442 1.21297E-5 41221 0 NA
1-150526850-CCT-C p.Pro381fs frameshift ADAMTSL4 1 82532 1.21165E-5 41266 0 NA
1-150526850-C-G p.Pro381Ala missense ADAMTSL4 1 82532 1.21165E-5 41266 0 1.24386E-4
1-150526850-C-A p.Pro381Thr missense ADAMTSL4 3 82532 3.63495E-5 41266 0 3.18634E-5
1-150526851-C-G p.Pro381Arg missense ADAMTSL4 14 82550 1.69594E-4 41275 0 4.7789E-4
1-150526851-CT-C p.Glu382fs frameshift ADAMTSL4 1 82550 1.21139E-5 41275 0 NA
1-150526860-C-A p.Pro384Gln missense ADAMTSL4 1 82682 1.20945E-5 41341 0 8.2861E-6
1-150526865-C-A p.Pro386Thr missense ADAMTSL4 1 82748 1.20849E-5 41374 0 NA
1-150526866-C-T p.Pro386Leu missense ADAMTSL4 1 82748 1.20849E-5 41374 0 NA
1-150526869-G-C p.Arg387Pro missense ADAMTSL4 1 82712 1.20901E-5 41356 0 NA
1-150526872-C-T p.Ala388Val missense ADAMTSL4 1 82760 1.20831E-5 41380 0 6.37267E-5
1-150526882-C-T p.Cys391Cys synonymous ADAMTSL4 1 82814 1.20753E-5 41407 0 3.18715E-5
1-150526883-G-A p.Ala392Thr missense ADAMTSL4 2 82824 2.41476E-5 41412 0 3.30502E-5
1-150526884-C-T p.Ala392Val missense ADAMTSL4 4 82852 4.82789E-5 41426 0 0.00100806
1-150526886-G-C p.Ala393Pro missense ADAMTSL4 3 82850 3.621E-5 41425 0 8.26228E-6
1-150526888-C-T p.Ala393Ala synonymous ADAMTSL4 4 82850 4.828E-5 41425 0 3.89901E-4
1-150526896-C-T p.Ser396Phe missense ADAMTSL4 1 82872 1.20668E-5 41436 0 8.26323E-6
1-150526917-T-A p.Leu403Gln missense ADAMTSL4 1 82874 1.20665E-5 41437 0 NA
1-150526918-G-C p.Leu403Leu synonymous ADAMTSL4 2 82868 2.41348E-5 41434 0 NA
1-150526931-C-T p.Pro408Ser missense ADAMTSL4 1 82740 1.20861E-5 41370 0 NA
1-150526946-G-A c.1234+3G>A splice_region ADAMTSL4 2 82698 2.41844E-5 41349 0 3.98498E-6
1-150526949-G-C c.1234+6G>C splice_region ADAMTSL4 2 82668 2.41932E-5 41334 0 3.18634E-5
1-150527053-C-G p.Pro416Ala missense ADAMTSL4 8 80268 9.96661E-5 40134 0 4.42439E-5
1-150527059-C-T p.Arg418Cys missense ADAMTSL4 42 80098 5.24358E-4 40049 0 0.00143358
1-150527060-G-A p.Arg418His missense ADAMTSL4 40 80080 4.995E-4 40040 0 0.00149777
1-150527060-G-T p.Arg418Leu missense ADAMTSL4 2 80082 2.49744E-5 40041 0 6.41272E-6
1-150527066-C-G p.Ala420Gly missense ADAMTSL4 1 79980 1.25031E-5 39990 0 1.29843E-5
1-150527067-CTTCT-C p.Leu423fs frameshift ADAMTSL4 1 80002 1.24997E-5 40001 0 6.5362E-6
1-150527101-A-T p.Ser432Cys missense ADAMTSL4 1 79596 1.25634E-5 39798 0 6.88553E-6
1-150527109-T-C p.Gly434Gly splice_region+synonymous ADAMTSL4 1520 79324 0.0191619 39662 62 0.0398975
1-150527110-G-T p.Val435Phe missense+splice_region ADAMTSL4 15 79450 1.88798E-4 39725 0 4.88016E-5
1-150527113-G-A c.1303+3G>A splice_region ADAMTSL4 1 79410 1.25929E-5 39705 0 6.62339E-5
1-150527900-C-T c.1235-5C>T splice_region ADAMTSL4 3 82480 3.63725E-5 41240 0 3.3437E-5
1-150527902-T-TA c.1235-3_1235-2insA splice_acceptor ADAMTSL4 1 82472 1.21253E-5 41236 0 NA
1-150527904-G-A c.1235-1G>A splice_acceptor ADAMTSL4 1 82528 1.21171E-5 41264 0 NA
1-150527919-C-T p.Arg417Cys missense ADAMTSL4 4 82746 4.83407E-5 41373 0 5.97962E-5
1-150527920-G-A p.Arg417His missense ADAMTSL4 3 82790 3.62363E-5 41395 0 4.78267E-5
1-150527935-G-A p.Cys422Tyr missense ADAMTSL4 2 82920 2.41196E-5 41460 0 1.59439E-4
1-150527937-C-T p.Arg423Trp missense ADAMTSL4 1 82918 1.20601E-5 41459 0 1.66381E-5
1-150527938-G-A p.Arg423Gln missense ADAMTSL4 8 82940 9.64553E-5 41470 0 0.00100806
1-150527942-C-A p.Pro424Pro synonymous ADAMTSL4 2 82928 2.41173E-5 41464 0 NA
1-150527944-G-A p.Arg425His missense ADAMTSL4 2 82952 2.41103E-5 41476 0 3.98314E-6
1-150527953-G-A p.Arg428His missense ADAMTSL4 24 83000 2.89157E-4 41500 0 5.41643E-4
1-150527957-C-T p.Phe429Phe synonymous ADAMTSL4 2 83018 2.40912E-5 41509 0 NA
1-150527965-G-A p.Arg432His missense ADAMTSL4 2 83010 2.40935E-5 41505 0 1.65854E-5
1-150527970-A-G p.Thr434Ala missense ADAMTSL4 2 82998 2.4097E-5 41499 0 NA
1-150527971-C-T p.Thr434Ile missense ADAMTSL4 2 82994 2.40981E-5 41497 0 1.19424E-5
1-150527975-AAA-CAG p.GluLys435AspArg missense ADAMTSL4 1 83002 1.20479E-5 41501 0 NA
1-150527978-G-A p.Lys436Lys synonymous ADAMTSL4 2 82988 2.40999E-5 41494 0 3.50316E-4
1-150528002-G-A p.Gln444Gln synonymous ADAMTSL4 2 82820 2.41488E-5 41410 0 2.23851E-4
1-150528007-G-A p.Gly446Glu missense ADAMTSL4 1 82782 1.20799E-5 41391 0 NA
1-150528017-C-T p.Asp449Asp synonymous ADAMTSL4 1 82688 1.20937E-5 41344 0 8.29641E-6
1-150528018-A-G p.Ile450Val missense ADAMTSL4 2 82662 2.41949E-5 41331 0 NA
1-150528020-CTG-C p.Val452fs frameshift ADAMTSL4 2 82616 2.42084E-5 41308 0 8.29862E-6
1-150528034-G-A p.Arg455His missense ADAMTSL4 2 82108 2.43582E-5 41054 0 5.58632E-5
1-150528041-G-A p.Leu457Leu splice_region+synonymous ADAMTSL4 1 81810 1.22234E-5 40905 0 3.99466E-6
1-150528043-T-C c.1371+2T>C splice_donor ADAMTSL4 1 81714 1.22378E-5 40857 0 8.31753E-6
1-150528631-T-G c.1372-7T>G splice_region ADAMTSL4 1 80152 1.24763E-5 40076 0 NA
1-150528635-C-T c.1372-3C>T splice_region ADAMTSL4 2 80190 2.49408E-5 40095 0 1.6518E-5
1-150528639-G-C p.Ser458Thr missense+splice_region ADAMTSL4 1 80236 1.24632E-5 40118 0 NA
1-150528640-C-T p.Ser458Ser splice_region+synonymous ADAMTSL4 1 80232 1.24639E-5 40116 0 NA
1-150528643-C-T p.Pro459Pro synonymous ADAMTSL4 1 80258 1.24598E-5 40129 0 9.55597E-5
1-150528645-G-A p.Gly460Asp missense ADAMTSL4 1 80278 1.24567E-5 40139 0 1.65071E-5
1-150528659-C-T p.Leu465Phe missense ADAMTSL4 1 80404 1.24372E-5 40202 0 NA
1-150528662-G-C p.Gly466Arg missense ADAMTSL4 2 80424 2.48682E-5 40212 0 3.05215E-4
1-150528675-G-A p.Arg470His missense ADAMTSL4 3 80456 3.72875E-5 40228 0 5.03525E-4
1-150528677-C-A p.Pro471Thr missense ADAMTSL4 1 80482 1.24251E-5 40241 0 8.24647E-6
1-150528685-C-T p.Gly473Gly synonymous ADAMTSL4 1 80520 1.24193E-5 40260 0 2.00758E-5
1-150528689-G-A p.Gly475Arg missense ADAMTSL4 1 80560 1.24131E-5 40280 0 NA
1-150528698-G-A p.Gly478Arg missense ADAMTSL4 6 80598 7.44435E-5 40299 0 3.18593E-5
1-150528710-T-C p.Ser482Pro missense ADAMTSL4 9 80620 1.11635E-4 40310 0 1.59347E-4
1-150528712-T-C p.Ser482Ser synonymous ADAMTSL4 2 80616 2.4809E-5 40308 0 4.01452E-6
1-150528716-T-C p.Cys484Arg missense ADAMTSL4 3 80648 3.71987E-5 40324 0 3.18695E-5
1-150528719-C-T p.Arg485Cys missense ADAMTSL4 1 80642 1.24005E-5 40321 0 3.18776E-5
1-150528720-G-A p.Arg485His missense ADAMTSL4 2 80624 2.48065E-5 40312 0 4.12167E-5
1-150528724-T-G p.Leu486Leu synonymous ADAMTSL4 1 80636 1.24014E-5 40318 0 NA
1-150528729-C-T p.Ser488Leu missense ADAMTSL4 1 80626 1.24029E-5 40313 0 4.0149E-5
1-150528730-G-A p.Ser488Ser synonymous ADAMTSL4 3 80608 3.72171E-5 40304 0 6.25E-4
1-150528736-C-A p.Asn490Lys missense ADAMTSL4 2 80624 2.48065E-5 40312 0 NA
1-150528738-T-C p.Leu491Pro missense ADAMTSL4 1 80630 1.24023E-5 40315 0 NA
1-150528744-A-G p.Asp493Gly missense ADAMTSL4 7 80614 8.68336E-5 40307 0 2.47386E-5
1-150528746-C-T p.Arg494* stop_gained ADAMTSL4 1 80588 1.24088E-5 40294 0 8.03032E-6
1-150528747-G-T p.Arg494Leu missense ADAMTSL4 2 80586 2.48182E-5 40293 0 NA
1-150528749-G-A p.Gly495Arg missense ADAMTSL4 4 80584 4.96376E-5 40292 0 2.23271E-4
1-150528753-G-C p.Gly496Ala missense ADAMTSL4 3 80576 3.72319E-5 40288 0 8.24633E-6
1-150528758-C-T p.Leu498Leu synonymous ADAMTSL4 4 80572 4.9645E-5 40286 0 0.00125156
1-150528779-T-C p.Trp505Arg missense ADAMTSL4 1 80596 1.24076E-5 40298 0 NA
1-150528787-A-G p.Pro507Pro synonymous ADAMTSL4 1 80606 1.2406E-5 40303 0 8.26515E-6
1-150528790-G-A p.Ala508Ala synonymous ADAMTSL4 1 80610 1.24054E-5 40305 0 3.1904E-5
1-150528791-G-A p.Gly509Arg missense ADAMTSL4 1 80610 1.24054E-5 40305 0 4.01752E-6
1-150528793-A-G p.Gly509Gly synonymous ADAMTSL4 2 80578 2.48207E-5 40289 0 NA
1-150528795-C-G p.Ala510Gly missense ADAMTSL4 1 80588 1.24088E-5 40294 0 8.27965E-6
1-150528800-C-T p.Arg512Trp missense ADAMTSL4 2 80616 2.4809E-5 40308 0 4.14188E-5
1-150528801-G-A p.Arg512Gln missense ADAMTSL4 2 80638 2.48022E-5 40319 0 8.28446E-6
1-150528805-C-T p.Leu513Leu synonymous ADAMTSL4 1 80726 1.23876E-5 40363 0 3.19142E-5
1-150528806-C-A p.Gln514Lys missense ADAMTSL4 2 80740 2.47709E-5 40370 0 4.01949E-6
1-150528811-T-A p.Ile515Ile synonymous ADAMTSL4 1 80778 1.23796E-5 40389 0 1.2058E-5
1-150528817-G-C p.Gln517His missense ADAMTSL4 2 80804 2.47513E-5 40402 0 8.31117E-6
1-150528821-C-T p.Arg519Trp missense ADAMTSL4 3 80890 3.70874E-5 40445 0 1.12629E-4
1-150528822-G-A p.Arg519Gln missense ADAMTSL4 4 80910 4.94376E-5 40455 0 6.65956E-5
1-150528822-G-T p.Arg519Leu missense ADAMTSL4 1 80910 1.23594E-5 40455 0 NA
1-150528827-A-G p.Ser521Gly missense ADAMTSL4 1 81128 1.23262E-5 40564 0 8.34001E-6
1-150529089-A-AC c.1577-5dupC splice_region ADAMTSL4 1 83212 1.20175E-5 41606 0 1.99157E-5
1-150529092-C-T c.1577-5C>T splice_region ADAMTSL4 5 83226 6.00774E-5 41613 0 6.25E-4
1-150529093-G-A c.1577-4G>A splice_region ADAMTSL4 14 83230 1.68209E-4 41615 0 1.91375E-4
1-150529097-C-T p.Ala526Val missense+splice_region ADAMTSL4 1 83228 1.20152E-5 41614 0 NA
1-150529098-A-G p.Ala526Ala splice_region+synonymous ADAMTSL4 1 83232 1.20146E-5 41616 0 NA
1-150529102-C-T p.Arg528Cys missense ADAMTSL4 9 83228 1.08137E-4 41614 0 8.29683E-6
1-150529107-C-T p.Gly529Gly synonymous ADAMTSL4 1 83230 1.20149E-5 41615 0 6.25E-4
1-150529110-T-TG p.Arg533fs frameshift ADAMTSL4 1 83244 1.20129E-5 41622 0 NA
1-150529118-G-A p.Arg533Gln missense ADAMTSL4 1 83252 1.20117E-5 41626 0 5.03525E-4
1-150529123-A-C p.Ile535Leu missense ADAMTSL4 40 83270 4.80365E-4 41635 1 1.79172E-4
1-150529125-C-T p.Ile535Ile synonymous ADAMTSL4 1 83266 1.20097E-5 41633 0 1.19439E-5
1-150529133-G-A p.Gly538Glu missense ADAMTSL4 1 83274 1.20085E-5 41637 0 3.98111E-6
1-150529140-G-A p.Trp540* stop_gained ADAMTSL4 3 83278 3.60239E-5 41639 0 6.38325E-5
1-150529141-G-T p.Ala541Ser missense ADAMTSL4 1 83266 1.20097E-5 41633 0 NA
1-150529157-G-C p.Gly546Ala missense ADAMTSL4 1 83268 1.20094E-5 41634 0 NA
1-150529164-C-A p.Tyr548* stop_gained ADAMTSL4 1 83260 1.20106E-5 41630 0 8.27089E-6
1-150529167-G-T p.Arg549Ser missense ADAMTSL4 1 83272 1.20088E-5 41636 0 NA
1-150529170-CGGCG-C p.Gly552fs frameshift ADAMTSL4 1 83258 1.20109E-5 41629 0 NA
1-150529170-C-T p.Ala550Ala synonymous ADAMTSL4 3 83254 3.60343E-5 41627 0 7.44478E-5
1-150529171-G-A p.Gly551Ser missense ADAMTSL4 2 83256 2.40223E-5 41628 0 3.30797E-5
1-150529173-C-T p.Gly551Gly synonymous ADAMTSL4 5 83250 6.00601E-5 41625 0 4.96179E-5
1-150529173-C-A p.Gly551Gly synonymous ADAMTSL4 1 83250 1.2012E-5 41625 0 3.98184E-6
1-150529176-G-A p.Gly552Gly synonymous ADAMTSL4 1 83250 1.2012E-5 41625 0 NA
1-150529176-G-T p.Gly552Gly synonymous ADAMTSL4 1 83250 1.2012E-5 41625 0 5.78522E-5
1-150529179-C-T p.Thr553Thr synonymous ADAMTSL4 9 83254 1.08103E-4 41627 0 0.00100705
1-150529181-T-A p.Val554Asp missense ADAMTSL4 5 83238 6.00687E-5 41619 0 1.28107E-4
1-150529186-C-T p.Arg556* stop_gained ADAMTSL4 1 83242 1.20132E-5 41621 0 2.47877E-5
1-150529193-A-C p.Asn558Thr missense ADAMTSL4 2 83234 2.40286E-5 41617 0 3.98105E-6
1-150529195-C-T p.Arg559Cys missense ADAMTSL4 8 83216 9.61354E-5 41608 0 1.99086E-5
1-150529196-G-A p.Arg559His missense ADAMTSL4 3 83196 3.60594E-5 41598 0 1.19459E-5
1-150529197-T-C p.Arg559Arg synonymous ADAMTSL4 2 83196 2.40396E-5 41598 0 0.0025
1-150529202-C-G p.Pro561Arg missense ADAMTSL4 1 83206 1.20184E-5 41603 0 6.61026E-5
1-150529203-C-T p.Pro561Pro synonymous ADAMTSL4 1 83204 1.20187E-5 41602 0 9.58589E-5
1-150529203-C-G p.Pro561Pro synonymous ADAMTSL4 2 83204 2.40373E-5 41602 0 NA
1-150529210-G-C p.Glu564Gln missense ADAMTSL4 1 83180 1.20221E-5 41590 0 NA
1-150529232-C-T p.Ser571Leu missense ADAMTSL4 5 83064 6.01946E-5 41532 0 5.03525E-4
1-150529233-G-A p.Ser571Ser synonymous ADAMTSL4 5 83036 6.02148E-5 41518 0 4.95401E-5
1-150529241-G-A p.Gly574Asp missense ADAMTSL4 1 82978 1.20514E-5 41489 0 8.2575E-6
1-150529242-C-T p.Gly574Gly synonymous ADAMTSL4 1 82964 1.20534E-5 41482 0 2.59051E-4
1-150529266-C-T p.Val582Val synonymous ADAMTSL4 1 82972 1.20523E-5 41486 0 1.65145E-5
1-150529269-TGTGAGCCTGGGGCCAGGGGCAGCTGAATGCTGGGGAGGGAGGCTGTTCCCTCTGGGCAGAGCTGTGGTTGTCAAGATGGGAGAGAGAGCTGGTGGCATCCTCTTCTGGCCACCCCCACATATTCATTATCTTCTCTTCTCCCCAG-T c.1749+1_1750-1del splice_acceptor ADAMTSL4 1 82982 1.20508E-5 41491 0 NA
1-150529407-C-T c.1750-8C>T splice_region ADAMTSL4 1 83188 1.2021E-5 41594 0 3.30879E-5
1-150529433-A-T p.Asn590Tyr missense ADAMTSL4 1 83230 1.20149E-5 41615 0 NA
1-150529433-A-C p.Asn590His missense ADAMTSL4 3 83230 3.60447E-5 41615 0 NA
1-150529439-G-A p.Gly592Ser missense ADAMTSL4 3 83242 3.60395E-5 41621 0 7.97747E-6
1-150529441-C-T p.Gly592Gly synonymous ADAMTSL4 7 83234 8.41002E-5 41617 0 5.58436E-5
1-150529450-T-G p.Tyr595* stop_gained ADAMTSL4 1 83248 1.20123E-5 41624 0 1.99389E-5
1-150529458-T-A p.Val598Asp missense ADAMTSL4 1 83250 1.2012E-5 41625 0 NA
1-150529478-A-G p.Ile605Val missense ADAMTSL4 1 83152 1.20262E-5 41576 0 8.29077E-6
1-150529490-C-T p.Pro609Ser missense ADAMTSL4 1 83066 1.20386E-5 41533 0 8.30924E-6
1-150529493-AC-A p.Pro611fs frameshift ADAMTSL4 2 83014 2.40923E-5 41507 0 3.99233E-6
1-150529499-G-A p.Glu612Lys missense ADAMTSL4 3 82982 3.61524E-5 41491 0 NA
1-150529502-C-T p.Pro613Ser missense ADAMTSL4 2 82936 2.4115E-5 41468 0 8.33625E-6
1-150529509-T-A p.Val615Asp missense ADAMTSL4 1 82852 1.20697E-5 41426 0 NA
1-150529509-T-TC p.Gln617fs frameshift ADAMTSL4 1 82852 1.20697E-5 41426 0 NA
1-150529510-C-T p.Val615Val synonymous ADAMTSL4 2 82872 2.41336E-5 41436 0 6.37796E-5
1-150529516-G-C p.Gln617His missense ADAMTSL4 2 82764 2.41651E-5 41382 0 8.35324E-6
1-150529517-C-T p.Leu618Phe missense ADAMTSL4 1 82768 1.2082E-5 41384 0 NA
1-150529524-C-T p.Pro620Leu missense+splice_region ADAMTSL4 1 82692 1.20931E-5 41346 0 6.37633E-5
1-150529525-GGGTAAGACTCTGACCCCTGCACTTGGAAGGAGGAGGGAGAGGCTGCAGGGCTGGCTCGGGGCAGTGGGGTGGCATCTGATTCGCCTGCTCCCCTGCACA-G p.Glu621fs frameshift ADAMTSL4 7 82680 8.46638E-5 41340 0 NA
1-150529525-G-A p.Pro620Pro splice_region+synonymous ADAMTSL4 2 82682 2.41891E-5 41341 0 3.1904E-5
1-150529526-G-C p.Glu621Gln missense+splice_region ADAMTSL4 3 82678 3.62853E-5 41339 0 3.20423E-5
1-150529638-T-G p.Val625Gly missense ADAMTSL4 1 80166 1.24741E-5 40083 0 1.22729E-5
1-150529649-C-T p.Leu629Phe missense ADAMTSL4 1 80040 1.24938E-5 40020 0 NA
1-150529656-C-T p.Pro631Leu missense ADAMTSL4 25 79736 3.13535E-4 39868 0 3.94032E-4
1-150529657-G-A p.Pro631Pro synonymous ADAMTSL4 63 79586 7.91597E-4 39793 0 0.00121468
1-150529664-C-T p.Arg634Cys missense ADAMTSL4 7 79638 8.78977E-5 39819 0 6.25782E-4
1-150529670-G-A p.Ala636Thr missense ADAMTSL4 1 79606 1.25619E-5 39803 0 4.11699E-6
1-150529673-C-T p.Arg637Trp missense ADAMTSL4 15 79746 1.88097E-4 39873 0 1.59663E-4
1-150529673-C-A p.Arg637Arg synonymous ADAMTSL4 12 79746 1.50478E-4 39873 0 1.91595E-4
1-150529674-G-A p.Arg637Gln missense ADAMTSL4 2 79594 2.51275E-5 39797 0 7.13356E-5
1-150529700-G-A p.Val646Met missense ADAMTSL4 7 80282 8.71926E-5 40141 0 5.06073E-4
1-150529709-C-A p.Pro649Thr missense ADAMTSL4 1 80632 1.2402E-5 40316 0 NA
1-150529709-C-T p.Pro649Ser missense ADAMTSL4 1 80632 1.2402E-5 40316 0 NA
1-150529717-G-A p.Met651Ile missense ADAMTSL4 1 80688 1.23934E-5 40344 0 3.19163E-5
1-150529720-C-T p.Pro652Pro synonymous ADAMTSL4 18 80938 2.22392E-4 40469 0 0.00125
1-150529721-G-T p.Ala653Ser missense ADAMTSL4 1 80840 1.23701E-5 40420 0 9.49523E-6
1-150529724-C-T p.Pro654Ser missense ADAMTSL4 2 81152 2.46451E-5 40576 1 5.06073E-4
1-150529725-C-T p.Pro654Leu missense ADAMTSL4 2 81178 2.46372E-5 40589 0 6.37999E-5
1-150529726-G-A p.Pro654Pro synonymous ADAMTSL4 2 81080 2.4667E-5 40540 0 6.391E-5
1-150529727-C-T p.Pro655Ser missense ADAMTSL4 3 81298 3.69013E-5 40649 0 NA
1-150529738-G-C p.Arg658Ser missense ADAMTSL4 10 81640 1.22489E-4 40820 0 1.10355E-4
1-150529758-C-T p.Ala665Val missense ADAMTSL4 1 82006 1.21942E-5 41003 0 1.21738E-5
1-150529761-C-T p.Ala666Val missense ADAMTSL4 3 82002 3.65845E-5 41001 0 9.48587E-6
1-150529762-G-T p.Ala666Ala synonymous ADAMTSL4 1 82030 1.21907E-5 41015 0 1.89761E-5
1-150529762-G-A p.Ala666Ala synonymous ADAMTSL4 4 82030 4.87626E-5 41015 0 4.74401E-5
1-150529773-G-A p.Arg670Gln missense ADAMTSL4 2 82142 2.43481E-5 41071 0 6.37755E-5
1-150529782-ACT-A p.Ser674fs frameshift ADAMTSL4 1 82124 1.21767E-5 41062 0 5.7867E-5
1-150529789-A-C p.Ala675Ala synonymous ADAMTSL4 1 82212 1.21637E-5 41106 0 NA
1-150529803-G-A p.Cys680Tyr missense ADAMTSL4 3 82152 3.65177E-5 41076 0 4.03372E-5
1-150529804-C-T p.Cys680Cys synonymous ADAMTSL4 14 82114 1.70495E-4 41057 0 0.001875
1-150529805-G-A p.Gly681Arg missense ADAMTSL4 5 82098 6.09028E-5 41049 0 5.07975E-5
1-150529807-G-A p.Gly681Gly synonymous ADAMTSL4 1 82090 1.21818E-5 41045 0 4.14666E-6
1-150529817-A-G c.2047+6A>G splice_region ADAMTSL4 1 82018 1.21924E-5 41009 0 NA
1-150529818-C-T c.2047+7C>T splice_region ADAMTSL4 1 82000 1.21951E-5 41000 0 1.04262E-5
1-150529819-A-G c.2047+8A>G splice_region ADAMTSL4 2 82004 2.43891E-5 41002 0 NA
1-150529978-C-T p.Arg686Cys missense ADAMTSL4 10 81566 1.226E-4 40783 0 8.18212E-5
1-150529987-T-C p.Phe689Leu missense ADAMTSL4 1 81828 1.22208E-5 40914 0 4.61783E-5
1-150529995-C-T p.Cys691Cys synonymous ADAMTSL4 1 81846 1.22181E-5 40923 0 3.18898E-5
1-150529997-T-C p.Ile692Thr missense ADAMTSL4 9 81802 1.10022E-4 40901 0 7.97251E-4
1-150530002-C-T p.Arg694Cys missense ADAMTSL4 4 81870 4.88579E-5 40935 0 2.43212E-5
1-150530009-C-T p.Ser696Leu missense ADAMTSL4 192 81786 0.00234759 40893 1 0.0131048
1-150530010-G-A p.Ser696Ser synonymous ADAMTSL4 2 81828 2.44415E-5 40914 0 7.01009E-5
1-150530011-G-C p.Gly697Arg missense ADAMTSL4 1 81814 1.22228E-5 40907 0 NA
1-150530022-G-A p.Leu700Leu synonymous ADAMTSL4 1 81770 1.22294E-5 40885 0 1.06397E-5
1-150530029-C-T p.Arg703Cys missense ADAMTSL4 10 81642 1.22486E-4 40821 0 4.60051E-5
1-150530030-G-A p.Arg703His missense ADAMTSL4 4 81588 4.90268E-5 40794 0 1.59663E-4
1-150530040-C-T p.Ala706Ala synonymous ADAMTSL4 10 81470 1.22745E-4 40735 0 2.34435E-4
1-150530041-G-A p.Ala707Thr missense ADAMTSL4 3 81396 3.68568E-5 40698 0 5.04541E-4
1-150530042-C-T p.Ala707Val missense ADAMTSL4 17 81380 2.08897E-4 40690 0 5.52306E-4
1-150530043-G-A p.Ala707Ala synonymous ADAMTSL4 867 81424 0.010648 40712 5 0.0135789
1-150530044-G-A p.Gly708Ser missense ADAMTSL4 2 81448 2.45555E-5 40724 0 NA
1-150530045-G-A p.Gly708Asp missense ADAMTSL4 1 81436 1.22796E-5 40718 0 1.28057E-5
1-150530049-C-T p.Ala709Ala synonymous ADAMTSL4 4 81362 4.9163E-5 40681 0 4.39951E-6
1-150530051-G-A p.Arg710Lys missense ADAMTSL4 1 81314 1.2298E-5 40657 0 NA
1-150530052-G-T p.Arg710Ser missense ADAMTSL4 1 81204 1.23147E-5 40602 0 9.58099E-4
1-150530053-C-T p.Pro711Ser missense ADAMTSL4 1 81336 1.22947E-5 40668 0 1.35977E-5
1-150530079-C-T p.His719His synonymous ADAMTSL4 12 80772 1.48566E-4 40386 0 0.00302725
1-150530080-G-A p.Gly720Ser missense ADAMTSL4 3 80702 3.71738E-5 40351 0 1.51888E-5
1-150530088-A-G p.Pro722Pro synonymous ADAMTSL4 1 80542 1.24159E-5 40271 0 4.58379E-6
1-150530090-G-GC p.Tyr726fs frameshift ADAMTSL4 1 80396 1.24384E-5 40198 0 NA
1-150530098-TAGTG-T p.Tyr726fs frameshift ADAMTSL4 1 80258 1.24598E-5 40129 0 9.13659E-6
1-150530414-C-A c.2178-7C>A splice_region ADAMTSL4 7 79618 8.79198E-5 39809 0 3.9618E-4
1-150530419-A-G c.2178-2A>G splice_acceptor ADAMTSL4 2 79860 2.50438E-5 39930 0 1.0049E-5
1-150530420-G-A c.2178-1G>A splice_acceptor ADAMTSL4 1 79876 1.25194E-5 39938 0 NA
1-150530433-C-T p.Gly730Gly synonymous ADAMTSL4 46 80178 5.73723E-4 40089 0 0.00404449
1-150530434-G-T p.Glu731* stop_gained ADAMTSL4 1 80256 1.24601E-5 40128 0 NA
1-150530440-A-T p.Thr733Ser missense ADAMTSL4 1 80462 1.24282E-5 40231 0 1.84383E-5
1-150530441-C-T p.Thr733Ile missense ADAMTSL4 16 80528 1.98689E-4 40264 0 7.50682E-5
1-150530442-A-G p.Thr733Thr synonymous ADAMTSL4 1 80548 1.2415E-5 40274 0 4.16427E-6
1-150530452-C-T p.Arg737Cys missense ADAMTSL4 14 80710 1.73461E-4 40355 0 6.6246E-5
1-150530454-C-T p.Arg737Arg synonymous ADAMTSL4 1 80806 1.23753E-5 40403 0 1.79717E-5
1-150530461-G-A p.Gly740Ser missense ADAMTSL4 2 80998 2.4692E-5 40499 0 4.11902E-6
1-150530466-C-T p.Pro741Pro synonymous ADAMTSL4 15 81052 1.85066E-4 40526 0 0.00126263
1-150530467-G-A p.Gly742Ser missense ADAMTSL4 1 81022 1.23423E-5 40511 0 3.18796E-5
1-150530479-C-T p.Arg746Cys missense ADAMTSL4 3 81270 3.6914E-5 40635 0 1.27494E-4
1-150530494-C-T p.Arg751Trp missense ADAMTSL4 4 81524 4.90653E-5 40762 0 8.12935E-5
1-150530495-G-A p.Arg751Gln missense ADAMTSL4 6 81598 7.35312E-5 40799 0 5.27936E-5
1-150530505-T-TG p.Gly758fs frameshift ADAMTSL4 16 81880 1.95408E-4 40940 0 0.00112638
1-150530505-TG-T p.Gly757fs frameshift ADAMTSL4 1 81878 1.22133E-5 40939 0 0.00100806
1-150530505-T-TGG p.Gly758fs frameshift ADAMTSL4 1 81898 1.22103E-5 40949 0 NA
1-150530506-G-T p.Gly755Trp missense ADAMTSL4 3 81864 3.66461E-5 40932 0 5.04032E-4
1-150530507-G-C p.Gly755Ala missense ADAMTSL4 1 81940 1.22041E-5 40970 0 1.73298E-5
1-150530507-G-T p.Gly755Val missense ADAMTSL4 2 81940 2.44081E-5 40970 0 2.07958E-4
1-150530508-G-T p.Gly755Gly synonymous ADAMTSL4 2 81958 2.44027E-5 40979 0 1.21449E-5
1-150530509-G-A p.Gly756Arg missense ADAMTSL4 6 81948 7.32172E-5 40974 0 4.04681E-6
1-150530509-G-C p.Gly756Arg missense ADAMTSL4 1 81948 1.22029E-5 40974 0 NA
1-150530512-G-A p.Gly757Ser missense ADAMTSL4 1 81852 1.22172E-5 40926 0 NA
1-150530514-T-G p.Gly757Gly synonymous ADAMTSL4 1 81526 1.2266E-5 40763 0 NA
1-150530519-C-T p.Ser759Phe missense ADAMTSL4 3 81988 3.65907E-5 40994 0 5.04032E-4
1-150530522-C-T p.Ser760Leu missense ADAMTSL4 12 82082 1.46195E-4 41041 0 2.87045E-4
1-150530523-G-A p.Ser760Ser synonymous ADAMTSL4 2 82072 2.43688E-5 41036 0 8.58236E-6
1-150530531-C-T p.Pro763Leu missense ADAMTSL4 117 82288 0.00142184 41144 1 0.00331696
1-150530531-C-G p.Pro763Arg missense ADAMTSL4 215 82284 0.0026129 41142 1 0.0046565
1-150530536-C-T p.Arg765Cys missense ADAMTSL4 19 82314 2.30823E-4 41157 0 6.25E-4
1-150530537-G-A p.Arg765His missense ADAMTSL4 9 82354 1.09284E-4 41177 0 5.03525E-4
1-150530543-G-A p.Gly767Glu missense ADAMTSL4 1 82504 1.21206E-5 41252 0 NA
1-150530548-C-G p.Leu769Val missense ADAMTSL4 1333 82500 0.0161576 41250 18 0.0207419
1-150530554-C-T p.Arg771Trp missense ADAMTSL4 12 82586 1.45303E-4 41293 0 6.25E-4
1-150530555-G-A p.Arg771Gln missense ADAMTSL4 4 82534 4.84649E-5 41267 0 5.04032E-4
1-150530555-G-T p.Arg771Leu missense ADAMTSL4 1 82534 1.21162E-5 41267 0 5.94924E-5
1-150530561-A-G p.Asn773Ser missense ADAMTSL4 1 82592 1.21077E-5 41296 0 2.54764E-5
1-150530563-A-G p.Ile774Val missense ADAMTSL4 2 82590 2.4216E-5 41295 0 1.69814E-5
1-150530584-C-T p.Arg781Cys missense ADAMTSL4 8 82572 9.68851E-5 41286 0 5.03525E-4
1-150530585-G-A p.Arg781His missense ADAMTSL4 3 82576 3.63302E-5 41288 0 1.01885E-4
1-150530597-A-G p.His785Arg missense ADAMTSL4 11 82506 1.33324E-4 41253 0 3.50363E-4
1-150530625-G-GTGCTCC c.2382_2382+1insTGCTCC splice_donor ADAMTSL4 1 82346 1.21439E-5 41173 0 NA
1-150530629-A-AGAGAAGCCGGCAGGTTCGCTGT c.2382+4_2382+5insGAGAAGCCGGCAGGTTCGCTGT splice_region ADAMTSL4 1 82314 1.21486E-5 41157 0 NA
1-150530939-GC-G c.2383-5delC splice_region ADAMTSL4 3 82648 3.62985E-5 41324 0 8.50962E-6
1-150530939-G-GC c.2383-5dupC splice_region ADAMTSL4 1 82648 1.20995E-5 41324 0 NA
1-150530941-C-A c.2383-8C>A splice_region ADAMTSL4 1 82750 1.20846E-5 41375 0 NA
1-150530951-C-G p.Cys795Trp missense+splice_region ADAMTSL4 1 82768 1.2082E-5 41384 0 NA
1-150530954-C-T p.Ser796Ser synonymous ADAMTSL4 9 82800 1.08696E-4 41400 0 2.79419E-4
1-150530955-G-A p.Val797Met missense ADAMTSL4 2 82800 2.41546E-5 41400 0 5.92016E-5
1-150530956-T-G p.Val797Gly missense ADAMTSL4 2 82836 2.41441E-5 41418 0 NA
1-150530957-G-GGCCCCT p.Val797_Arg798insAlaPro conservative_inframe_insertion ADAMTSL4 2 82846 2.41412E-5 41423 0 NA
1-150530958-C-T p.Arg798Trp missense ADAMTSL4 18 82830 2.17313E-4 41415 0 6.25E-4
1-150530959-G-A p.Arg798Gln missense ADAMTSL4 6 82858 7.2413E-5 41429 0 3.18735E-5
1-150530962-G-A p.Cys799Tyr missense ADAMTSL4 1 82864 1.2068E-5 41432 0 3.5975E-5
1-150530963-C-T p.Cys799Cys synonymous ADAMTSL4 14 82854 1.68972E-4 41427 0 4.39814E-5
1-150530964-G-A p.Gly800Ser missense ADAMTSL4 8 82872 9.65344E-5 41436 0 9.56145E-5
1-150530967-C-T p.Arg801Trp missense ADAMTSL4 34 82910 4.10083E-4 41455 1 6.69344E-4
1-150530967-C-G p.Arg801Gly missense ADAMTSL4 1 82910 1.20613E-5 41455 0 NA
1-150530968-G-A p.Arg801Gln missense ADAMTSL4 2 82922 2.41191E-5 41461 0 6.37227E-5
1-150530969-G-A p.Arg801Arg synonymous ADAMTSL4 2 82940 2.41138E-5 41470 0 NA
1-150530971-G-T p.Gly802Val missense ADAMTSL4 2 82940 2.41138E-5 41470 0 NA
1-150530979-A-G p.Ser805Gly missense ADAMTSL4 1 83004 1.20476E-5 41502 0 2.79116E-5
1-150530982-C-T p.Arg806Trp missense ADAMTSL4 3 83008 3.61411E-5 41504 0 5.01354E-5
1-150530983-G-A p.Arg806Gln missense ADAMTSL4 2 82998 2.4097E-5 41499 0 4.38429E-5
1-150530991-C-T p.Arg809Cys missense ADAMTSL4 6 82998 7.22909E-5 41499 0 3.98441E-5
1-150530992-G-A p.Arg809His missense ADAMTSL4 3 83002 3.61437E-5 41501 0 4.78069E-5
1-150530993-C-T p.Arg809Arg synonymous ADAMTSL4 166 83022 0.00199947 41511 7 0.00704287
1-150531008-T-C p.Asn814Asn synonymous ADAMTSL4 74961 82742 0.905961 41371 34205 0.9112
1-150531009-G-A p.Gly815Ser missense ADAMTSL4 2 83100 2.40674E-5 41550 0 5.03525E-4
1-150531010-GTGA-G p.Asp816del disruptive_inframe_deletion ADAMTSL4 3 83108 3.60976E-5 41554 0 1.19432E-5
1-150531014-T-C p.Asp816Asp synonymous ADAMTSL4 7 83114 8.42217E-5 41557 0 9.08145E-5
1-150531022-G-C p.Ser819Thr missense ADAMTSL4 1 83148 1.20267E-5 41574 0 3.98051E-6
1-150531023-C-T p.Ser819Ser synonymous ADAMTSL4 10 83136 1.20285E-4 41568 0 8.25614E-5
1-150531024-G-A p.Glu820Lys missense ADAMTSL4 6 83156 7.21535E-5 41578 0 6.76708E-5
1-150531034-G-A p.Cys823Tyr missense ADAMTSL4 1 83174 1.2023E-5 41587 0 NA
1-150531036-G-A p.Ala824Thr missense ADAMTSL4 1 83158 1.20253E-5 41579 0 1.59208E-5
1-150531037-C-T p.Ala824Val missense ADAMTSL4 1 83152 1.20262E-5 41576 0 6.25E-4
1-150531038-G-A p.Ala824Ala synonymous ADAMTSL4 2 83168 2.40477E-5 41584 0 8.256E-5
1-150531043-G-GC p.Gln829fs frameshift ADAMTSL4 1 83148 1.20267E-5 41574 0 1.65248E-5
1-150531044-C-T p.Gly826Gly synonymous ADAMTSL4 1 83140 1.20279E-5 41570 0 8.26282E-6
1-150531046-C-T p.Pro827Leu missense ADAMTSL4 15 83174 1.80345E-4 41587 0 0.00100705
1-150531047-C-T p.Pro827Pro synonymous ADAMTSL4 20 83172 2.40466E-4 41586 0 5.03525E-4
1-150531048-C-T p.Pro828Ser missense ADAMTSL4 2 83172 2.40466E-5 41586 0 8.26829E-6
1-150531049-C-T p.Pro828Leu missense ADAMTSL4 6 83174 7.21379E-5 41587 0 7.44097E-5
1-150531050-G-A p.Pro828Pro synonymous ADAMTSL4 69150 82660 0.836559 41330 28953 0.870376
1-150531053-G-GC p.Ser832fs frameshift ADAMTSL4 4 83150 4.81058E-5 41575 0 2.48624E-5
1-150531054-C-T p.Pro830Ser missense ADAMTSL4 1 83164 1.20244E-5 41582 0 NA
1-150531059-C-A p.Pro831Pro synonymous ADAMTSL4 1 83170 1.20236E-5 41585 0 3.18918E-5
1-150531071-C-G p.Ala835Ala synonymous ADAMTSL4 1 83150 1.20265E-5 41575 0 3.98064E-6
1-150531078-A-G p.Met838Val missense ADAMTSL4 2305 83098 0.0277383 41549 182 0.0575696
1-150531079-T-C p.Met838Thr missense ADAMTSL4 3 83132 3.60872E-5 41566 0 0.00125
1-150531081-G-A p.Gly839Arg missense ADAMTSL4 3 83134 3.60863E-5 41567 0 3.18857E-5
1-150531082-G-A p.Gly839Glu missense ADAMTSL4 1 83132 1.20291E-5 41566 0 4.97364E-5
1-150531083-G-A p.Gly839Gly synonymous ADAMTSL4 1 83120 1.20308E-5 41560 0 3.18918E-5
1-150531083-G-T p.Gly839Gly synonymous ADAMTSL4 1 83120 1.20308E-5 41560 0 NA
1-150531093-A-G p.Thr843Ala missense ADAMTSL4 2 83086 2.40714E-5 41543 0 3.1902E-5
1-150531101-G-C p.Trp845Cys missense ADAMTSL4 1 83050 1.20409E-5 41525 0 NA
1-150531111-G-A p.Asp849Asn missense ADAMTSL4 8 82908 9.64925E-5 41454 0 0.00100705
1-150531113-C-G p.Asp849Glu missense ADAMTSL4 29 82910 3.49777E-4 41455 0 7.0162E-4
1-150531113-CTG-C p.Trp850fs frameshift ADAMTSL4 2 82910 2.41225E-5 41455 0 NA
1-150531123-A-C p.Lys853Gln missense+splice_region ADAMTSL4 1 82854 1.20694E-5 41427 0 NA
1-150531125-G-T p.Lys853Asn missense+splice_region ADAMTSL4 3 82846 3.62118E-5 41423 0 3.991E-6
1-150531133-C-T p.Pro856Leu missense ADAMTSL4 5 82712 6.04507E-5 41356 0 0.00125
1-150531134-G-A p.Pro856Pro synonymous ADAMTSL4 19 82806 2.29452E-4 41403 0 4.14938E-4
1-150531137-A-C p.Glu857Asp missense ADAMTSL4 4 82328 4.85861E-5 41164 0 0.204637
1-150531138-C-T p.Pro858Ser missense ADAMTSL4 1 83122 1.20305E-5 41561 0 1.99399E-5
1-150531139-C-T p.Pro858Leu missense ADAMTSL4 2 83132 2.40581E-5 41566 0 8.2802E-6
1-150531141-C-T p.Pro859Ser missense ADAMTSL4 3 83154 3.60776E-5 41577 0 NA
1-150531151-C-T p.Ser862Phe missense ADAMTSL4 1 83144 1.20273E-5 41572 0 NA
1-150531158-C-T p.Ile864Ile synonymous ADAMTSL4 1 83134 1.20288E-5 41567 0 NA
1-150531170-C-T p.His868His synonymous ADAMTSL4 76486 79310 0.964393 39655 37102 0.99375
1-150531171-GC-G p.Gln870fs frameshift ADAMTSL4 86 83048 0.00103555 41524 0 0.00239204
1-150531180-A-G p.Thr872Ala missense ADAMTSL4 1 82992 1.20494E-5 41496 0 8.81943E-6
1-150531189-T-C p.Phe875Leu missense ADAMTSL4 1 82964 1.20534E-5 41482 0 NA
1-150531222-A-G c.*22A>G splice_region ADAMTSL4 1 82542 1.2115E-5 41271 0 2.6024E-5
1-150531433-C-T c.2560-5C>T splice_region ADAMTSL4 18 79622 2.26068E-4 39811 0 1.83346E-4
1-150531434-G-A c.2560-4G>A splice_region ADAMTSL4 17 79572 2.13643E-4 39786 0 0.00187735
1-150531443-A-C p.Ser855Ser synonymous ADAMTSL4 1 79832 1.25263E-5 39916 0 5.06073E-4
1-150531445-CCG-C p.Glu857fs frameshift ADAMTSL4 1 79830 1.25266E-5 39915 0 NA
1-150531447-G-A p.Glu857Lys missense ADAMTSL4 6 79876 7.51164E-5 39938 0 1.17977E-4
1-150531455-G-T p.Gly859Gly synonymous ADAMTSL4 1 80076 1.24881E-5 40038 0 6.37592E-5
1-150531457-C-CGGGAATCCA p.Gly861_Gln863dup conservative_inframe_insertion ADAMTSL4 1 80116 1.24819E-5 40058 0 3.18918E-5
1-150531457-C-T p.Thr860Met missense ADAMTSL4 2 80116 2.49638E-5 40058 0 3.18918E-5
1-150531458-G-A p.Thr860Thr synonymous ADAMTSL4 78 80192 9.72666E-4 40096 0 0.00127592
1-150531468-C-T p.Arg864Trp missense ADAMTSL4 4 80508 4.96845E-5 40254 0 2.21941E-4
1-150531469-G-A p.Arg864Gln missense ADAMTSL4 12 80540 1.48994E-4 40270 0 1.76173E-4
1-150531471-C-T p.Arg865Cys missense ADAMTSL4 4 80520 4.96771E-5 40260 0 1.08835E-5
1-150531472-G-A p.Arg865His missense ADAMTSL4 2 80608 2.48114E-5 40304 0 5.04541E-4
1-150531503-C-T p.Ala875Ala synonymous ADAMTSL4 10 81040 1.23396E-4 40520 0 1.35641E-4
1-150531506-C-G p.Leu876Leu synonymous ADAMTSL4 1 80988 1.23475E-5 40494 0 NA
1-150531506-C-T p.Leu876Leu synonymous ADAMTSL4 2 80988 2.4695E-5 40494 0 8.20096E-6
1-150531507-G-A p.Gly877Arg missense ADAMTSL4 5 81016 6.17162E-5 40508 0 2.78087E-4
1-150531508-G-A p.Gly877Glu missense ADAMTSL4 2 80996 2.46926E-5 40498 0 NA
1-150531518-G-A p.Gln880Gln synonymous ADAMTSL4 6 81112 7.39718E-5 40556 0 0.00125
1-150531521-G-A p.Gly881Gly synonymous ADAMTSL4 9 81092 1.10985E-4 40546 0 5.60706E-5
1-150531532-C-T p.Ala885Val missense ADAMTSL4 1 81038 1.23399E-5 40519 0 9.2239E-6
1-150531557-A-T p.Thr893Thr synonymous ADAMTSL4 1 81274 1.23041E-5 40637 0 NA
1-150531564-C-A p.Arg896Arg synonymous ADAMTSL4 4 81154 4.9289E-5 40577 0 8.13617E-6
1-150531565-G-A p.Arg896Gln missense ADAMTSL4 28 81126 3.45142E-4 40563 0 5.03525E-4
1-150531566-G-A p.Arg896Arg synonymous ADAMTSL4 1 81094 1.23314E-5 40547 0 NA
1-150531569-C-G p.Pro897Pro synonymous ADAMTSL4 3 81148 3.69695E-5 40574 0 6.25782E-4
1-150531570-CCT-C p.Pro898fs frameshift ADAMTSL4 1 81170 1.23198E-5 40585 0 NA
1-150531580-G-A p.Arg901His missense ADAMTSL4 24 80984 2.96355E-4 40492 0 3.18878E-4
1-150531581-C-T p.Arg901Arg synonymous ADAMTSL4 3 80972 3.70498E-5 40486 0 1.8059E-5
1-150531582-G-A p.Ala902Thr missense ADAMTSL4 18 81020 2.22167E-4 40510 0 7.14182E-4
1-150531590-C-T p.Ser904Ser synonymous ADAMTSL4 7 80982 8.6439E-5 40491 0 6.37755E-5
1-150531593-G-A p.Leu905Leu synonymous ADAMTSL4 1 80972 1.23499E-5 40486 0 NA
1-150531601-G-C p.Cys908Ser missense ADAMTSL4 3 80832 3.7114E-5 40416 0 2.71336E-5
1-150531608-A-G p.Arg910Arg synonymous ADAMTSL4 1 80714 1.23894E-5 40357 0 4.0702E-6
1-150531615-C-T p.Arg913Cys missense ADAMTSL4 1 80496 1.2423E-5 40248 0 2.72693E-5
1-150531616-G-A p.Arg913His missense ADAMTSL4 33 80494 4.09968E-4 40247 0 0.0015121
1-150531620-G-A p.Trp914* stop_gained ADAMTSL4 1 80498 1.24227E-5 40249 0 NA
1-150531621-T-C p.Tyr915His missense ADAMTSL4 3 80468 3.72819E-5 40234 0 9.08678E-6
1-150531629-G-A p.Gly917Gly synonymous ADAMTSL4 50 80042 6.24672E-4 40021 0 0.00185008
1-150531649-G-A c.2763+8G>A splice_region ADAMTSL4 2 79952 2.5015E-5 39976 0 NA
1-150531757-C-T c.2764-6C>T splice_region ADAMTSL4 2 82470 2.42512E-5 41235 0 1.59237E-5
1-150531772-G-A p.Glu925Lys missense ADAMTSL4 5 82602 6.05312E-5 41301 0 6.25E-4
1-150531782-C-G p.Ser928Cys missense ADAMTSL4 2 82696 2.4185E-5 41348 0 NA
1-150531793-C-T p.Arg932Cys missense ADAMTSL4 1 82596 1.21071E-5 41298 0 8.27239E-6
1-150531794-G-A p.Arg932His missense ADAMTSL4 7 82608 8.47376E-5 41304 1 1.3235E-4
1-150531795-T-C p.Arg932Arg synonymous ADAMTSL4 1 82624 1.2103E-5 41312 0 4.13579E-5
1-150531828-G-A p.Thr943Thr synonymous ADAMTSL4 81 82094 9.86674E-4 41047 0 0.00261138
1-150531837-C-G p.Asn946Lys missense ADAMTSL4 3 81808 3.66712E-5 40904 0 3.19061E-5
1-150531837-C-T p.Asn946Asn synonymous ADAMTSL4 2 81810 2.44469E-5 40905 0 6.38121E-5
1-150531838-G-A p.Val947Met missense ADAMTSL4 12 81730 1.46825E-4 40865 0 1.6722E-4
1-150531843-T-C p.Thr948Thr synonymous ADAMTSL4 2 81472 2.45483E-5 40736 0 8.30206E-6
1-150531847-C-T p.Pro950Ser missense ADAMTSL4 2 81136 2.465E-5 40568 0 NA
1-150531848-C-T p.Pro950Leu missense ADAMTSL4 3 81032 3.70224E-5 40516 0 6.38121E-5
1-150531849-G-A p.Pro950Pro synonymous ADAMTSL4 7 80912 8.65137E-5 40456 0 5.03525E-4
1-150531860-C-T p.Ser954Phe missense ADAMTSL4 5 79824 6.26378E-5 39912 1 1.27584E-4
1-150531869-C-T p.Pro957Leu missense ADAMTSL4 5 78690 6.35405E-5 39345 0 0.0020141
1-150531880-G-T p.Ala961Ser missense ADAMTSL4 1 76178 1.31271E-5 38089 0 NA
1-150531882-C-G p.Ala961Ala synonymous ADAMTSL4 98 76148 0.00128697 38074 2 0.003125
1-150531905-C-A p.Ala969Asp missense ADAMTSL4 614 70874 0.00866326 35437 5 0.00937975
1-150531916-C-T p.Arg973* stop_gained ADAMTSL4 1 68650 1.45666E-5 34325 0 1.67386E-5
1-150531917-G-A p.Arg973Gln missense ADAMTSL4 3 68130 4.40335E-5 34065 0 6.25E-4
1-150531930-G-A p.Thr977Thr synonymous ADAMTSL4 31 65112 4.76103E-4 32556 0 9.57182E-4
1-150532229-C-T c.2944-8C>T splice_region ADAMTSL4 18 82842 2.17281E-4 41421 0 1.56988E-4
1-150532230-G-A c.2944-7G>A splice_region ADAMTSL4 112 82850 0.00135184 41425 0 0.00103267
1-150532232-C-G c.2944-5C>G splice_region ADAMTSL4 2 82934 2.41156E-5 41467 0 NA
1-150532243-C-T p.Arg984Cys missense ADAMTSL4 6 83002 7.22874E-5 41501 0 8.25518E-5
1-150532244-GC-G p.Ser985fs frameshift ADAMTSL4 1 83014 1.20462E-5 41507 0 NA
1-150532244-G-A p.Arg984His missense ADAMTSL4 1 83014 1.20462E-5 41507 0 6.25E-4
1-150532256-G-C p.Gly988Ala missense ADAMTSL4 2 83130 2.40587E-5 41565 0 3.30087E-5
1-150532262-C-T p.Thr990Met missense ADAMTSL4 90 83136 0.00108256 41568 1 0.00290382
1-150532263-G-A p.Thr990Thr synonymous ADAMTSL4 2 83128 2.40593E-5 41564 0 5.77529E-5
1-150532267-A-G p.Thr992Ala missense ADAMTSL4 3 83156 3.60768E-5 41578 0 3.97867E-6
1-150532270-C-T p.Arg993Trp missense ADAMTSL4 6 83148 7.21605E-5 41574 0 7.9576E-5
1-150532271-G-A p.Arg993Gln missense ADAMTSL4 7 83144 8.41913E-5 41572 1 6.38407E-5
1-150532300-A-C p.Thr1003Pro missense ADAMTSL4 1 83142 1.20276E-5 41571 0 3.97899E-6
1-150532303-C-G p.Leu1004Val missense ADAMTSL4 1 83150 1.20265E-5 41575 0 NA
1-150532308-C-T p.Ser1005Ser synonymous ADAMTSL4 1 83154 1.20259E-5 41577 0 NA
1-150532313-G-A p.Arg1007Gln missense ADAMTSL4 6 83142 7.21657E-5 41571 0 6.36674E-5
1-150532331-G-A p.Arg1013Gln missense ADAMTSL4 8 83142 9.62209E-5 41571 0 6.25E-4
1-150532331-G-C p.Arg1013Pro missense ADAMTSL4 1 83142 1.20276E-5 41571 0 3.97962E-6
1-150532345-C-T p.Arg1018Cys missense ADAMTSL4 2 83156 2.40512E-5 41578 0 NA
1-150532346-G-A p.Arg1018His missense ADAMTSL4 1 83156 1.20256E-5 41578 0 1.15553E-4
1-150532352-G-A p.Cys1020Tyr missense ADAMTSL4 1 83182 1.20218E-5 41591 0 1.19415E-5
1-150532371-C-G p.Ser1026Arg missense ADAMTSL4 34 83170 4.08801E-4 41585 0 2.55086E-4
1-150532374-G-A p.Gln1027Gln synonymous ADAMTSL4 4 83160 4.81E-5 41580 0 1.40359E-4
1-150532375-C-T p.Arg1028Cys missense ADAMTSL4 4 83154 4.81035E-5 41577 0 0.001875
1-150532376-G-A p.Arg1028His missense ADAMTSL4 1530 83128 0.0184053 41564 21 0.0158525
1-150532380-T-C p.Pro1029Pro splice_region+synonymous ADAMTSL4 2 83160 2.405E-5 41580 0 8.25723E-6
1-150532389-G-T c.3088+8G>T splice_region ADAMTSL4 1 83158 1.20253E-5 41579 0 NA
1-150532529-T-C c.3089-7T>C splice_region ADAMTSL4 1 82992 1.20494E-5 41496 0 3.98537E-6
1-150532529-T-A c.3089-7T>A splice_region ADAMTSL4 1 82994 1.20491E-5 41497 0 NA
1-150532531-C-T c.3089-5C>T splice_region ADAMTSL4 2 83030 2.40877E-5 41515 0 NA
1-150532576-G-T p.Val1043Val synonymous ADAMTSL4 1 83110 1.20322E-5 41555 0 NA
1-150532586-C-A p.Arg1047Arg synonymous ADAMTSL4 506 83104 0.00608876 41552 5 0.0126586
1-150532587-G-A p.Arg1047Gln missense ADAMTSL4 3 83106 3.60985E-5 41553 0 4.94478E-5
1-150532595-G-A p.Val1050Ile missense ADAMTSL4 8 83130 9.62348E-5 41565 1 0.00100705
1-150532598-T-C p.Tyr1051His missense ADAMTSL4 1 83140 1.20279E-5 41570 0 NA
1-150532602-C-T p.Pro1052Leu missense ADAMTSL4 17 83158 2.0443E-4 41579 0 9.94376E-5
1-150532602-C-A p.Pro1052His missense ADAMTSL4 1 83158 1.20253E-5 41579 0 7.95501E-6
1-150532609-C-T p.Tyr1054Tyr synonymous ADAMTSL4 8 83166 9.61932E-5 41583 1 5.03525E-4
1-150532616-A-G p.Thr1057Ala missense ADAMTSL4 1 83152 1.20262E-5 41576 0 6.391E-5
1-150532618-C-T p.Thr1057Thr synonymous ADAMTSL4 18 83166 2.16435E-4 41583 0 5.7387E-4
1-150532621-TTGCC-T p.Cys1059fs frameshift ADAMTSL4 1 83166 1.20241E-5 41583 0 NA
1-150532625-C-G p.Arg1060Gly missense ADAMTSL4 65 83162 7.81607E-4 41581 2 0.011875
1-150532626-G-A p.Arg1060His missense ADAMTSL4 34 83156 4.0887E-4 41578 0 0.00116296
1-150532633-C-T p.Cys1062Cys synonymous ADAMTSL4 2 83184 2.40431E-5 41592 0 4.77293E-5
1-150532636-A-C p.Ala1063Ala synonymous ADAMTSL4 8 83190 9.61654E-5 41595 0 9.9005E-5
1-150532639-T-C p.His1064His synonymous ADAMTSL4 1 83198 1.20195E-5 41599 0 NA
1-150532646-G-C p.Glu1067Gln missense ADAMTSL4 2 83196 2.40396E-5 41598 0 6.37755E-5
1-150532649-C-T p.Arg1068Trp missense ADAMTSL4 2 83184 2.40431E-5 41592 0 3.18817E-5
1-150532650-G-A p.Arg1068Gln missense ADAMTSL4 3 83190 3.6062E-5 41595 0 8.26187E-6
1-150532657-C-G p.Pro1070Pro synonymous ADAMTSL4 2 83190 2.40414E-5 41595 0 7.95843E-6