Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
15-100514610-C-T p.Ser1095Ser synonymous ADAMTS17 162 83216 0.00194674 41608 0 0.0025
15-100514610-C-G p.Ser1095Ser synonymous ADAMTS17 1 83226 1.20155E-5 41613 0 3.97905E-6
15-100514610-C-A p.Ser1095Ser synonymous ADAMTS17 1 83226 1.20155E-5 41613 0 3.18573E-5
15-100514611-G-A p.Ser1095Leu missense ADAMTS17 2 83226 2.4031E-5 41613 0 3.18613E-5
15-100514613-GT-AC p.Asn1094Ser missense ADAMTS17 1 83224 1.20158E-5 41612 0 NA
15-100514613-G-A p.Asn1094Asn synonymous ADAMTS17 1 83224 1.20158E-5 41612 0 NA
15-100514614-T-C p.Asn1094Ser missense ADAMTS17 53711 82114 0.654103 41057 17706 0.711617
15-100514614-T-G p.Asn1094Thr missense ADAMTS17 1 83228 1.20152E-5 41614 0 8.24266E-6
15-100514617-G-A p.Pro1093Leu missense ADAMTS17 4 83210 4.80711E-5 41605 0 4.94698E-5
15-100514617-G-T p.Pro1093Gln missense ADAMTS17 1 83210 1.20178E-5 41605 0 NA
15-100514619-C-T p.Pro1092Pro synonymous ADAMTS17 4 83222 4.80642E-5 41611 0 0.00100705
15-100514620-G-A p.Pro1092Leu missense ADAMTS17 19 83218 2.28316E-4 41609 0 5.09189E-4
15-100514622-T-G p.Pro1091Pro synonymous ADAMTS17 30 83186 3.60638E-4 41593 0 8.60366E-4
15-100514629-C-T p.Arg1089His missense ADAMTS17 2 83160 2.405E-5 41580 0 1.19338E-5
15-100514630-G-A p.Arg1089Cys missense ADAMTS17 4 83196 4.80792E-5 41598 0 4.12018E-5
15-100514632-A-T p.Met1088Lys missense ADAMTS17 1 83204 1.20187E-5 41602 0 3.18573E-5
15-100514635-T-C p.Lys1087Arg missense ADAMTS17 1 83242 1.20132E-5 41621 0 NA
15-100514644-T-C p.Tyr1084Cys missense ADAMTS17 1 83232 1.20146E-5 41616 0 8.23873E-6
15-100514651-C-T p.Asp1082Asn missense ADAMTS17 1 83222 1.20161E-5 41611 0 3.97659E-6
15-100514652-C-G p.Arg1081Ser missense ADAMTS17 2 83218 2.40333E-5 41609 0 8.23859E-6
15-100514657-A-C p.Cys1080Gly missense ADAMTS17 2 83226 2.4031E-5 41613 0 3.29527E-5
15-100514665-C-G p.Cys1077Ser missense ADAMTS17 1 83230 1.20149E-5 41615 0 NA
15-100514673-C-T p.Gln1074Gln synonymous ADAMTS17 1 83212 1.20175E-5 41606 0 NA
15-100514676-G-A p.Tyr1073Tyr synonymous ADAMTS17 906 83194 0.0108902 41597 31 0.0218527
15-100514680-C-A p.Trp1072Leu missense ADAMTS17 1 83198 1.20195E-5 41599 0 NA
15-100514682-C-T p.Arg1071Arg synonymous ADAMTS17 1 83184 1.20215E-5 41592 0 NA
15-100514683-C-T p.Arg1071Gln missense ADAMTS17 5 83178 6.0112E-5 41589 0 1.64747E-4
15-100514684-G-T p.Arg1071Arg synonymous ADAMTS17 2 83172 2.40466E-5 41586 0 7.95317E-6
15-100514684-G-A p.Arg1071Trp missense ADAMTS17 5 83172 6.01164E-5 41586 0 4.37424E-5
15-100514690-C-G p.Asp1069His missense ADAMTS17 2 83168 2.40477E-5 41584 0 3.97655E-6
15-100514692-T-G p.Gln1068Pro missense ADAMTS17 11 83166 1.32266E-4 41583 0 3.50207E-4
15-100514694-G-A p.Cys1067Cys synonymous ADAMTS17 1 83148 1.20267E-5 41574 0 NA
15-100514694-G-C p.Cys1067Trp missense ADAMTS17 1 83148 1.20267E-5 41574 0 NA
15-100514703-C-G p.Lys1064Asn missense ADAMTS17 1 83120 1.20308E-5 41560 0 8.23696E-6
15-100514708-C-A p.Glu1063* stop_gained ADAMTS17 1 83054 1.20404E-5 41527 0 3.97687E-6
15-100514710-C-T p.Arg1062Gln missense ADAMTS17 7 83030 8.43069E-5 41515 0 1.27413E-4
15-100514719-C-T p.Arg1059Gln missense ADAMTS17 3 82934 3.61733E-5 41467 0 1.07082E-4
15-100514720-G-A p.Arg1059Trp missense ADAMTS17 6 82948 7.23345E-5 41474 0 4.77262E-5
15-100514727-T-C p.Val1056Val synonymous ADAMTS17 1 82856 1.20691E-5 41428 0 3.9776E-6
15-100514730-C-T p.Thr1055Thr synonymous ADAMTS17 9 82798 1.08698E-4 41399 1 5.03525E-4
15-100514730-C-G p.Thr1055Thr synonymous ADAMTS17 12 82798 1.44931E-4 41399 0 3.58007E-5
15-100514730-C-CGTCCACTGGTCTCGTGTGCATTTGTAGGTCAGAGCAGCTAAGGG p.Val1056fs frameshift ADAMTS17 2 82798 2.41552E-5 41399 0 3.97785E-6
15-100514730-C-A p.Thr1055Thr synonymous ADAMTS17 1 82798 1.20776E-5 41399 0 NA
15-100514731-G-A p.Thr1055Met missense ADAMTS17 16 82754 1.93344E-4 41377 0 1.64745E-4
15-100514743-C-T p.Arg1051Gln missense ADAMTS17 6 82478 7.27467E-5 41239 0 5.76625E-5
15-100514757-G-A p.Thr1046Thr synonymous ADAMTS17 534 82126 0.0065022 41063 7 0.0122285
15-100514757-G-C p.Thr1046Thr synonymous ADAMTS17 9 82144 1.09564E-4 41072 0 1.59226E-4
15-100514773-G-A c.3128-6C>T splice_region ADAMTS17 4 81746 4.89321E-5 40873 0 2.71887E-4
15-100516245-C-T c.3127+5G>A splice_region ADAMTS17 1 78838 1.26842E-5 39419 0 NA
15-100516254-G-T p.Arg1041Arg synonymous ADAMTS17 69 79058 8.72777E-4 39529 2 0.00184713
15-100516255-C-T p.Arg1041His missense ADAMTS17 2 79082 2.52902E-5 39541 0 1.94006E-5
15-100516255-CG-C p.Arg1041fs frameshift ADAMTS17 1 79082 1.26451E-5 39541 0 NA
15-100516255-C-CG p.Arg1041fs frameshift ADAMTS17 1 79082 1.26451E-5 39541 0 NA
15-100516256-G-A p.Arg1041Cys missense ADAMTS17 10 79168 1.26314E-4 39584 0 1.59307E-4
15-100516256-G-T p.Arg1041Ser missense ADAMTS17 1 79168 1.26314E-5 39584 0 3.86817E-5
15-100516256-G-C p.Arg1041Gly missense ADAMTS17 1 79170 1.2631E-5 39585 0 1.28939E-5
15-100516257-G-T p.Pro1040Pro synonymous ADAMTS17 1 79242 1.26196E-5 39621 0 NA
15-100516257-G-A p.Pro1040Pro synonymous ADAMTS17 1 79242 1.26196E-5 39621 0 0.00173611
15-100516259-G-C p.Pro1040Ala missense ADAMTS17 1 79324 1.26065E-5 39662 0 6.42401E-6
15-100516262-A-G p.Ser1039Pro missense ADAMTS17 1 79346 1.2603E-5 39673 0 0.00177725
15-100516264-G-A p.Thr1038Ile missense ADAMTS17 2 79552 2.51408E-5 39776 0 6.41445E-6
15-100516273-T-C p.Asn1035Ser missense ADAMTS17 1 79930 1.25109E-5 39965 0 NA
15-100516277-C-T p.Ala1034Thr missense ADAMTS17 4 79938 5.00388E-5 39969 0 6.37186E-5
15-100516278-G-A p.Asn1033Asn synonymous ADAMTS17 5 80034 6.24734E-5 40017 0 1.02338E-4
15-100516288-T-C p.Asp1030Gly missense ADAMTS17 1 80196 1.24694E-5 40098 0 NA
15-100516289-C-T p.Asp1030Asn missense ADAMTS17 4 80218 4.98641E-5 40109 0 6.25E-4
15-100516309-C-T p.Cys1023Tyr missense ADAMTS17 2 80378 2.48824E-5 40189 0 3.18471E-5
15-100516320-G-A p.Pro1019Pro synonymous ADAMTS17 2 80410 2.48725E-5 40205 0 6.40631E-5
15-100516321-G-C p.Pro1019Arg missense ADAMTS17 1 80412 1.2436E-5 40206 0 3.18512E-5
15-100516323-G-A p.Ala1018Ala synonymous ADAMTS17 1 80408 1.24366E-5 40204 0 1.92322E-5
15-100516324-G-A p.Ala1018Val missense ADAMTS17 1 80382 1.24406E-5 40191 0 0.00232829
15-100516328-G-C p.Pro1017Ala missense ADAMTS17 1 80432 1.24329E-5 40216 0 NA
15-100516329-C-T p.Lys1016Lys synonymous ADAMTS17 1 80440 1.24316E-5 40220 0 NA
15-100516333-G-A p.Ser1015Leu missense ADAMTS17 83 80534 0.00103062 40267 0 9.87513E-4
15-100516337-G-T p.Leu1014Ile missense ADAMTS17 1 80594 1.24079E-5 40297 0 1.28487E-5
15-100516341-G-A p.Pro1012Pro synonymous ADAMTS17 1 80594 1.24079E-5 40297 0 6.43211E-6
15-100516349-C-T p.Glu1010Lys missense ADAMTS17 32 80682 3.96619E-4 40341 0 0.00120919
15-100516350-G-A p.Ser1009Ser synonymous ADAMTS17 2 80680 2.47893E-5 40340 0 1.28727E-5
15-100516354-C-A p.Gly1008Val missense ADAMTS17 2 80730 2.47739E-5 40365 0 NA
15-100516355-C-T p.Gly1008Ser missense ADAMTS17 1 80734 1.23864E-5 40367 0 9.55657E-5
15-100516356-G-A p.His1007His synonymous ADAMTS17 2 80764 2.47635E-5 40382 0 3.22236E-5
15-100516360-C-T p.Arg1006His missense ADAMTS17 11 80768 1.36193E-4 40384 0 4.9169E-4
15-100516361-G-A p.Arg1006Cys missense ADAMTS17 2 80762 2.47641E-5 40381 0 0.00123001
15-100516362-C-T p.Gly1005Gly synonymous ADAMTS17 1 80814 1.23741E-5 40407 0 2.57682E-5
15-100516368-G-A p.Val1003Val synonymous ADAMTS17 1 80818 1.23735E-5 40409 0 4.90773E-5
15-100516371-C-G p.Lys1002Asn missense ADAMTS17 2 80832 2.47427E-5 40416 0 NA
15-100516412-C-T p.Gly989Arg missense ADAMTS17 3 80590 3.72255E-5 40295 0 3.18532E-5
15-100516416-G-A p.Thr987Thr synonymous ADAMTS17 1 80514 1.24202E-5 40257 0 NA
15-100516419-C-T p.Ser986Ser synonymous ADAMTS17 3 80452 3.72893E-5 40226 0 3.18654E-5
15-100516419-C-G p.Ser986Ser synonymous ADAMTS17 2 80452 2.48595E-5 40226 0 1.27462E-4
15-100516420-G-A p.Ser986Leu missense ADAMTS17 4 80410 4.97451E-5 40205 0 5.06022E-5
15-100516422-C-T p.Ser985Ser synonymous ADAMTS17 53 80428 6.58974E-4 40214 2 0.0019305
15-100516425-G-A p.Cys984Cys splice_region+synonymous ADAMTS17 1 80360 1.2444E-5 40180 0 NA
15-100516432-A-G c.2950-5T>C splice_region ADAMTS17 1 80254 1.24604E-5 40127 0 5.08751E-5
15-100516432-AGAGACAGGACAGCCTGAGTGGGGCTGACATGAGGTCAAGGGACTGGGATGATGGCCTCACAATGTGGCACTGCG-A c.2950-79_2950-6delCGCAGTGCCACATTGTGAGGCCATCATCCCAGTCCCTTGACCTCATGTCAGCCCCACTCAGGCTGTCCTGTCTC splice_region ADAMTS17 1 80252 1.24607E-5 40126 0 2.56131E-4
15-100516433-G-A c.2950-6C>T splice_region ADAMTS17 3 80246 3.7385E-5 40123 0 NA
15-100533253-C-T p.Thr983Thr splice_region+synonymous ADAMTS17 1 83102 1.20334E-5 41551 0 1.19355E-5
15-100533254-G-A p.Thr983Met missense+splice_region ADAMTS17 29 83114 3.48918E-4 41557 0 0.00100705
15-100533265-C-T p.Gly979Gly synonymous ADAMTS17 15 83214 1.80258E-4 41607 0 3.29745E-5
15-100533266-CCA-C p.Asp980fs frameshift ADAMTS17 1 83212 1.20175E-5 41606 0 NA
15-100533271-T-C p.Lys977Lys synonymous ADAMTS17 1 83214 1.20172E-5 41607 0 NA
15-100533279-C-T p.Glu975Lys missense ADAMTS17 1 83222 1.20161E-5 41611 0 1.64856E-5
15-100533280-G-A p.Tyr974Tyr synonymous ADAMTS17 1 83232 1.20146E-5 41616 0 NA
15-100533301-G-A p.Cys967Cys synonymous ADAMTS17 167 83220 0.00200673 41610 0 0.00328276
15-100533306-C-T p.Ala966Thr missense ADAMTS17 1 83254 1.20114E-5 41627 0 NA
15-100533312-C-T p.Glu964Lys missense ADAMTS17 14 83250 1.68168E-4 41625 0 2.22973E-4
15-100533315-C-T p.Ala963Thr missense ADAMTS17 1 83242 1.20132E-5 41621 0 NA
15-100533319-C-T p.Pro961Pro synonymous ADAMTS17 1 83234 1.20143E-5 41617 0 3.97716E-5
15-100533325-C-T p.Thr959Thr synonymous ADAMTS17 15 83270 1.80137E-4 41635 0 0.00151057
15-100533326-G-A p.Thr959Met missense ADAMTS17 3 83256 3.60334E-5 41628 0 6.25E-4
15-100533333-C-T p.Ala957Thr missense ADAMTS17 2 83264 2.402E-5 41632 0 1.19298E-5
15-100533334-G-A p.Asp956Asp synonymous ADAMTS17 16 83262 1.92164E-4 41631 0 1.40079E-4
15-100533336-C-T p.Asp956Asn missense ADAMTS17 1 83260 1.20106E-5 41630 0 1.64796E-5
15-100533341-T-C p.Lys954Arg missense ADAMTS17 1 83274 1.20085E-5 41637 0 NA
15-100533358-G-A p.Cys948Cys synonymous ADAMTS17 1 83268 1.20094E-5 41634 0 6.37105E-5
15-100533361-C-T p.Ala947Ala synonymous ADAMTS17 2 83278 2.40159E-5 41639 0 3.18613E-5
15-100533362-G-A p.Ala947Val missense ADAMTS17 3 83278 3.60239E-5 41639 0 1.27437E-4
15-100533366-C-T p.Val946Met missense ADAMTS17 3 83292 3.60179E-5 41646 0 3.29582E-5
15-100533371-C-T p.Arg944Gln missense ADAMTS17 1 83286 1.20068E-5 41643 0 8.23913E-6
15-100533382-C-T p.Gly940Gly synonymous ADAMTS17 1 83284 1.20071E-5 41642 0 6.59141E-5
15-100533389-C-T p.Gly938Asp missense ADAMTS17 3 83272 3.60265E-5 41636 0 2.47178E-5
15-100533391-A-G p.Cys937Cys synonymous ADAMTS17 1 83262 1.20103E-5 41631 0 3.97636E-6
15-100533403-G-A p.Cys933Cys splice_region+synonymous ADAMTS17 48 83252 5.76563E-4 41626 0 0.003125
15-100533412-G-A c.2797-7C>T splice_region ADAMTS17 1 83234 1.20143E-5 41617 0 3.97678E-6
15-100537605-C-T p.Ala927Ala synonymous ADAMTS17 1 81902 1.22097E-5 40951 0 3.18613E-5
15-100537606-G-A p.Ala927Val missense ADAMTS17 2 81908 2.44176E-5 40954 0 8.03374E-6
15-100537618-G-C p.Ser923Cys missense ADAMTS17 2 82046 2.43766E-5 41023 0 2.00531E-5
15-100537624-C-T p.Cys921Tyr missense ADAMTS17 3 82154 3.65168E-5 41077 0 4.00933E-6
15-100537628-C-T p.Asp920Asn missense ADAMTS17 1 82216 1.21631E-5 41108 0 NA
15-100537629-C-T p.Gln919Gln synonymous ADAMTS17 1 82218 1.21628E-5 41109 0 0.00125
15-100537633-C-T p.Gly918Asp missense ADAMTS17 1 82234 1.21604E-5 41117 0 1.6704E-5
15-100537651-G-A p.Ala912Val missense ADAMTS17 3 82452 3.63848E-5 41226 0 3.18674E-5
15-100537653-C-T p.Ala911Ala synonymous ADAMTS17 10 82444 1.21294E-4 41222 0 0.00100705
15-100537654-G-A p.Ala911Val missense ADAMTS17 10 82432 1.21312E-4 41216 0 6.25E-4
15-100537656-C-T p.Pro910Pro synonymous ADAMTS17 28 82454 3.39583E-4 41227 0 0.00100705
15-100537657-G-A p.Pro910Leu missense ADAMTS17 2 82494 2.42442E-5 41247 0 1.20435E-5
15-100537660-C-T p.Arg909Gln missense ADAMTS17 13 82542 1.57496E-4 41271 0 1.27502E-4
15-100537661-G-A p.Arg909Trp missense ADAMTS17 2 82586 2.42172E-5 41293 0 2.53011E-5
15-100537668-C-T p.Pro906Pro synonymous ADAMTS17 3 82626 3.63082E-5 41313 0 1.27535E-4
15-100537669-G-A p.Pro906Leu missense ADAMTS17 2 82664 2.41943E-5 41332 0 6.37552E-5
15-100537674-G-A p.Tyr904Tyr synonymous ADAMTS17 1 82786 1.20793E-5 41393 0 4.00596E-6
15-100537674-G-T p.Tyr904* stop_gained ADAMTS17 2 82786 2.41587E-5 41393 0 NA
15-100537682-G-A p.Pro902Ser missense ADAMTS17 1 82852 1.20697E-5 41426 0 4.00506E-6
15-100537684-C-T p.Arg901Gln missense ADAMTS17 4 82860 4.82742E-5 41430 0 5.20675E-5
15-100537685-G-A p.Arg901Trp missense ADAMTS17 1 82858 1.20688E-5 41429 0 6.80664E-5
15-100537685-G-C p.Arg901Gly missense ADAMTS17 2 82860 2.41371E-5 41430 0 2.00195E-5
15-100537686-C-T p.Thr900Thr synonymous ADAMTS17 194 82868 0.00234107 41434 3 0.00487696
15-100537687-G-A p.Thr900Met missense ADAMTS17 3 82890 3.61925E-5 41445 0 2.52683E-5
15-100537691-C-T p.Ala899Thr missense ADAMTS17 4 82908 4.82462E-5 41454 0 6.37146E-5
15-100537691-C-G p.Ala899Pro missense ADAMTS17 1 82908 1.20616E-5 41454 0 NA
15-100537692-G-A p.Val898Val synonymous ADAMTS17 1 82916 1.20604E-5 41458 0 3.60017E-5
15-100537693-A-G p.Val898Ala missense ADAMTS17 49 82898 5.91088E-4 41449 1 0.0025
15-100537694-C-A p.Val898Phe missense ADAMTS17 4 82920 4.82393E-5 41460 0 1.85129E-4
15-100537700-T-C p.Thr896Ala missense ADAMTS17 1 82946 1.2056E-5 41473 0 NA
15-100537703-C-T p.Gly895Ser missense ADAMTS17 3 82936 3.61725E-5 41468 0 1.83863E-4
15-100537704-G-A p.Asn894Asn synonymous ADAMTS17 2 82952 2.41103E-5 41476 0 3.18512E-5
15-100537710-C-T p.Leu892Leu synonymous ADAMTS17 4 82962 4.82148E-5 41481 0 1.19855E-5
15-100537711-A-G p.Leu892Pro missense ADAMTS17 1 82968 1.20528E-5 41484 0 NA
15-100537713-C-A p.Gln891His missense ADAMTS17 1 82970 1.20525E-5 41485 0 NA
15-100537716-G-A p.Tyr890Tyr synonymous ADAMTS17 12 82958 1.44652E-4 41479 0 5.99429E-5
15-100537717-T-A p.Tyr890Phe missense ADAMTS17 3 82936 3.61725E-5 41468 0 NA
15-100537721-C-A p.Val889Leu missense ADAMTS17 1 82930 1.20584E-5 41465 0 NA
15-100537721-C-T p.Val889Met missense ADAMTS17 4 82930 4.82335E-5 41465 0 0.0015121
15-100537748-C-G p.Gly880Arg missense ADAMTS17 1 82842 1.20712E-5 41421 0 NA
15-100537749-T-C p.Lys879Lys synonymous ADAMTS17 28 82844 3.37985E-4 41422 0 3.82531E-4
15-100537752-C-T p.Glu878Glu synonymous ADAMTS17 7 82824 8.45166E-5 41412 0 2.54842E-4
15-100537756-C-G p.Cys877Ser missense ADAMTS17 2 82754 2.4168E-5 41377 0 NA
15-100537759-G-A p.Thr876Ile missense ADAMTS17 1 82680 1.20948E-5 41340 0 4.00728E-6
15-100537761-C-T p.Ala875Ala synonymous ADAMTS17 1 82598 1.21068E-5 41299 0 2.00438E-5
15-100537762-G-C p.Ala875Gly missense ADAMTS17 3 82570 3.63328E-5 41285 0 3.18532E-5
15-100537762-G-A p.Ala875Val missense ADAMTS17 1 82570 1.21109E-5 41285 0 2.00552E-5
15-100537764-C-T p.Ser874Ser synonymous ADAMTS17 5 82502 6.06046E-5 41251 0 5.93804E-5
15-100537765-G-A p.Ser874Leu missense ADAMTS17 3 82508 3.63601E-5 41254 0 2.5447E-5
15-100537772-G-A p.Pro872Ser missense ADAMTS17 2 82318 2.4296E-5 41159 0 NA
15-100537779-C-T p.Pro869Pro synonymous ADAMTS17 39 82008 4.75563E-4 41004 0 8.59927E-4
15-100537783-C-T p.Gly868Asp missense ADAMTS17 2 81790 2.44529E-5 40895 0 NA
15-100589056-T-C c.2591+6A>G splice_region ADAMTS17 21942 81848 0.268082 40924 3286 0.305333
15-100589062-C-T p.Arg864Gln missense+splice_region ADAMTS17 1 82704 1.20913E-5 41352 0 6.3743E-5
15-100589063-G-A p.Arg864Trp missense+splice_region ADAMTS17 5 82734 6.04346E-5 41367 0 2.54907E-4
15-100589073-G-C p.Pro860Pro synonymous ADAMTS17 1 82908 1.20616E-5 41454 0 2.47154E-5
15-100589092-C-T p.Arg854Gln missense ADAMTS17 2 83084 2.4072E-5 41542 0 5.03525E-4
15-100589093-G-T p.Arg854Arg synonymous ADAMTS17 1 83076 1.20372E-5 41538 0 NA
15-100589110-C-T p.Arg848His missense ADAMTS17 2 83184 2.40431E-5 41592 0 6.37471E-5
15-100589111-G-A p.Arg848Cys missense ADAMTS17 2 83204 2.40373E-5 41602 0 1.64758E-5
15-100589116-G-A p.Ala846Val missense ADAMTS17 1 83236 1.2014E-5 41618 0 NA
15-100589125-C-T p.Cys843Tyr missense ADAMTS17 2 83248 2.40246E-5 41624 0 3.97728E-6
15-100589135-C-T p.Asp840Asn missense ADAMTS17 25 83258 3.00271E-4 41629 0 0.00127665
15-100589136-G-A p.Asn839Asn synonymous ADAMTS17 4 83254 4.80457E-5 41627 0 3.97728E-5
15-100589136-G-T p.Asn839Lys missense ADAMTS17 1 83254 1.20114E-5 41627 0 NA
15-100589152-G-C p.Thr834Ser missense ADAMTS17 6 83264 7.206E-5 41632 0 3.29527E-5
15-100589152-G-T p.Thr834Asn missense ADAMTS17 1 83264 1.201E-5 41632 0 NA
15-100589154-C-T p.Lys833Lys synonymous ADAMTS17 264 83266 0.00317056 41633 2 0.00311403
15-100589157-G-A p.Asn832Asn synonymous ADAMTS17 1 83256 1.20111E-5 41628 0 NA
15-100589158-T-C p.Asn832Ser missense ADAMTS17 1 83256 1.20111E-5 41628 0 3.977E-6
15-100589168-G-A p.Arg829Trp missense ADAMTS17 2 83226 2.4031E-5 41613 0 9.56084E-5
15-100589175-C-T p.Ser826Ser synonymous ADAMTS17 4 83192 4.80815E-5 41596 0 9.5584E-5
15-100589175-C-G p.Ser826Ser synonymous ADAMTS17 1 83192 1.20204E-5 41596 0 6.37227E-5
15-100589176-G-A p.Ser826Leu missense ADAMTS17 1 83182 1.20218E-5 41591 0 6.37146E-5
15-100589181-G-A p.Ile824Ile synonymous ADAMTS17 2224 83104 0.0267616 41552 45 0.0392749
15-100589191-C-T p.Arg821His missense ADAMTS17 6 83056 7.22404E-5 41528 0 1.81255E-4
15-100589203-A-G c.2456-6T>C splice_region ADAMTS17 1 82916 1.20604E-5 41458 0 NA
15-100589203-A-T c.2456-6T>A splice_region ADAMTS17 2 82916 2.41208E-5 41458 0 4.11957E-5
15-100591776-C-T c.2455+1G>A splice_donor ADAMTS17 1 82742 1.20858E-5 41371 0 NA
15-100591780-C-T p.Gly818Arg missense ADAMTS17 2 82844 2.41418E-5 41422 0 4.94185E-5
15-100591781-G-A p.Gly817Gly synonymous ADAMTS17 1 82876 1.20662E-5 41438 0 3.18573E-5
15-100591783-C-T p.Gly817Ser missense ADAMTS17 2 82974 2.41039E-5 41487 0 1.59209E-5
15-100591784-G-A p.Cys816Cys synonymous ADAMTS17 5 83004 6.02381E-5 41502 0 6.58913E-5
15-100591792-C-T p.Val814Met missense ADAMTS17 2 83132 2.40581E-5 41566 0 3.97962E-6
15-100591793-A-G p.Ser813Ser synonymous ADAMTS17 9 83132 1.08262E-4 41566 0 9.55779E-5
15-100591794-C-G p.Ser813Thr missense ADAMTS17 7 83138 8.41974E-5 41569 0 1.59185E-4
15-100591800-C-G p.Gly811Ala missense ADAMTS17 1 83198 1.20195E-5 41599 0 NA
15-100591801-C-A p.Gly811Trp missense ADAMTS17 8 83210 9.61423E-5 41605 0 3.18319E-5
15-100591810-C-T p.Gly808Ser missense ADAMTS17 4 83268 4.80377E-5 41634 0 3.29462E-5
15-100591811-G-A p.Ser807Ser synonymous ADAMTS17 1 83276 1.20083E-5 41638 0 3.29462E-5
15-100591818-G-T p.Thr805Asn missense ADAMTS17 1 83284 1.20071E-5 41642 0 8.23655E-6
15-100591825-T-G p.Ile803Leu missense ADAMTS17 1 83324 1.20013E-5 41662 0 1.1531E-4
15-100591836-T-C p.Asp799Gly missense ADAMTS17 1 83344 1.19985E-5 41672 0 8.23642E-6
15-100591841-C-A p.Pro797Pro synonymous ADAMTS17 4 83338 4.79973E-5 41669 0 3.18431E-5
15-100591841-C-T p.Pro797Pro synonymous ADAMTS17 3 83338 3.5998E-5 41669 0 3.18431E-5
15-100591842-G-A p.Pro797Leu missense ADAMTS17 13 83340 1.55988E-4 41670 0 2.22944E-4
15-100591846-T-C p.Lys796Glu missense ADAMTS17 5 83356 5.99837E-5 41678 0 NA
15-100591853-T-A p.Glu793Asp missense ADAMTS17 1 83344 1.19985E-5 41672 0 2.47093E-5
15-100591855-C-T p.Glu793Lys missense ADAMTS17 2 83350 2.39952E-5 41675 0 6.58924E-5
15-100591856-G-A p.Ser792Ser synonymous ADAMTS17 1 83346 1.19982E-5 41673 0 4.94201E-5
15-100591857-C-G p.Ser792Thr missense ADAMTS17 2 83348 2.39958E-5 41674 0 6.37024E-5
15-100591860-T-C p.Gln791Arg missense ADAMTS17 5 83352 5.99866E-5 41676 0 6.25E-4
15-100591867-C-T p.Glu789Lys missense ADAMTS17 1 83344 1.19985E-5 41672 0 1.27364E-4
15-100591868-C-T p.Ala788Ala synonymous ADAMTS17 7 83344 8.39893E-5 41672 0 1.8121E-4
15-100591876-G-A p.Arg786Cys missense ADAMTS17 6 83344 7.19908E-5 41672 0 5.96488E-5
15-100591884-G-A p.Pro783Leu missense ADAMTS17 37 83338 4.43975E-4 41669 0 0.00121042
15-100591884-G-C p.Pro783Arg missense ADAMTS17 1 83340 1.1999E-5 41670 0 8.23669E-6
15-100591915-C-T p.Asp773Asn missense ADAMTS17 1 83346 1.19982E-5 41673 0 3.18532E-5
15-100591916-T-C p.Gln772Gln synonymous ADAMTS17 2 83344 2.39969E-5 41672 0 4.11868E-5
15-100591920-TC-AA p.Asp771Phe missense ADAMTS17 3 83336 3.59988E-5 41668 0 NA
15-100591921-C-T p.Asp771Asn missense ADAMTS17 3 83336 3.59988E-5 41668 0 4.11875E-5
15-100591922-G-A p.His770His synonymous ADAMTS17 2 83332 2.40004E-5 41666 0 6.25E-4
15-100591933-A-C p.Leu767Val missense ADAMTS17 1 83326 1.20011E-5 41663 0 8.23954E-6
15-100591943-C-G c.2296-7G>C splice_region ADAMTS17 1 83320 1.20019E-5 41660 0 1.64832E-5
15-100594099-T-C c.2295+3A>G splice_region ADAMTS17 1 83360 1.19962E-5 41680 0 8.23642E-6
15-100594108-G-A p.His763His synonymous ADAMTS17 2 83374 2.39883E-5 41687 0 9.5584E-5
15-100594114-C-A p.Pro761Pro synonymous ADAMTS17 1 83374 1.19941E-5 41687 0 3.97643E-6
15-100594114-C-T p.Pro761Pro synonymous ADAMTS17 2 83374 2.39883E-5 41687 0 9.55901E-5
15-100594115-G-T p.Pro761Gln missense ADAMTS17 2 83378 2.39871E-5 41689 0 9.55962E-5
15-100594118-A-G p.Leu760Pro missense ADAMTS17 1 83380 1.19933E-5 41690 0 NA
15-100594142-ATCT-A p.Lys751del disruptive_inframe_deletion ADAMTS17 1 83388 1.19921E-5 41694 0 3.97624E-6
15-100594156-C-T p.Gly747Gly synonymous ADAMTS17 1 83394 1.19913E-5 41697 0 1.64728E-5
15-100594167-C-T p.Val744Met missense ADAMTS17 1 83398 1.19907E-5 41699 0 8.23642E-6
15-100594172-C-T p.Arg742His missense ADAMTS17 8 83394 9.59302E-5 41697 0 1.27413E-4
15-100594173-G-A p.Arg742Cys missense ADAMTS17 7 83396 8.39369E-5 41698 0 5.03525E-4
15-100594189-A-C p.Ile736Met missense ADAMTS17 1 83390 1.19918E-5 41695 0 3.29462E-5
15-100594212-C-T p.Glu729Lys missense ADAMTS17 1 83392 1.19916E-5 41696 0 4.11834E-5
15-100594212-C-G p.Glu729Gln missense ADAMTS17 1 83392 1.19916E-5 41696 0 NA
15-100594213-T-C p.Ile728Met missense ADAMTS17 1 83392 1.19916E-5 41696 0 2.47101E-5
15-100594226-C-T p.Ser724Asn missense ADAMTS17 212 83380 0.00254258 41690 2 0.00509781
15-100594227-T-A p.Ser724Cys missense ADAMTS17 1 83380 1.19933E-5 41690 0 3.97624E-6
15-100594233-T-C p.Ile722Val missense ADAMTS17 5 83380 5.99664E-5 41690 0 5.03525E-4
15-100594242-T-C p.Lys719Glu missense ADAMTS17 3 83356 3.59902E-5 41678 0 4.94315E-5
15-100594243-AC-A p.Gly718fs frameshift ADAMTS17 1 83356 1.19967E-5 41678 0 NA
15-100594244-C-T p.Gly718Asp missense ADAMTS17 3 83354 3.59911E-5 41677 0 3.18593E-5
15-100594246-C-A p.Ser717Ser synonymous ADAMTS17 1 83342 1.19988E-5 41671 0 3.97633E-6
15-100594246-C-T p.Ser717Ser synonymous ADAMTS17 1 83342 1.19988E-5 41671 0 3.18695E-5
15-100594247-G-A p.Ser717Leu missense ADAMTS17 26 83340 3.11975E-4 41670 0 0.00258192
15-100594257-G-A p.Leu714Phe missense+splice_region ADAMTS17 1 83318 1.20022E-5 41659 0 3.18573E-5
15-100603885-C-T p.Leu106Leu splice_region+synonymous ADAMTS17 3 77666 3.86269E-5 38833 0 8.01154E-5
15-100603894-G-A p.His103His synonymous ADAMTS17 1 77672 1.28747E-5 38836 0 2.90947E-5
15-100603896-G-A p.His103Tyr missense ADAMTS17 2 77690 2.57433E-5 38845 0 7.04225E-5
15-100603898-G-A p.Ala102Val missense ADAMTS17 17 77690 2.18818E-4 38845 0 4.94416E-4
15-100603899-C-A p.Ala102Ser missense ADAMTS17 2 77680 2.57467E-5 38840 0 7.0373E-5
15-100603907-T-C p.Asp99Gly missense ADAMTS17 1 77696 1.28707E-5 38848 0 7.26417E-6
15-100603919-C-G p.Arg95Pro missense ADAMTS17 1 77730 1.2865E-5 38865 0 NA
15-100603919-C-T p.Arg95His missense ADAMTS17 1 77730 1.2865E-5 38865 0 7.97587E-5
15-100603920-G-A p.Arg95Cys missense ADAMTS17 1 77732 1.28647E-5 38866 0 1.39958E-4
15-100603928-C-T p.Arg92Gln missense ADAMTS17 2 77744 2.57255E-5 38872 0 NA
15-100603929-G-A p.Arg92Trp missense ADAMTS17 1 77738 1.28637E-5 38869 0 3.18654E-5
15-100603934-C-G p.Gly90Ala missense ADAMTS17 3 77758 3.85812E-5 38879 0 NA
15-100603947-C-T p.Val86Ile missense ADAMTS17 1 77766 1.28591E-5 38883 0 2.17165E-5
15-100603948-G-A p.Ala85Ala synonymous ADAMTS17 23 77762 2.95774E-4 38881 0 0.00422028
15-100603957-G-A p.Ile82Ile synonymous ADAMTS17 1 77752 1.28614E-5 38876 0 6.91276E-5
15-100603962-A-G p.Tyr81His missense+splice_region ADAMTS17 1 77758 1.28604E-5 38879 0 NA
15-100603964-C-T p.Gly80Asp missense+splice_region ADAMTS17 1 77746 1.28624E-5 38873 0 NA
15-100636558-C-A c.2137+3G>T splice_region ADAMTS17 5 83228 6.00759E-5 41614 0 1.19565E-5
15-100636563-G-C p.Thr712Arg missense+splice_region ADAMTS17 1 83240 1.20135E-5 41620 0 7.96819E-6
15-100636565-C-T p.Gly711Gly synonymous ADAMTS17 1 83244 1.20129E-5 41622 0 3.98406E-6
15-100636566-C-T p.Gly711Glu missense ADAMTS17 1 83246 1.20126E-5 41623 0 NA
15-100636570-G-A p.Arg710Trp missense ADAMTS17 2 83250 2.4024E-5 41625 0 3.30606E-5
15-100636570-G-C p.Arg710Gly missense ADAMTS17 1 83250 1.2012E-5 41625 0 3.9826E-6
15-100636573-C-A p.Ala709Ser missense ADAMTS17 2 83258 2.40217E-5 41629 0 1.65218E-5
15-100636573-C-T p.Ala709Thr missense ADAMTS17 3 83258 3.60326E-5 41629 0 4.95655E-5
15-100636574-G-A p.His708His synonymous ADAMTS17 4 83264 4.804E-5 41632 0 6.3678E-5
15-100636585-C-T p.Asp705Asn missense ADAMTS17 9 83252 1.08106E-4 41626 0 8.25518E-6
15-100636586-G-A p.Gly704Gly synonymous ADAMTS17 13696 83100 0.164813 41550 1310 0.195174
15-100636587-C-T p.Gly704Asp missense ADAMTS17 8 83260 9.60846E-5 41630 0 1.1937E-4
15-100636589-C-T p.Lys703Lys synonymous ADAMTS17 88 83272 0.00105678 41636 0 6.4452E-4
15-100636612-C-T p.Gly696Ser missense ADAMTS17 7 83228 8.41063E-5 41614 0 3.18532E-5
15-100636613-G-A p.Asp695Asp synonymous ADAMTS17 5 83216 6.00846E-5 41608 0 3.18269E-5
15-100636623-C-A p.Cys692Phe missense ADAMTS17 2 83252 2.40234E-5 41626 0 3.97763E-6
15-100636627-C-A p.Val691Phe missense ADAMTS17 1 83276 1.20083E-5 41638 0 NA
15-100636630-C-T p.Gly690Arg missense ADAMTS17 3 83280 3.60231E-5 41640 0 8.24416E-6
15-100636631-G-A p.Cys689Cys synonymous ADAMTS17 2 83272 2.40177E-5 41636 0 3.18471E-5
15-100636651-C-T p.Ala683Thr missense ADAMTS17 1 83300 1.20048E-5 41650 0 6.76073E-5
15-100636656-C-T p.Gly681Glu missense ADAMTS17 2 83310 2.40067E-5 41655 0 NA
15-100636657-C-G p.Gly681Arg missense ADAMTS17 1 83312 1.20031E-5 41656 0 NA
15-100636658-G-A p.Ile680Ile synonymous ADAMTS17 8 83310 9.60269E-5 41655 0 3.2963E-5
15-100636666-C-T p.Gly678Ser missense ADAMTS17 3 83324 3.6004E-5 41662 0 3.29614E-5
15-100636667-G-A p.Asp677Asp synonymous ADAMTS17 2 83322 2.40033E-5 41661 0 3.18593E-5
15-100636672-A-G p.Cys676Arg missense ADAMTS17 1 83332 1.20002E-5 41666 0 1.59065E-5
15-100636675-C-T p.Gly675Ser missense ADAMTS17 3 83320 3.60058E-5 41660 0 1.193E-5
15-100636676-G-A p.Ile674Ile synonymous ADAMTS17 4 83324 4.80054E-5 41662 0 6.36309E-5
15-100636676-G-T p.Ile674Ile synonymous ADAMTS17 2 83324 2.40027E-5 41662 0 NA
15-100636681-T-C p.Lys673Glu missense+splice_region ADAMTS17 1 83332 1.20002E-5 41666 0 NA
15-100636684-A-G c.2017-3T>C splice_region ADAMTS17 1 83334 1.19999E-5 41667 0 8.24131E-6
15-100636686-A-G c.2017-5T>C splice_region ADAMTS17 1 83336 1.19996E-5 41668 0 NA
15-100636687-G-C c.2017-6C>G splice_region ADAMTS17 7 83332 8.40013E-5 41666 0 5.76901E-5
15-100649188-C-T c.2016+6G>A splice_region ADAMTS17 1 82234 1.21604E-5 41117 0 6.25E-4
15-100649189-G-A c.2016+5C>T splice_region ADAMTS17 1 82256 1.21572E-5 41128 0 8.25573E-6
15-100649203-G-C p.Gly669Gly synonymous ADAMTS17 1 82502 1.21209E-5 41251 0 NA
15-100649206-G-A p.His668His synonymous ADAMTS17 5 82534 6.05811E-5 41267 0 7.42954E-5
15-100649211-C-G p.Val667Leu missense ADAMTS17 1 82602 1.21062E-5 41301 0 8.25518E-6
15-100649211-C-T p.Val667Met missense ADAMTS17 3 82602 3.63187E-5 41301 0 6.36699E-5
15-100649215-G-T p.Leu665Leu synonymous ADAMTS17 1 82652 1.20989E-5 41326 0 NA
15-100649217-G-T p.Leu665Ile missense ADAMTS17 1 82670 1.20963E-5 41335 0 3.18431E-5
15-100649218-A-T p.Asp664Glu missense ADAMTS17 2 82668 2.41932E-5 41334 0 9.55779E-5
15-100649221-A-G p.Thr663Thr synonymous ADAMTS17 15 82698 1.81383E-4 41349 0 4.77555E-4
15-100649225-T-C p.Glu662Gly missense ADAMTS17 8 82710 9.67235E-5 41355 0 3.18573E-5
15-100649229-A-G p.Tyr661His missense ADAMTS17 24 82718 2.90142E-4 41359 1 1.47274E-4
15-100649230-G-A p.Pro660Pro synonymous ADAMTS17 1 82728 1.20878E-5 41364 0 8.262E-6
15-100649235-C-G p.Gly659Arg missense ADAMTS17 1 82684 1.20942E-5 41342 0 NA
15-100649236-G-A p.Cys658Cys synonymous ADAMTS17 2 82682 2.41891E-5 41341 0 8.26556E-6
15-100649236-G-T p.Cys658* stop_gained ADAMTS17 1 82682 1.20945E-5 41341 0 NA
15-100649239-G-C p.Pro657Pro synonymous ADAMTS17 7 82688 8.46556E-5 41344 1 1.07484E-4
15-100649241-G-T p.Pro657Thr missense ADAMTS17 1 82686 1.20939E-5 41343 0 NA
15-100649242-T-C p.Thr656Thr synonymous ADAMTS17 1 82678 1.20951E-5 41339 0 0.00100705
15-100649243-G-A p.Thr656Ile missense ADAMTS17 3 82702 3.62748E-5 41351 0 NA
15-100649248-G-A p.Asp654Asp synonymous ADAMTS17 6935 82368 0.0841953 41184 317 0.11279
15-100649257-C-T p.Arg651Arg synonymous ADAMTS17 1 82556 1.2113E-5 41278 0 NA
15-100649262-C-T p.Asp650Asn missense ADAMTS17 2 82478 2.42489E-5 41239 0 6.36943E-5
15-100649262-C-G p.Asp650His missense ADAMTS17 2 82478 2.42489E-5 41239 0 6.36943E-5
15-100649262-C-A p.Asp650Tyr missense ADAMTS17 1 82478 1.21244E-5 41239 0 5.03525E-4
15-100649263-G-A p.Ala649Ala synonymous ADAMTS17 4 82470 4.85025E-5 41235 0 3.18451E-5
15-100649265-C-T p.Ala649Thr missense ADAMTS17 1 82464 1.21265E-5 41232 0 NA
15-100649274-G-C p.Leu646Val missense ADAMTS17 3 82404 3.6406E-5 41202 0 1.10002E-4
15-100649277-G-A p.Pro645Ser missense ADAMTS17 1 82346 1.21439E-5 41173 0 NA
15-100649280-A-ACTCCTT p.Glu643_Ser644insLysGlu conservative_inframe_insertion ADAMTS17 56 82294 6.80487E-4 41147 0 0.00146674
15-100649287-C-T p.Gly641Gly synonymous ADAMTS17 2 82198 2.43315E-5 41099 0 8.94694E-6
15-100649289-C-T p.Gly641Arg missense ADAMTS17 5 82120 6.08865E-5 41060 0 2.22916E-4
15-100649290-G-A p.Leu640Leu synonymous ADAMTS17 6 82090 7.30905E-5 41045 0 6.37024E-5
15-100649296-C-T p.Ser638Ser synonymous ADAMTS17 3 81916 3.66229E-5 40958 0 9.55353E-5
15-100649297-G-A p.Ser638Leu missense ADAMTS17 3 81908 3.66265E-5 40954 0 6.36821E-5
15-100649299-G-A p.Cys637Cys synonymous ADAMTS17 1 81868 1.22148E-5 40934 0 6.76394E-5
15-100649326-G-A c.1889-5C>T splice_region ADAMTS17 20 80468 2.48546E-4 40234 0 6.04903E-4
15-100657052-C-T p.Asp630Asn missense+splice_region ADAMTS17 2 82952 2.41103E-5 41476 0 2.78793E-5
15-100657053-G-A p.Asp629Asp splice_region+synonymous ADAMTS17 30 82972 3.61568E-4 41486 1 0.00125
15-100657062-C-T p.Val626Val synonymous ADAMTS17 1 83106 1.20328E-5 41553 0 3.18492E-5
15-100657063-A-G p.Val626Ala missense ADAMTS17 3 83120 3.60924E-5 41560 0 6.36902E-5
15-100657064-C-G p.Val626Leu missense ADAMTS17 2 83114 2.40633E-5 41557 0 2.47317E-5
15-100657064-C-T p.Val626Met missense ADAMTS17 4 83114 4.81267E-5 41557 0 6.36983E-5
15-100657065-G-A p.Ala625Ala synonymous ADAMTS17 865 83098 0.0104094 41549 5 0.00943894
15-100657067-C-A p.Ala625Ser missense ADAMTS17 1 83144 1.20273E-5 41572 0 6.25E-4
15-100657068-T-C p.Thr624Thr synonymous ADAMTS17 1 83158 1.20253E-5 41579 0 5.03525E-4
15-100657072-A-G p.Leu623Pro missense ADAMTS17 2 83188 2.40419E-5 41594 0 1.89625E-4
15-100657076-G-C p.Leu622Val missense ADAMTS17 2 83198 2.4039E-5 41599 0 8.24511E-6
15-100657087-T-C p.Lys618Arg missense ADAMTS17 2 83194 2.40402E-5 41597 0 NA
15-100657093-C-T p.Ser616Asn missense ADAMTS17 4 83190 4.80827E-5 41595 0 NA
15-100657096-A-G p.Leu615Pro missense ADAMTS17 1 83186 1.20213E-5 41593 0 8.2526E-6
15-100657099-C-G p.Arg614Pro missense ADAMTS17 40 83172 4.80931E-4 41586 0 7.32671E-4
15-100657099-C-T p.Arg614Gln missense ADAMTS17 3 83172 3.60698E-5 41586 0 1.65082E-5
15-100657100-G-A p.Arg614Trp missense ADAMTS17 19 83168 2.28453E-4 41584 0 0.00375
15-100657103-C-T p.Asp613Asn missense ADAMTS17 2 83158 2.40506E-5 41579 0 6.25E-4
15-100657104-G-A p.His612His synonymous ADAMTS17 5 83160 6.01251E-5 41580 0 1.59215E-4
15-100657111-T-C p.Gln610Arg missense ADAMTS17 1 83136 1.20285E-5 41568 0 NA
15-100657112-G-C p.Gln610Glu missense ADAMTS17 1 83136 1.20285E-5 41568 0 8.26105E-6
15-100657116-C-A p.Gln608His missense ADAMTS17 5 83120 6.0154E-5 41560 0 NA
15-100657116-C-T p.Gln608Gln synonymous ADAMTS17 1 83120 1.20308E-5 41560 0 8.26583E-5
15-100657126-C-T p.Arg605Gln missense ADAMTS17 2 83072 2.40755E-5 41536 0 3.97918E-6
15-100657127-G-A p.Arg605Trp missense ADAMTS17 2 83078 2.40738E-5 41539 0 2.78534E-5
15-100657136-G-A p.Pro602Ser missense ADAMTS17 1 83026 1.20444E-5 41513 0 5.03525E-4
15-100657145-T-C p.Lys599Glu missense ADAMTS17 1 83008 1.2047E-5 41504 0 3.97991E-6
15-100657147-G-C p.Pro598Arg missense ADAMTS17 1 82986 1.20502E-5 41493 0 8.37226E-6
15-100657148-G-T p.Pro598Thr missense ADAMTS17 3 82978 3.61542E-5 41489 0 7.96096E-6
15-100657152-G-C p.Pro596Pro synonymous ADAMTS17 1 82946 1.2056E-5 41473 0 NA
15-100657155-C-A p.Leu595Leu synonymous ADAMTS17 1 82900 1.20627E-5 41450 0 3.98314E-6
15-100657164-G-A p.Cys592Cys synonymous ADAMTS17 1 82816 1.2075E-5 41408 0 6.37308E-5
15-100657170-C-T p.Ala590Ala synonymous ADAMTS17 2 82802 2.4154E-5 41401 0 6.25E-4
15-100657171-G-A p.Ala590Val missense ADAMTS17 5 82784 6.03981E-5 41392 0 9.56328E-5
15-100657173-A-G p.His589His synonymous ADAMTS17 265 82806 0.00320025 41403 2 0.0020786
15-100657180-A-G p.Val587Ala missense ADAMTS17 1 82766 1.20823E-5 41383 0 NA
15-100657182-A-G p.Ser586Ser synonymous ADAMTS17 1 82762 1.20828E-5 41381 0 0.00125
15-100657187-C-A p.Ala585Ser missense ADAMTS17 1 82704 1.20913E-5 41352 0 NA
15-100657191-C-T p.Pro583Pro synonymous ADAMTS17 8 82664 9.67773E-5 41332 0 9.56267E-5
15-100657192-G-A p.Pro583Leu missense ADAMTS17 5 82672 6.048E-5 41336 0 6.25E-4
15-100657195-C-T p.Cys582Tyr missense ADAMTS17 1 82642 1.21004E-5 41321 0 1.00746E-5
15-100657214-C-T p.Gly576Arg missense ADAMTS17 1 82418 1.21333E-5 41209 0 NA
15-100672211-C-T c.1721+1G>A splice_donor ADAMTS17 2 83152 2.40523E-5 41576 0 3.19678E-5
15-100672213-G-A p.Pro574Ser missense+splice_region ADAMTS17 11 83176 1.3225E-4 41588 0 1.59236E-4
15-100672218-T-C p.Asn572Ser missense ADAMTS17 2 83078 2.40738E-5 41539 0 NA
15-100672219-T-G p.Asn572His missense ADAMTS17 1 83170 1.20236E-5 41585 0 8.25832E-6
15-100672222-C-G p.Asp571His missense ADAMTS17 2 83178 2.40448E-5 41589 0 8.25723E-6
15-100672236-C-T p.Arg566Lys missense ADAMTS17 3 83210 3.60534E-5 41605 0 1.65055E-5
15-100672237-T-G p.Arg566Arg synonymous ADAMTS17 82744 82800 0.999324 41400 41347 1.0
15-100672237-T-A p.Arg566Trp missense ADAMTS17 5 83192 6.01019E-5 41596 0 3.18451E-5
15-100672242-C-A p.Arg564Leu missense ADAMTS17 1 83182 1.20218E-5 41591 0 3.18492E-5
15-100672243-G-A p.Arg564Cys missense ADAMTS17 2 83202 2.40379E-5 41601 0 5.03525E-4
15-100672244-G-A p.Ala563Ala synonymous ADAMTS17 1 83206 1.20184E-5 41603 0 NA
15-100672248-C-A p.Gly562Val missense ADAMTS17 12 83206 1.4422E-4 41603 0 1.59276E-4
15-100672250-C-T p.Thr561Thr synonymous ADAMTS17 1 83200 1.20192E-5 41600 0 3.18532E-5
15-100672251-G-A p.Thr561Met missense ADAMTS17 19 83186 2.28404E-4 41593 0 2.54842E-4
15-100672251-G-C p.Thr561Arg missense ADAMTS17 2 83186 2.40425E-5 41593 0 NA
15-100672263-C-T p.Arg557Gln missense ADAMTS17 2 83188 2.40419E-5 41594 0 6.37024E-5
15-100672282-C-T p.Ala551Thr missense ADAMTS17 333 83124 0.00400606 41562 3 0.00863442
15-100672282-C-A p.Ala551Ser missense ADAMTS17 1 83124 1.20302E-5 41562 0 8.30675E-6
15-100672283-G-A p.Gly550Gly synonymous ADAMTS17 2 83110 2.40645E-5 41555 0 8.31228E-6
15-100672284-C-T p.Gly550Asp missense ADAMTS17 1 83128 1.20296E-5 41564 0 NA
15-100672285-C-A p.Gly550Cys missense ADAMTS17 1 83128 1.20296E-5 41564 0 6.37064E-5
15-100672289-C-T p.Pro548Pro synonymous ADAMTS17 6 83122 7.21831E-5 41561 0 3.5043E-4
15-100672290-G-A p.Pro548Leu missense ADAMTS17 3 83108 3.60976E-5 41554 0 5.8278E-5
15-100672292-G-A p.Ser547Ser synonymous ADAMTS17 1 83102 1.20334E-5 41551 0 2.38892E-5
15-100672298-G-C p.Asp545Glu missense ADAMTS17 1 83090 1.20351E-5 41545 0 8.34404E-6
15-100672303-C-T p.Gly544Arg missense ADAMTS17 2 83086 2.40714E-5 41543 0 8.36484E-6
15-100672304-G-A p.Asp543Asp synonymous ADAMTS17 5 83072 6.01888E-5 41536 0 8.36512E-5
15-100672304-G-C p.Asp543Glu missense ADAMTS17 1 83072 1.20378E-5 41536 0 3.98235E-6
15-100672306-C-T p.Asp543Asn missense ADAMTS17 1 83084 1.2036E-5 41542 0 NA
15-100672311-T-A p.His541Leu missense ADAMTS17 1 83074 1.20375E-5 41537 0 8.40675E-6
15-100672326-G-A p.Thr536Met missense ADAMTS17 2 82982 2.41016E-5 41491 0 3.98985E-6
15-100672334-C-G p.Val533Val synonymous ADAMTS17 9 82906 1.08557E-4 41453 0 8.61653E-5
15-100672336-C-T p.Val533Met missense ADAMTS17 2 82874 2.4133E-5 41437 0 6.8133E-5
15-100672337-G-A p.Cys532Cys synonymous ADAMTS17 3 82842 3.62135E-5 41421 0 6.37105E-5
15-100672343-C-T p.Gly530Gly synonymous ADAMTS17 2 82816 2.41499E-5 41408 0 NA
15-100672346-C-G p.Ala529Ala synonymous ADAMTS17 1 82792 1.20785E-5 41396 0 6.36983E-5
15-100672346-C-T p.Ala529Ala synonymous ADAMTS17 9 82792 1.08706E-4 41396 0 6.36983E-5
15-100672347-G-A p.Ala529Val missense ADAMTS17 1 82748 1.20849E-5 41374 0 3.18532E-5
15-100672348-C-T p.Ala529Thr missense ADAMTS17 15 82730 1.81313E-4 41365 0 0.00100705
15-100672349-G-A p.Arg528Arg synonymous ADAMTS17 21 82704 2.53918E-4 41352 0 5.03525E-4
15-100672350-C-A p.Arg528Leu missense ADAMTS17 3 82700 3.62757E-5 41350 0 3.18451E-5
15-100672351-G-A p.Arg528Cys missense ADAMTS17 1 82684 1.20942E-5 41342 0 6.36983E-5
15-100672358-C-A c.1576-1G>T splice_acceptor ADAMTS17 2 82646 2.41996E-5 41323 0 4.05006E-6
15-100673411-G-C c.1575+8C>G splice_region ADAMTS17 3 78770 3.80856E-5 39385 0 NA
15-100673422-G-A p.Asp524Asp synonymous ADAMTS17 1 79020 1.2655E-5 39510 0 2.43677E-5
15-100673428-C-T p.Gly522Gly synonymous ADAMTS17 1 79134 1.26368E-5 39567 0 2.2477E-5
15-100673436-C-T p.Glu520Lys missense ADAMTS17 7 79214 8.83682E-5 39607 1 2.25599E-5
15-100673437-G-A p.Thr519Thr synonymous ADAMTS17 3 79230 3.78644E-5 39615 0 2.03442E-5
15-100673439-T-A p.Thr519Ser missense ADAMTS17 2 79268 2.52309E-5 39634 0 6.37146E-5
15-100673452-A-G p.Pro514Pro synonymous ADAMTS17 1 79352 1.26021E-5 39676 0 1.8076E-5
15-100673465-G-C p.Thr510Ser missense ADAMTS17 2 79408 2.51864E-5 39704 0 4.37411E-6
15-100673476-T-C p.Thr506Thr synonymous ADAMTS17 5 79402 6.29707E-5 39701 0 3.59712E-5
15-100673477-G-A p.Thr506Ile missense ADAMTS17 1 79396 1.25951E-5 39698 0 1.76905E-5
15-100673513-A-G p.Met494Thr missense ADAMTS17 1 79234 1.26208E-5 39617 0 NA
15-100673520-G-A p.His492Tyr missense+splice_region ADAMTS17 4 79172 5.05229E-5 39586 0 9.38482E-5
15-100673520-G-T p.His492Asn missense+splice_region ADAMTS17 2 79172 2.52615E-5 39586 0 2.34621E-5
15-100692820-C-T p.Met490Ile missense ADAMTS17 1 82942 1.20566E-5 41471 0 3.98194E-6
15-100692822-T-C p.Met490Val missense ADAMTS17 1 82976 1.20517E-5 41488 0 NA
15-100692842-T-C p.Asn483Ser missense ADAMTS17 5 83186 6.01063E-5 41593 0 3.18796E-5
15-100692844-CA-TG p.Met482Thr missense ADAMTS17 11 83190 1.32227E-4 41595 0 NA
15-100692844-C-T p.Met482Ile missense ADAMTS17 4 83190 4.80827E-5 41595 0 1.91217E-4
15-100692845-A-G p.Met482Thr missense ADAMTS17 12755 82370 0.15485 41185 997 0.269375
15-100692866-T-C p.Gln475Arg missense ADAMTS17 2 83296 2.40108E-5 41648 0 NA
15-100692870-C-T p.Glu474Lys missense ADAMTS17 2 83314 2.40056E-5 41657 0 6.59087E-5
15-100692871-G-A p.Asn473Asn synonymous ADAMTS17 6 83312 7.20184E-5 41656 0 6.25E-4
15-100692878-C-A p.Ser471Ile missense ADAMTS17 4 83332 4.80008E-5 41666 0 2.50547E-4
15-100692880-G-A p.Tyr470Tyr synonymous ADAMTS17 1 83332 1.20002E-5 41666 0 NA
15-100692881-T-C p.Tyr470Cys missense ADAMTS17 4 83330 4.80019E-5 41665 0 8.23764E-6
15-100692892-C-T p.Pro466Pro synonymous ADAMTS17 36 83326 4.32038E-4 41663 0 6.25E-4
15-100692892-C-G p.Pro466Pro synonymous ADAMTS17 1 83328 1.20008E-5 41664 0 NA
15-100692901-G-T p.His463Gln missense ADAMTS17 1 83348 1.19979E-5 41674 0 NA
15-100692904-C-T p.Pro462Pro synonymous ADAMTS17 12 83348 1.43975E-4 41674 0 1.27413E-4
15-100692905-G-A p.Pro462Leu missense ADAMTS17 4 83352 4.79893E-5 41676 0 8.23791E-5
15-100692907-G-A p.Leu461Leu synonymous ADAMTS17 3 83354 3.59911E-5 41677 0 3.97662E-6
15-100692911-C-T p.Arg460His missense ADAMTS17 6 83350 7.19856E-5 41675 0 6.25E-4
15-100692919-G-A p.His457His synonymous ADAMTS17 2 83342 2.39975E-5 41671 0 1.64761E-5
15-100692925-G-A p.Ser455Ser synonymous ADAMTS17 1 83338 1.19993E-5 41669 0 3.97659E-6
15-100692937-C-T p.Thr451Thr synonymous ADAMTS17 27 83336 3.2399E-4 41668 0 3.82555E-4
15-100692940-G-A p.Val450Val synonymous ADAMTS17 2 83340 2.39981E-5 41670 0 3.97697E-6
15-100692952-G-C p.Thr446Thr synonymous ADAMTS17 1 83336 1.19996E-5 41668 0 8.23954E-6
15-100692953-G-A p.Thr446Ile missense ADAMTS17 6095 83096 0.0733489 41548 292 0.078422
15-100692963-T-C p.Lys443Glu missense ADAMTS17 1 83344 1.19985E-5 41672 0 NA
15-100695378-G-T c.1322+7C>A splice_region ADAMTS17 1 83306 1.20039E-5 41653 0 NA
15-100695385-T-C p.Lys441Arg missense+splice_region ADAMTS17 5 83322 6.00082E-5 41661 0 7.41339E-5
15-100695390-G-T p.Phe439Leu missense ADAMTS17 87 83328 0.00104407 41664 1 0.00100705
15-100695393-G-C p.Asn438Lys missense ADAMTS17 1 83330 1.20005E-5 41665 0 NA
15-100695401-G-A p.Leu436Phe missense ADAMTS17 1 83336 1.19996E-5 41668 0 3.9769E-6
15-100695405-A-G p.Asp434Asp synonymous ADAMTS17 13 83332 1.56002E-4 41666 0 0.00151057
15-100695409-C-T p.Arg433Gln missense ADAMTS17 1 83338 1.19993E-5 41669 0 2.47133E-5
15-100695410-G-A p.Arg433* stop_gained ADAMTS17 1 83334 1.19999E-5 41667 0 3.1841E-5
15-100695418-G-A p.Ser430Phe missense ADAMTS17 1 83334 1.19999E-5 41667 0 NA
15-100695419-A-G p.Ser430Pro missense ADAMTS17 39 83334 4.67996E-4 41667 0 5.76701E-4
15-100695420-G-A p.Ser429Ser synonymous ADAMTS17 5 83336 5.99981E-5 41668 0 1.91071E-4
15-100695431-G-C p.Leu426Val missense ADAMTS17 2 83322 2.40033E-5 41661 0 NA
15-100695437-T-C p.Ser424Gly missense ADAMTS17 3 83318 3.60066E-5 41659 0 8.24334E-6
15-100695442-T-C p.Asn422Ser missense ADAMTS17 1 83300 1.20048E-5 41650 0 8.24878E-6
15-100695444-C-G p.Arg421Arg synonymous ADAMTS17 1 83304 1.20042E-5 41652 0 3.18431E-5
15-100695445-C-T p.Arg421Gln missense ADAMTS17 2 83298 2.40102E-5 41649 0 6.37024E-5
15-100695446-G-A p.Arg421Trp missense ADAMTS17 4 83302 4.80181E-5 41651 0 3.18512E-5
15-100695448-C-T p.Gly420Asp missense ADAMTS17 1 83298 1.20051E-5 41649 0 NA
15-100695473-T-C p.Ile412Val missense ADAMTS17 2 83280 2.40154E-5 41640 0 NA
15-100695483-G-T p.Gly408Gly synonymous ADAMTS17 1 83256 1.20111E-5 41628 0 NA
15-100695487-G-C p.Ala407Gly missense ADAMTS17 14 83254 1.6816E-4 41627 0 2.54793E-4
15-100695488-C-T p.Ala407Thr missense ADAMTS17 4 83250 4.8048E-5 41625 0 5.90339E-5
15-100695489-G-A p.Cys406Cys synonymous ADAMTS17 1 83240 1.20135E-5 41620 0 3.37872E-5
15-100695498-G-A p.His403His synonymous ADAMTS17 1 83216 1.20169E-5 41608 0 NA
15-100695506-C-T p.Asp401Asn missense ADAMTS17 1 83168 1.20239E-5 41584 0 2.39263E-5
15-100695507-G-A p.Asp400Asp synonymous ADAMTS17 9 83160 1.08225E-4 41580 0 1.11666E-4
15-100695518-T-C p.Met397Val missense ADAMTS17 2 83092 2.40697E-5 41546 0 7.98945E-6
15-100695519-G-A p.Gly396Gly synonymous ADAMTS17 1 83074 1.20375E-5 41537 0 7.99578E-6
15-100695524-A-T p.Leu395Met missense+splice_region ADAMTS17 1 83052 1.20406E-5 41526 0 NA
15-100695524-A-G p.Leu395Leu splice_region+synonymous ADAMTS17 1 83052 1.20406E-5 41526 0 NA
15-100695530-C-A c.1182-5G>T splice_region ADAMTS17 1 82972 1.20523E-5 41486 0 5.82739E-5
15-100739516-T-C c.1181+7A>G splice_region ADAMTS17 1 83320 1.20019E-5 41660 0 NA
15-100739517-A-C c.1181+6T>G splice_region ADAMTS17 2 83328 2.40015E-5 41664 0 NA
15-100739534-C-T p.Glu390Glu synonymous ADAMTS17 1 83348 1.19979E-5 41674 0 NA
15-100739542-C-T p.Ala388Thr missense ADAMTS17 2 83362 2.39917E-5 41681 0 2.47093E-5
15-100739543-G-A p.Ile387Ile synonymous ADAMTS17 1 83364 1.19956E-5 41682 0 4.11821E-5
15-100739559-T-C p.Asn382Ser missense ADAMTS17 4 83376 4.79754E-5 41688 0 3.18512E-5
15-100739565-C-T p.Gly380Asp missense ADAMTS17 1 83380 1.19933E-5 41690 0 3.18431E-5
15-100739566-C-G p.Gly380Arg missense ADAMTS17 2 83382 2.3986E-5 41691 0 NA
15-100739568-T-C p.Asn379Ser missense ADAMTS17 2 83380 2.39866E-5 41690 0 3.57859E-5
15-100739576-G-A p.Ala376Ala synonymous ADAMTS17 1 83374 1.19941E-5 41687 0 3.29457E-5
15-100739594-C-T p.Lys370Lys synonymous ADAMTS17 1 83366 1.19953E-5 41683 0 NA
15-100739611-C-T p.Gly365Ser missense ADAMTS17 2 83338 2.39987E-5 41669 0 7.95267E-6
15-100739615-T-C p.Leu363Leu synonymous ADAMTS17 1 83326 1.20011E-5 41663 0 NA
15-100739627-T-G p.Gly359Gly splice_region+synonymous ADAMTS17 1 83282 1.20074E-5 41641 0 NA
15-100739635-CAG-C c.1076-9_1076-8delCT splice_region ADAMTS17 1 83194 1.20201E-5 41597 0 3.97662E-6
15-100794342-A-G p.Val358Val splice_region+synonymous ADAMTS17 2 82902 2.41249E-5 41451 0 1.59117E-5
15-100794346-G-A p.Thr357Ile missense ADAMTS17 1 82910 1.20613E-5 41455 0 8.2462E-6
15-100794354-C-T p.Pro354Pro synonymous ADAMTS17 82 82878 9.89406E-4 41439 0 0.00151515
15-100794360-A-G p.Asp352Asp synonymous ADAMTS17 10 82882 1.20653E-4 41441 0 6.37146E-5
15-100794362-C-A p.Asp352Tyr missense ADAMTS17 1 82894 1.20636E-5 41447 0 4.12208E-5
15-100794363-C-T p.Lys351Lys synonymous ADAMTS17 59517 82428 0.722048 41214 21709 0.767327
15-100794377-A-C p.Phe347Val missense ADAMTS17 2 82878 2.41319E-5 41439 0 2.47799E-5
15-100801677-A-G c.1031+7T>C splice_region ADAMTS17 1 82806 1.20764E-5 41403 0 3.18573E-5
15-100801679-C-G c.1031+5G>C splice_region ADAMTS17 3 82830 3.62188E-5 41415 0 3.97782E-5
15-100801698-G-A p.Ala339Ala synonymous ADAMTS17 53163 81344 0.653558 40672 17425 0.695011
15-100801700-C-A p.Ala339Ser missense ADAMTS17 2 83120 2.40616E-5 41560 0 NA
15-100801702-G-A p.Ala338Val missense ADAMTS17 1 83130 1.20294E-5 41565 0 0.00100806
15-100801707-C-T p.Val336Val synonymous ADAMTS17 3 83142 3.60828E-5 41571 0 7.55666E-5
15-100801713-G-A p.Pro334Pro synonymous ADAMTS17 30 83192 3.60612E-4 41596 0 0.001875
15-100801714-G-C p.Pro334Arg missense ADAMTS17 1 83202 1.20189E-5 41601 0 NA
15-100801715-G-A p.Pro334Ser missense ADAMTS17 1 83198 1.20195E-5 41599 0 3.97779E-6
15-100801716-C-T p.Pro333Pro synonymous ADAMTS17 1 83212 1.20175E-5 41606 0 3.18258E-5
15-100801717-G-A p.Pro333Leu missense ADAMTS17 3 83218 3.60499E-5 41609 0 4.94698E-5
15-100801721-C-T p.Asp332Asn missense ADAMTS17 3 83188 3.60629E-5 41594 0 6.37146E-5
15-100801722-G-A p.Asp331Asp synonymous ADAMTS17 1 83192 1.20204E-5 41596 0 6.37511E-5
15-100801725-C-A p.Lys330Asn missense ADAMTS17 1 83228 1.20152E-5 41614 0 NA
15-100801730-C-T p.Gly329Arg missense ADAMTS17 1 83256 1.20111E-5 41628 0 6.37105E-5
15-100801731-G-A p.Gly328Gly synonymous ADAMTS17 2 83240 2.40269E-5 41620 0 1.19337E-5
15-100801733-C-A p.Gly328Cys missense ADAMTS17 1 83264 1.201E-5 41632 0 0.00100705
15-100801734-G-A p.Pro327Pro synonymous ADAMTS17 7 83274 8.40599E-5 41637 0 0.00100705
15-100801735-G-A p.Pro327Leu missense ADAMTS17 1 83288 1.20065E-5 41644 0 3.18552E-5
15-100801741-T-C p.Gln325Arg missense ADAMTS17 1 83302 1.20045E-5 41651 0 6.37186E-5
15-100801747-T-C p.Asn323Ser missense ADAMTS17 1 83294 1.20057E-5 41647 0 NA
15-100801751-C-T p.Gly322Ser missense ADAMTS17 1 83282 1.20074E-5 41641 0 3.18634E-5
15-100801752-G-A p.Leu321Leu synonymous ADAMTS17 1 83282 1.20074E-5 41641 0 3.18593E-5
15-100801759-C-T p.Arg319Gln missense ADAMTS17 3 83286 3.60205E-5 41643 0 3.18634E-5
15-100801760-G-A p.Arg319* stop_gained ADAMTS17 3 83280 3.60231E-5 41640 0 3.18695E-5
15-100801761-C-T p.Ala318Ala synonymous ADAMTS17 3 83292 3.60179E-5 41646 0 3.18226E-5
15-100801762-G-A p.Ala318Val missense ADAMTS17 1 83280 1.20077E-5 41640 0 7.95665E-6
15-100801762-G-T p.Ala318Glu missense ADAMTS17 1 83280 1.20077E-5 41640 0 4.14381E-5
15-100801771-T-A p.Tyr315Phe missense ADAMTS17 6 83308 7.20219E-5 41654 0 1.91144E-4
15-100801773-C-G p.Glu314Asp missense ADAMTS17 1 83306 1.20039E-5 41653 0 1.66317E-5
15-100801777-T-C p.Glu313Gly missense ADAMTS17 2 83316 2.4005E-5 41658 0 8.32265E-6
15-100801778-C-T p.Glu313Lys missense ADAMTS17 3 83314 3.60084E-5 41657 0 1.58201E-4
15-100801779-G-A p.Asn312Asn synonymous ADAMTS17 1 83308 1.20036E-5 41654 0 3.33317E-5
15-100801788-G-C p.His309Gln missense ADAMTS17 4 83320 4.80077E-5 41660 0 8.3633E-6
15-100801794-G-A p.Phe307Phe synonymous ADAMTS17 4 83318 4.80088E-5 41659 0 3.58163E-5
15-100801795-A-C p.Phe307Cys missense ADAMTS17 2 83316 2.4005E-5 41658 0 NA
15-100801806-G-A p.Ser303Ser synonymous ADAMTS17 2 83302 2.4009E-5 41651 0 3.98118E-6
15-100801807-G-A p.Ser303Phe missense ADAMTS17 4 83304 4.80169E-5 41652 0 1.70491E-5
15-100801810-C-T p.Arg302Gln missense ADAMTS17 1 83300 1.20048E-5 41650 0 3.18593E-5
15-100801811-G-A p.Arg302Trp missense ADAMTS17 7 83286 8.40477E-5 41643 0 5.03525E-4
15-100801812-C-T p.Glu301Glu synonymous ADAMTS17 42 83288 5.04274E-4 41644 0 7.96432E-4
15-100801815-A-G p.Gly300Gly synonymous ADAMTS17 4 83286 4.80273E-5 41643 0 8.60659E-6
15-100801821-G-A p.His298His synonymous ADAMTS17 1 83264 1.201E-5 41632 0 3.98429E-5
15-100801836-C-T p.Lys293Lys synonymous ADAMTS17 2 83218 2.40333E-5 41609 0 7.98665E-6
15-100801848-A-G c.874-7T>C splice_region ADAMTS17 3 83138 3.60846E-5 41569 0 2.0047E-5
15-100801849-A-C c.874-8T>G splice_region ADAMTS17 1 83134 1.20288E-5 41567 0 NA
15-100802557-G-A p.Pro291Pro splice_region+synonymous ADAMTS17 1 83164 1.20244E-5 41582 0 3.18756E-5
15-100802562-G-A p.Arg290Cys missense ADAMTS17 3 83186 3.60638E-5 41593 0 6.37308E-5
15-100802563-T-G p.Gln289His missense ADAMTS17 1 83196 1.20198E-5 41598 0 NA
15-100802567-C-T p.Arg288Gln missense ADAMTS17 6 83174 7.21379E-5 41587 0 6.76003E-5
15-100802568-G-A p.Arg288* stop_gained ADAMTS17 4 83188 4.80839E-5 41594 0 3.29489E-5
15-100802580-G-C p.Leu284Val missense ADAMTS17 1 83218 1.20166E-5 41609 0 NA
15-100802581-C-G p.Lys283Asn missense ADAMTS17 1 83224 1.20158E-5 41612 0 NA
15-100802583-T-G p.Lys283Gln missense ADAMTS17 4 83224 4.80631E-5 41612 0 0.00125
15-100802588-A-G p.Val281Ala missense ADAMTS17 1 83234 1.20143E-5 41617 0 NA
15-100802590-T-C p.Gln280Gln synonymous ADAMTS17 1 83240 1.20135E-5 41620 0 8.23683E-6
15-100802592-G-T p.Gln280Lys missense ADAMTS17 1 83240 1.20135E-5 41620 0 NA
15-100802606-A-C p.Ile275Ser missense ADAMTS17 1 83238 1.20137E-5 41619 0 3.97633E-6
15-100802611-C-G p.Leu273Leu synonymous ADAMTS17 2 83230 2.40298E-5 41615 0 NA
15-100802622-G-T p.His270Asn missense ADAMTS17 4 83186 4.8085E-5 41593 0 1.64848E-5
15-100802646-A-G c.790-6T>C splice_region ADAMTS17 1 82842 1.20712E-5 41421 0 NA
15-100821426-G-A c.789+8C>T splice_region ADAMTS17 24432 80062 0.305164 40031 3677 0.371715
15-100821437-G-A p.Asn262Asn synonymous ADAMTS17 1 81596 1.22555E-5 40798 0 NA
15-100821445-C-T p.Val260Ile missense ADAMTS17 4 81740 4.89356E-5 40870 0 7.53138E-5
15-100821446-G-A p.Thr259Thr synonymous ADAMTS17 7 81762 8.56143E-5 40881 0 0.00187735
15-100821452-G-A p.Ile257Ile synonymous ADAMTS17 20 81946 2.44063E-4 40973 0 6.25E-4
15-100821452-G-T p.Ile257Ile synonymous ADAMTS17 1 81946 1.22032E-5 40973 0 6.3678E-5
15-100821466-C-A p.Ala253Ser missense ADAMTS17 8 82182 9.73449E-5 41091 0 6.37105E-5
15-100821466-C-T p.Ala253Thr missense ADAMTS17 2 82182 2.43362E-5 41091 0 0.00101112
15-100821467-G-A p.Ala252Ala synonymous ADAMTS17 32049 81552 0.392989 40776 6580 0.443125
15-100821467-G-T p.Ala252Ala synonymous ADAMTS17 1 82238 1.21598E-5 41119 0 4.06967E-6
15-100821472-C-T p.Glu251Lys missense ADAMTS17 34 82320 4.13022E-4 41160 0 2.80508E-4
15-100821473-G-A p.Ala250Ala synonymous ADAMTS17 7 82338 8.50154E-5 41169 0 4.18221E-5
15-100821476-C-A p.Gly249Gly synonymous ADAMTS17 1 82450 1.21286E-5 41225 0 4.05791E-6
15-100821479-G-A p.His248His synonymous ADAMTS17 57 82506 6.90859E-4 41253 0 5.04541E-4
15-100821496-C-T p.Asp243Asn missense ADAMTS17 6 82592 7.26463E-5 41296 0 5.03525E-4
15-100821497-G-A p.Ala242Ala synonymous ADAMTS17 1 82600 1.21065E-5 41300 0 6.37714E-5
15-100821499-C-A p.Ala242Ser missense ADAMTS17 4 82586 4.84344E-5 41293 0 3.18634E-5
15-100821500-G-A p.Asp241Asp synonymous ADAMTS17 2 82592 2.42154E-5 41296 0 5.03525E-4
15-100821503-G-A p.Ala240Ala synonymous ADAMTS17 1 82568 1.21112E-5 41284 0 NA
15-100821514-G-A p.Leu237Leu synonymous ADAMTS17 5 82572 6.05532E-5 41286 0 1.09134E-4
15-100821517-T-C p.Thr236Ala missense ADAMTS17 2 82482 2.42477E-5 41241 0 NA
15-100821524-C-T p.Thr233Thr synonymous ADAMTS17 2 82434 2.42618E-5 41217 0 1.68192E-5
15-100821525-G-A p.Thr233Met missense ADAMTS17 1 82430 1.21315E-5 41215 0 8.41E-6
15-100821532-C-T p.Glu231Lys missense ADAMTS17 5 82310 6.0746E-5 41155 0 5.03525E-4
15-100821536-G-A p.Thr229Thr synonymous ADAMTS17 1 82284 1.2153E-5 41142 0 6.37064E-5
15-100821538-T-C p.Thr229Ala missense ADAMTS17 3 82214 3.64901E-5 41107 0 2.01935E-5
15-100821542-C-T p.Arg227Arg synonymous ADAMTS17 1 82116 1.21779E-5 41058 0 3.63866E-5
15-100821544-G-A p.Arg227Trp missense ADAMTS17 4 82102 4.87199E-5 41051 0 9.55657E-5
15-100821550-C-T p.Ala225Thr missense ADAMTS17 1 81744 1.22333E-5 40872 0 3.18492E-5
15-100821558-C-T p.Arg222Gln missense ADAMTS17 11 81396 1.35142E-4 40698 0 5.04032E-4
15-100821559-G-A p.Arg222Trp missense ADAMTS17 1 81164 1.23207E-5 40582 0 2.46035E-5
15-100821559-G-T p.Arg222Arg synonymous ADAMTS17 1 81164 1.23207E-5 40582 0 5.04032E-4
15-100821564-C-T p.Arg220Gln missense ADAMTS17 1 82586 1.21086E-5 41293 0 1.20636E-5
15-100821574-G-A p.Arg217Trp missense ADAMTS17 2 82534 2.42324E-5 41267 0 6.36943E-5
15-100821574-GCG-ACA p.SerArg216LeuTrp missense ADAMTS17 1 82534 1.21162E-5 41267 0 NA
15-100821575-C-T p.Ser216Ser synonymous ADAMTS17 1 82516 1.21189E-5 41258 0 3.38708E-5
15-100821576-G-A p.Ser216Leu missense ADAMTS17 31432 81718 0.38464 40859 6258 0.438125
15-100821580-G-T p.Pro215Thr missense ADAMTS17 1 82484 1.21236E-5 41242 0 1.71315E-5
15-100821588-C-A p.Trp212Leu missense ADAMTS17 1 82400 1.21359E-5 41200 0 NA
15-100821591-G-A p.Thr211Met missense ADAMTS17 1 82314 1.21486E-5 41157 0 4.43711E-5
15-100821595-GCTT-G p.Lys209del conservative_inframe_deletion ADAMTS17 44 82158 5.35553E-4 41079 0 0.00152827
15-100846714-G-A p.His111Tyr missense ADAMTS17 1 9012 1.10963E-4 4506 0 NA
15-100846720-C-A p.Val109Leu missense ADAMTS17 1 9012 1.10963E-4 4506 0 NA
15-100846729-C-A p.Asp106Tyr missense ADAMTS17 1 9010 1.10988E-4 4505 0 3.18512E-5
15-100846757-C-T p.Trp96* stop_gained ADAMTS17 80 9008 0.00888099 4504 0 0.023125
15-100871086-C-T c.616+8G>A splice_region ADAMTS17 1 82968 1.20528E-5 41484 0 3.18593E-5
15-100871087-G-A c.616+7C>T splice_region ADAMTS17 1 82968 1.20528E-5 41484 0 1.19383E-5
15-100871105-T-C p.Lys202Arg missense ADAMTS17 2 82990 2.40993E-5 41495 0 3.18532E-5
15-100871119-A-G p.Pro197Pro synonymous ADAMTS17 2 82934 2.41156E-5 41467 0 3.18613E-5
15-100871120-G-A p.Pro197Leu missense ADAMTS17 1 82928 1.20587E-5 41464 0 3.97687E-5
15-100871132-TCAG-T p.Ala192del disruptive_inframe_deletion ADAMTS17 3 82894 3.61908E-5 41447 0 1.27437E-4
15-100871139-A-G p.Ser191Pro missense ADAMTS17 1 82872 1.20668E-5 41436 0 NA
15-100871141-G-C p.Pro190Arg missense ADAMTS17 2 82866 2.41354E-5 41433 0 7.95311E-6
15-100871146-G-A p.Gln65* stop_gained ADAMTS17 2 82886 2.41295E-5 41443 0 NA
15-100871162-T-C p.Lys183Arg missense ADAMTS17 212 82952 0.00255569 41476 0 0.0016893
15-100871164-G-C p.Gln59Glu missense ADAMTS17 2 82948 2.41115E-5 41474 0 6.37349E-5
15-100871165-C-T p.Arg182His missense ADAMTS17 2 82946 2.41121E-5 41473 0 1.64737E-5
15-100871166-G-A p.Arg182Cys missense ADAMTS17 10 82934 1.20578E-4 41467 0 1.91266E-4
15-100871168-C-T p.Arg181Lys missense ADAMTS17 52 82942 6.26944E-4 41471 0 4.61262E-4
15-100871176-A-G p.Ser55Pro missense ADAMTS17 1 82948 1.20557E-5 41474 0 NA
15-100871182-T-C p.Arg53Gly missense ADAMTS17 7 82946 8.43923E-5 41473 0 1.59297E-4
15-100871184-G-A p.Arg176* stop_gained ADAMTS17 2 82942 2.41132E-5 41471 0 8.23696E-6
15-100871184-G-C p.Arg176Gly missense ADAMTS17 1 82940 1.20569E-5 41470 0 6.25E-4
15-100871185-T-C p.Thr52Ala missense ADAMTS17 1 82958 1.20543E-5 41479 0 3.9764E-6
15-100871190-T-G p.Ser174Arg missense ADAMTS17 4 82968 4.82114E-5 41484 0 3.57881E-5
15-100871201-T-C p.Gln170Arg missense ADAMTS17 1 82986 1.20502E-5 41493 0 8.23832E-6
15-100871206-G-T p.Asn168Lys missense ADAMTS17 1 82976 1.20517E-5 41488 0 3.97655E-6
15-100871214-G-A p.Leu166Phe missense ADAMTS17 1 82948 1.20557E-5 41474 0 NA
15-100871215-G-A p.Pro42Ser missense ADAMTS17 1 82936 1.20575E-5 41468 0 NA
15-100871224-T-C p.Asn39Asp missense ADAMTS17 19 82956 2.29037E-4 41478 0 4.46229E-4
15-100871227-C-T p.Ala38Thr missense ADAMTS17 1 82942 1.20566E-5 41471 0 NA
15-100871228-A-T p.Val161Glu missense ADAMTS17 1 82926 1.20589E-5 41463 0 NA
15-100871230-C-G p.Gln160His missense ADAMTS17 3 82928 3.6176E-5 41464 0 5.03525E-4
15-100871241-C-G p.Gly157Arg missense ADAMTS17 1 82882 1.20653E-5 41441 0 8.26187E-6
15-100871244-G-A p.Leu156Phe missense ADAMTS17 2 82908 2.41231E-5 41454 0 NA
15-100871245-C-G p.Gln155His missense ADAMTS17 9 82910 1.08551E-4 41455 0 2.42616E-4
15-100871250-T-G p.Ile154Leu missense ADAMTS17 1 82900 1.20627E-5 41450 0 3.97738E-6
15-100871250-T-C p.Ile154Val missense ADAMTS17 1 82900 1.20627E-5 41450 0 8.27609E-6
15-100881209-C-G n.179G>C splice_region ADAMTS17 1 38522 2.59592E-5 19261 0 NA
15-100881244-C-T p.Leu150Leu splice_region+synonymous ADAMTS17 1 39702 2.51876E-5 19851 0 NA
15-100881248-C-T p.Gly149Asp missense ADAMTS17 1 39692 2.5194E-5 19846 0 NA
15-100881253-G-C p.Ala147Ala synonymous ADAMTS17 48 39826 0.00120524 19913 0 0.0128181
15-100881273-G-A p.Leu141Phe missense ADAMTS17 1 40142 2.49116E-5 20071 0 NA
15-100881290-G-A p.Pro135Leu missense ADAMTS17 1 40372 2.47696E-5 20186 0 NA
15-100881298-G-A p.Leu132Leu synonymous ADAMTS17 1 40424 2.47378E-5 20212 0 8.56062E-6
15-100881300-G-A p.Leu132Phe missense ADAMTS17 1 40426 2.47366E-5 20213 0 3.24065E-5
15-100881306-G-C p.Arg130Gly missense ADAMTS17 5 40458 1.23585E-4 20229 0 1.94666E-4
15-100881326-TCGGCGGGGCGGCCG-T p.Gly119fs frameshift ADAMTS17 1 40480 2.47036E-5 20240 0 NA
15-100881327-C-CGGCGGGGCG p.Ala122_Glu123insArgProAla conservative_inframe_insertion ADAMTS17 1 40464 2.47133E-5 20232 0 3.31609E-5
15-100881328-G-C p.Ala122Ala synonymous ADAMTS17 2 40532 4.93437E-5 20266 0 2.60281E-4
15-100881355-G-C p.Gly113Gly synonymous ADAMTS17 1 40080 2.49501E-5 20040 0 1.49298E-4
15-100881381-G-A p.Arg105* stop_gained ADAMTS17 1 41306 2.42096E-5 20653 0 NA
15-100881401-C-G p.Arg98Pro missense ADAMTS17 1 41416 2.41453E-5 20708 0 3.36814E-5
15-100881403-G-C p.Arg97Arg synonymous ADAMTS17 1 41488 2.41034E-5 20744 0 NA
15-100881409-C-T p.Gln95Gln synonymous ADAMTS17 1 41366 2.41744E-5 20683 0 2.02443E-4
15-100881415-G-T p.Tyr93* stop_gained ADAMTS17 1 41394 2.41581E-5 20697 0 NA
15-100881416-T-C p.Tyr93Cys missense ADAMTS17 1 41270 2.42307E-5 20635 0 NA
15-100881436-C-A p.Pro86Pro synonymous ADAMTS17 1 39346 2.54155E-5 19673 0 NA
15-100881451-C-T p.Leu81Leu synonymous ADAMTS17 1 37354 2.67709E-5 18677 0 NA
15-100881453-G-A p.Leu81Leu synonymous ADAMTS17 1 36458 2.74288E-5 18229 0 1.05219E-4
15-100881461-T-C p.Glu78Gly missense ADAMTS17 3 34582 8.67503E-5 17291 0 7.37191E-5
15-100881466-G-C p.Pro76Pro synonymous ADAMTS17 14 33698 4.15455E-4 16849 0 5.90493E-4
15-100881471-G-C p.Arg75Gly missense ADAMTS17 2 32804 6.09682E-5 16402 0 1.12807E-4
15-100881480-G-C p.Pro72Ala missense ADAMTS17 12 32008 3.74906E-4 16004 0 7.68344E-4
15-100881483-C-A p.Ala71Ser missense ADAMTS17 4 31670 1.26302E-4 15835 0 5.9125E-4
15-100881487-TGGGGGCGTGC-T p.Arg66fs frameshift ADAMTS17 1 31410 3.1837E-5 15705 0 NA
15-100881488-G-A p.Pro69Leu missense ADAMTS17 2 31482 6.35284E-5 15741 1 0.0019084
15-100881489-G-C p.Pro69Ala missense ADAMTS17 1 31192 3.20595E-5 15596 0 NA
15-100881492-G-A p.Pro68Ser missense ADAMTS17 1 30960 3.22997E-5 15480 0 NA
15-100881495-T-C p.Thr67Ala missense ADAMTS17 1 30200 3.31126E-5 15100 0 NA
15-100881498-G-A p.Arg66Cys missense ADAMTS17 1 30130 3.31895E-5 15065 0 NA
15-100881506-C-A p.Arg63Leu missense ADAMTS17 1 29400 3.40136E-5 14700 0 NA
15-100881516-G-C p.Arg60Gly missense ADAMTS17 1 28638 3.49186E-5 14319 0 NA
15-100881525-G-A p.Pro57Ser missense ADAMTS17 2 27516 7.2685E-5 13758 0 NA
15-100881526-G-A p.Ala56Ala synonymous ADAMTS17 165 27376 0.00602718 13688 3 0.00246305
15-100881533-G-A p.Pro54Leu missense ADAMTS17 1 26238 3.81127E-5 13119 0 3.93174E-5
15-100881535-C-T p.Leu53Leu synonymous ADAMTS17 1 25920 3.85802E-5 12960 0 NA
15-100881542-G-T p.Pro51Gln missense ADAMTS17 1 25140 3.97772E-5 12570 0 NA
15-100881547-G-A p.His49His synonymous ADAMTS17 1 25170 3.97298E-5 12585 0 NA
15-100881559-G-C p.Pro45Pro synonymous ADAMTS17 1 25174 3.97235E-5 12587 0 NA
15-100881563-C-T p.Arg44His missense ADAMTS17 1 25016 3.99744E-5 12508 0 NA
15-100881570-G-A p.Arg42Trp missense ADAMTS17 3 25310 1.1853E-4 12655 0 3.91635E-5
15-100881589-C-T p.Val35Val synonymous ADAMTS17 6 25652 2.339E-4 12826 0 3.87868E-5
15-100881594-C-T p.Asp34Asn missense ADAMTS17 1 25586 3.90839E-5 12793 0 3.88319E-5
15-100881618-C-T c.80-4G>A splice_region ADAMTS17 1 25500 3.92157E-5 12750 0 NA
15-100882031-C-T p.Gly25Asp missense ADAMTS17 3 76788 3.90686E-5 38394 0 1.29266E-5
15-100882034-G-A p.Pro24Leu missense ADAMTS17 1 76846 1.3013E-5 38423 0 NA
15-100882035-G-A p.Pro24Ser missense ADAMTS17 4 76914 5.20061E-5 38457 0 9.57916E-5
15-100882042-T-C p.Gly21Gly synonymous ADAMTS17 5 77134 6.48223E-5 38567 0 2.1638E-4
15-100882050-CCAG-C p.Leu18del conservative_inframe_deletion ADAMTS17 1 77312 1.29346E-5 38656 0 0.00653595
15-100882050-C-CCAG p.Leu18dup conservative_inframe_insertion ADAMTS17 1 77342 1.29296E-5 38671 0 NA
15-100882053-G-A p.Leu18Leu synonymous ADAMTS17 1 77404 1.29192E-5 38702 0 NA
15-100882077-G-C p.Leu10Val missense ADAMTS17 1 77654 1.28776E-5 38827 0 NA
15-100882079-G-A p.Pro9Leu missense ADAMTS17 2 77724 2.57321E-5 38862 0 3.19224E-5
15-100882083-G-A p.Pro8Ser missense ADAMTS17 3 77756 3.85822E-5 38878 0 6.25E-4
15-100882135-G-A c.-31C>T 5_prime_UTR_premature_start_codon_gain ADAMTS17 1 76608 1.30535E-5 38304 0 NA
15-100882143-G-A c.-39C>T 5_prime_UTR_premature_start_codon_gain ADAMTS17 2 76416 2.61725E-5 38208 0 6.48508E-5
15-100882143-G-C c.-39C>G 5_prime_UTR_premature_start_codon_gain ADAMTS17 1 76418 1.30859E-5 38209 0 6.80392E-6
15-100882149-G-A c.-45C>T 5_prime_UTR_premature_start_codon_gain ADAMTS17 1 76382 1.30921E-5 38191 0 1.36355E-5
15-100882163-G-A c.-59C>T 5_prime_UTR_premature_start_codon_gain ADAMTS17 2 75868 2.63616E-5 37934 0 NA
15-100882173-G-A c.-69C>T 5_prime_UTR_premature_start_codon_gain ADAMTS17 28 75446 3.71126E-4 37723 0 5.73797E-4
15-100882176-G-A c.-72C>T 5_prime_UTR_premature_start_codon_gain ADAMTS17 1 75530 1.32398E-5 37765 0 NA
15-100882206-T-C c.-102A>G 5_prime_UTR_premature_start_codon_gain ADAMTS17 5 71148 7.0276E-5 35574 0 3.18979E-5