Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-8645127-G-A c.*650C>T splice_region ADAMTS10 1 42308 2.36362E-5 21154 0 NA
19-8645782-G-A p.His1103Tyr missense ADAMTS10 1 77552 1.28946E-5 38776 0 NA
19-8645786-A-C p.His1101Gln missense ADAMTS10 75772 75790 0.999762 37895 37879 1.0
19-8645786-A-T p.His1101Gln missense ADAMTS10 3 77686 3.8617E-5 38843 0 NA
19-8645811-C-T p.Arg1093His missense ADAMTS10 2 77908 2.56713E-5 38954 0 7.09912E-5
19-8645812-G-T p.Arg1093Ser missense ADAMTS10 1 77892 1.28383E-5 38946 0 8.86682E-6
19-8645819-G-C p.Ala1090Ala synonymous ADAMTS10 1 77878 1.28406E-5 38939 0 5.2939E-5
19-8645825-G-C p.Ser1088Arg missense ADAMTS10 1 77770 1.28584E-5 38885 0 NA
19-8645827-T-C p.Ser1088Gly missense ADAMTS10 2 77668 2.57506E-5 38834 0 9.67118E-5
19-8645835-T-C p.Gln1085Arg missense ADAMTS10 1 77658 1.2877E-5 38829 0 3.22685E-5
19-8645842-T-G p.Lys1083Gln missense ADAMTS10 1 77620 1.28833E-5 38810 0 NA
19-8645848-C-T p.Val1081Met missense ADAMTS10 1 77570 1.28916E-5 38785 0 NA
19-8645888-T-TTCA c.3203-3_3203-2insTGA splice_region ADAMTS10 2 77108 2.59376E-5 38554 0 NA
19-8645889-G-GGGCCGTCCC c.3203-4_3203-3insGGGACGGCC splice_region ADAMTS10 1 77154 1.29611E-5 38577 0 NA
19-8645890-CGG-C c.3203-6_3203-5delCC splice_region ADAMTS10 2 77112 2.59363E-5 38556 0 1.22949E-5
19-8645891-G-A c.3203-5C>T splice_region ADAMTS10 4 77114 5.18713E-5 38557 0 1.19301E-4
19-8649788-C-T p.Gly1065Ser missense ADAMTS10 143 49772 0.0028731 24886 0 0.00666709
19-8649788-C-G p.Gly1065Arg missense ADAMTS10 1 49786 2.0086E-5 24893 0 NA
19-8649793-C-A p.Gly1063Val missense ADAMTS10 1 48934 2.04357E-5 24467 0 NA
19-8649832-G-A p.Thr1050Met missense ADAMTS10 1 44998 2.22232E-5 22499 0 7.08215E-6
19-8649839-G-C p.Pro1048Ala missense ADAMTS10 1 44366 2.25398E-5 22183 0 NA
19-8649840-C-A p.Pro1047Pro synonymous ADAMTS10 2 44232 4.52161E-5 22116 0 3.19163E-5
19-8649845-G-T p.Arg1046Arg synonymous ADAMTS10 1 43902 2.2778E-5 21951 0 NA
19-8649858-G-A p.Cys1041Cys synonymous ADAMTS10 3 43330 6.92361E-5 21665 0 7.24501E-6
19-8649879-C-T p.Thr1034Thr synonymous ADAMTS10 575 42438 0.0135492 21219 24 0.0304898
19-8649901-G-C p.Ser1027Trp missense ADAMTS10 1 41576 2.40523E-5 20788 0 NA
19-8649938-ACTGCGAGGGGGCACCACTCAGTTGCTGCCCCGCAGCCCCTGCCCTGGCCCCCACCCCTCTGGGGCGCGCCCTCCTAC-A c.3042+1_3043-1delGTAGGAGGGCGCGCCCCAGAGGGGTGGGGGCCAGGGCAGGGGCTGCGGGGCAGCAACTGAGTGGTGCCCCCTCGCAG splice_acceptor ADAMTS10 6 41692 1.43913E-4 20846 0 NA
19-8649943-G-GAGGGGGC c.3043-6_3043-5insGCCCCCT splice_region ADAMTS10 7656 41086 0.186341 20543 748 0.192285
19-8649943-G-A c.3043-5C>T splice_region ADAMTS10 6 41480 1.44648E-4 20740 0 1.06769E-4
19-8649946-G-A c.3043-8C>T splice_region ADAMTS10 4 41864 9.55475E-5 20932 0 5.80682E-5
19-8650045-C-G p.Ala1005Pro missense ADAMTS10 1 45744 2.18608E-5 22872 0 NA
19-8650076-G-C p.Thr994Thr synonymous ADAMTS10 28 50704 5.52225E-4 25352 0 0.00403226
19-8650082-C-A p.Pro992Pro synonymous ADAMTS10 1 51394 1.94575E-5 25697 0 6.76559E-5
19-8650102-A-G p.Ser986Pro missense ADAMTS10 1 54078 1.84918E-5 27039 0 NA
19-8650120-G-C p.Leu980Val missense ADAMTS10 1 59242 1.68799E-5 29621 0 4.56215E-5
19-8650140-C-G p.Ser973Thr missense ADAMTS10 2 65960 3.03214E-5 32980 0 0.00107066
19-8650150-G-A p.Leu970Phe missense ADAMTS10 1 68386 1.46229E-5 34193 0 NA
19-8650187-G-A p.Thr957Thr synonymous ADAMTS10 1 72436 1.38053E-5 36218 0 NA
19-8650194-T-TCA c.2866-3_2866-2insTG splice_region ADAMTS10 1 73206 1.36601E-5 36603 0 NA
19-8650351-C-A p.Asp952Tyr missense ADAMTS10 1 58106 1.72099E-5 29053 0 NA
19-8650355-G-T p.Ala950Ala synonymous ADAMTS10 1 57584 1.73659E-5 28792 0 NA
19-8650360-C-T p.Ala949Thr missense ADAMTS10 22 57260 3.84212E-4 28630 0 0.00211864
19-8650367-C-T p.Pro946Pro synonymous ADAMTS10 3 57142 5.25008E-5 28571 0 7.05328E-6
19-8650395-T-C p.Glu937Gly missense ADAMTS10 2 53412 3.74448E-5 26706 0 7.05318E-5
19-8650397-C-T p.Leu936Leu synonymous ADAMTS10 1 53236 1.87843E-5 26618 0 6.49984E-6
19-8650399-G-A p.Leu936Leu synonymous ADAMTS10 1 52978 1.88758E-5 26489 0 6.50161E-6
19-8650417-G-A p.Gln930* stop_gained ADAMTS10 1 48900 2.04499E-5 24450 0 NA
19-8650424-T-TGCGCTGTCGTCCAGCGCCTTCTCCTCCGCGGCAGAGACG p.Ala927_Cys928insValSerAlaAlaGluGluLysAlaLeuAspAspSerAla disruptive_inframe_insertion ADAMTS10 1 48016 2.08264E-5 24008 0 6.38447E-5
19-8650427-G-T p.Ser926Arg missense ADAMTS10 3 47126 6.36591E-5 23563 0 4.01606E-5
19-8650432-C-T p.Asp925Asn missense ADAMTS10 4 46610 8.58185E-5 23305 0 7.09119E-5
19-8650453-C-T p.Ala918Thr missense ADAMTS10 1 43898 2.27801E-5 21949 0 NA
19-8650463-G-T p.Arg914Arg synonymous ADAMTS10 1 42968 2.32731E-5 21484 0 4.41108E-6
19-8650477-C-A p.Val910Leu missense ADAMTS10 1 41666 2.40004E-5 20833 0 3.19101E-5
19-8650478-G-C p.Val909Val synonymous ADAMTS10 1 41420 2.41429E-5 20710 0 4.3281E-6
19-8650481-C-T p.Ser908Ser synonymous ADAMTS10 1 41152 2.43002E-5 20576 0 4.33028E-6
19-8650543-A-AGTCTGGAGGGCAAGGCTCCGTGTTGCAGGCGCGCTGCCTTTTGGGCAGCTT p.Asp887_Trp888insLysLeuProLysArgGlnArgAlaCysAsnThrGluProCysProProAsp conservative_inframe_insertion ADAMTS10 1 34550 2.89436E-5 17275 0 NA
19-8650544-G-T p.Asp887Glu missense+splice_region ADAMTS10 3 34548 8.68357E-5 17274 0 NA
19-8650552-A-C c.2661-8T>G splice_region ADAMTS10 4 34378 1.16353E-4 17189 0 6.25E-4
19-8651023-C-T p.Thr881Thr synonymous ADAMTS10 2 80196 2.49389E-5 40098 0 0.0020202
19-8651034-C-T p.Ala878Thr missense ADAMTS10 2 80056 2.49825E-5 40028 0 NA
19-8651035-G-T p.Arg877Arg synonymous ADAMTS10 1 80030 1.24953E-5 40015 0 NA
19-8651048-G-A p.Pro873Leu missense ADAMTS10 1 79496 1.25792E-5 39748 0 NA
19-8651048-G-C p.Pro873Arg missense ADAMTS10 1 79496 1.25792E-5 39748 0 NA
19-8651049-G-A p.Pro873Ser missense ADAMTS10 1 79498 1.25789E-5 39749 0 NA
19-8651071-G-A p.Tyr865Tyr synonymous ADAMTS10 2 79644 2.51117E-5 39822 0 4.01668E-6
19-8651076-G-C p.His864Asp missense ADAMTS10 1 79640 1.25565E-5 39820 0 NA
19-8651082-C-A p.Ala862Ser missense ADAMTS10 1144 79422 0.0144041 39711 46 0.0299445
19-8651089-G-A p.Ser859Ser synonymous ADAMTS10 1 79520 1.25755E-5 39760 0 8.05626E-6
19-8651103-G-T p.Gln855Lys missense ADAMTS10 2 79584 2.51307E-5 39792 0 8.06478E-6
19-8651107-G-A p.Arg853Arg synonymous ADAMTS10 1 79432 1.25894E-5 39716 0 2.59983E-5
19-8651120-G-A p.Ala849Val missense ADAMTS10 1 79268 1.26154E-5 39634 0 8.7014E-6
19-8651133-TACCTGGAGGGGAGGGTGAGAGGCCTGCTCAGCCCCTCCCGGCCCAGAGAACCTCAGCCCAGGTATCTTGTGCCTTCCCCCACCCCCGGCCTC-T p.Gly844fs frameshift ADAMTS10 7 79224 8.83571E-5 39612 0 NA
19-8651140-A-G c.2531-5T>C splice_region ADAMTS10 1 79090 1.26438E-5 39545 0 NA
19-8651245-G-C p.Ser838Trp missense ADAMTS10 1 77896 1.28376E-5 38948 0 NA
19-8651252-T-A p.Lys836* stop_gained ADAMTS10 1 78086 1.28064E-5 39043 0 NA
19-8651281-G-T p.Pro826His missense ADAMTS10 12 78742 1.52396E-4 39371 0 3.18451E-4
19-8651285-G-A p.Pro825Ser missense ADAMTS10 1 78682 1.27094E-5 39341 0 3.18532E-5
19-8651286-C-T p.Leu824Leu synonymous ADAMTS10 1 78696 1.27071E-5 39348 0 NA
19-8651289-C-G p.Ser823Ser synonymous ADAMTS10 4 78736 5.08027E-5 39368 0 4.01542E-6
19-8651289-C-T p.Ser823Ser synonymous ADAMTS10 1 78736 1.27007E-5 39368 0 1.70888E-5
19-8651297-G-A p.Arg821Cys missense ADAMTS10 1 79098 1.26425E-5 39549 0 8.02517E-6
19-8651311-T-C p.Asn816Ser missense ADAMTS10 4 79708 5.01832E-5 39854 0 NA
19-8651316-GC-TT p.Arg814Gln missense ADAMTS10 4 79802 5.01241E-5 39901 0 NA
19-8651318-G-A p.Arg814Cys missense ADAMTS10 1 79856 1.25225E-5 39928 0 NA
19-8651325-G-A p.Leu811Leu synonymous ADAMTS10 1 80114 1.24822E-5 40057 0 8.00307E-6
19-8651330-C-T p.Ala810Thr missense ADAMTS10 2 80092 2.49713E-5 40046 0 NA
19-8651335-A-C p.Leu808Arg missense ADAMTS10 1021 80124 0.0127427 40062 39 0.0266263
19-8651336-G-C p.Leu808Val missense ADAMTS10 2 80218 2.49321E-5 40109 0 8.48162E-6
19-8651337-C-G p.Glu807Asp missense ADAMTS10 1 80214 1.24667E-5 40107 0 3.18918E-5
19-8651338-T-C p.Glu807Gly missense ADAMTS10 1 80226 1.24648E-5 40113 0 1.69604E-5
19-8651339-C-T p.Glu807Lys missense ADAMTS10 1 80236 1.24632E-5 40118 0 9.56999E-5
19-8651340-G-T p.Thr806Thr synonymous ADAMTS10 1 80268 1.24583E-5 40134 0 1.69523E-5
19-8651343-C-T p.Arg805Arg synonymous ADAMTS10 15 80314 1.86767E-4 40157 0 2.8721E-4
19-8651349-C-G p.Leu803Leu synonymous ADAMTS10 38 80372 4.72801E-4 40186 0 0.00172172
19-8651352-CACCTGGAGAAAGGGGGCGGCAGCCAGTGGAAGGATCGCATGGAGTCTCTAATTCCAAAGGCTGCACCTTGCCCCCAGTCTCCCTGTT-C p.Val802fs frameshift ADAMTS10 7 80370 8.70972E-5 40185 0 NA
19-8651434-C-T c.2403+8G>A splice_region ADAMTS10 1 80864 1.23664E-5 40432 0 6.25E-4
19-8651438-T-C c.2403+4A>G splice_region ADAMTS10 724 80854 0.00895441 40427 4 0.00609095
19-8651438-T-G c.2403+4A>C splice_region ADAMTS10 1 80864 1.23664E-5 40432 0 NA
19-8651447-C-T p.Val800Ile missense ADAMTS10 1 80852 1.23683E-5 40426 0 3.18715E-5
19-8651447-C-A p.Val800Phe missense ADAMTS10 1 80852 1.23683E-5 40426 0 1.19476E-5
19-8651457-T-C p.Ala796Ala synonymous ADAMTS10 29 80836 3.58751E-4 40418 0 2.4784E-4
19-8651461-T-C p.Asn795Ser missense ADAMTS10 5 80820 6.18659E-5 40410 0 1.19393E-5
19-8651466-C-T p.Pro793Pro synonymous ADAMTS10 1 80784 1.23787E-5 40392 0 3.97991E-6
19-8651475-G-A p.Ala790Ala synonymous ADAMTS10 15 80694 1.85887E-4 40347 0 6.25E-4
19-8651478-T-G p.Glu789Asp missense ADAMTS10 2 80660 2.47954E-5 40330 0 NA
19-8651487-C-T p.Gln786Gln synonymous ADAMTS10 6 80542 7.44953E-5 40271 0 0.00125
19-8651492-C-A p.Val785Phe missense ADAMTS10 1 80448 1.24304E-5 40224 0 3.97798E-6
19-8651516-G-A p.Gln777* stop_gained ADAMTS10 1 80098 1.24847E-5 40049 0 NA
19-8651523-G-A p.Thr774Thr synonymous ADAMTS10 2 80058 2.49819E-5 40029 0 8.26228E-6
19-8651524-G-A p.Thr774Ile missense ADAMTS10 1 80052 1.24919E-5 40026 0 NA
19-8651528-C-T p.Gly773Arg missense ADAMTS10 1 80056 1.24913E-5 40028 0 NA
19-8651557-G-C p.Thr763Ser missense ADAMTS10 35 80230 4.36246E-4 40115 0 0.00125
19-8651557-G-T p.Thr763Asn missense ADAMTS10 1 80230 1.24642E-5 40115 0 NA
19-8651562-A-G p.Pro761Pro synonymous ADAMTS10 17156 79834 0.214896 39917 1833 0.231725
19-8651562-A-T p.Pro761Pro synonymous ADAMTS10 3 80372 3.73264E-5 40186 0 3.98877E-6
19-8651564-GCAGCCCCTCCAGCAGCAGGGAC-G p.Glu753fs frameshift ADAMTS10 1 80400 1.24378E-5 40200 0 NA
19-8651580-C-T p.Leu755Leu synonymous ADAMTS10 3 80692 3.71784E-5 40346 0 2.47942E-5
19-8651584-G-A p.Ser754Phe missense ADAMTS10 70 80742 8.66959E-4 40371 0 0.00197792
19-8651598-C-T p.Lys749Lys synonymous ADAMTS10 6 80858 7.42042E-5 40429 0 6.25E-4
19-8651601-C-T p.Leu748Leu synonymous ADAMTS10 1 80866 1.23661E-5 40433 0 NA
19-8651605-GCTGGGGGACGATGCAGGGTTCAGAATTCTAGTCATGCTGAAACCGCCCTCCCCACTGACCCCTAATCCTCATCCCCTCCCCACCATCTGCTCAC-G c.2239+1_2240-1delGTGAGCAGATGGTGGGGAGGGGATGAGGATTAGGGGTCAGTGGGGAGGGCGGTTTCAGCATGACTAGAATTCTGAACCCTGCATCGTCCCCCAG splice_acceptor ADAMTS10 11 80874 1.36014E-4 40437 4 NA
19-8651718-G-A p.Leu741Phe missense ADAMTS10 1 81056 1.23371E-5 40528 0 NA
19-8651746-G-C p.Ser731Ser synonymous ADAMTS10 1 81044 1.2339E-5 40522 0 3.18634E-5
19-8651746-G-A p.Ser731Ser synonymous ADAMTS10 2 81044 2.4678E-5 40522 0 4.94226E-5
19-8651750-C-G p.Gly730Ala missense ADAMTS10 2 81042 2.46786E-5 40521 0 8.23696E-6
19-8651767-G-A p.Val724Val synonymous ADAMTS10 1 81028 1.23414E-5 40514 0 2.47125E-5
19-8651776-G-A p.Tyr721Tyr synonymous ADAMTS10 15 81000 1.85185E-4 40500 0 6.3743E-4
19-8651787-A-G c.2159-7T>C splice_region ADAMTS10 1 80974 1.23496E-5 40487 0 NA
19-8654126-C-A p.Gly720Trp missense+splice_region ADAMTS10 2 78998 2.53171E-5 39499 0 6.37796E-5
19-8654127-G-C p.Ala719Ala splice_region+synonymous ADAMTS10 429 78978 0.00543189 39489 2 0.00462549
19-8654127-G-A p.Ala719Ala splice_region+synonymous ADAMTS10 1 78986 1.26605E-5 39493 0 4.0345E-6
19-8654130-C-T p.Gly718Gly synonymous ADAMTS10 52 79024 6.58028E-4 39512 0 0.00232795
19-8654143-G-A p.Pro714Leu missense ADAMTS10 2 79182 2.52583E-5 39591 0 3.19122E-5
19-8654153-C-T p.Val711Ile missense ADAMTS10 2 79104 2.52832E-5 39552 0 1.61379E-5
19-8654154-G-A p.Gly710Gly synonymous ADAMTS10 7 79064 8.85359E-5 39532 0 4.2342E-5
19-8654159-C-T p.Glu709Lys missense ADAMTS10 1 79194 1.26272E-5 39597 0 0.001875
19-8654160-G-A p.Ile708Ile synonymous ADAMTS10 3 79248 3.78558E-5 39624 0 4.2347E-5
19-8654164-G-A p.Thr707Ile missense ADAMTS10 2 79276 2.52283E-5 39638 0 NA
19-8654168-C-T p.Glu706Lys missense ADAMTS10 4 79194 5.05089E-5 39597 0 4.84035E-5
19-8654179-C-T p.Gly702Asp missense ADAMTS10 1 79294 1.26113E-5 39647 0 NA
19-8654180-C-T p.Gly702Ser missense ADAMTS10 2 79278 2.52277E-5 39639 0 6.05337E-5
19-8654181-G-A p.Asp701Asp synonymous ADAMTS10 5 79286 6.30628E-5 39643 0 5.08664E-5
19-8654184-A-T p.Gly700Gly synonymous ADAMTS10 4 79288 5.0449E-5 39644 0 3.63261E-5
19-8654186-C-T p.Gly700Ser missense ADAMTS10 6 79512 7.54603E-5 39756 0 6.38203E-5
19-8654212-C-G p.Arg691Pro missense ADAMTS10 1 79430 1.25897E-5 39715 0 NA
19-8654214-C-G p.Leu690Leu synonymous ADAMTS10 17 79374 2.14176E-4 39687 0 9.27719E-5
19-8654219-C-T p.Asp689Asn missense ADAMTS10 4 79260 5.04668E-5 39630 0 2.01854E-5
19-8654238-G-A p.Cys682Cys synonymous ADAMTS10 1 78834 1.26849E-5 39417 0 1.62492E-5
19-8654246-C-T p.Val680Met missense ADAMTS10 3 78756 3.80923E-5 39378 0 5.12059E-5
19-8654249-GCTGCGTGGAGAAGGCGTGAGTGAGGCGACCCCCTAACCCACCCCCGCTCCCCATCCCCTCTCCACCTCCCTGGGAGTCCCCTCCAC-G c.2034+1_2035-1delGTGGAGGGGACTCCCAGGGAGGTGGAGAGGGGATGGGGAGCGGGGGTGGGTTAGGGGGTCGCCTCACTCACGCCTTCTCCACGCAG splice_acceptor ADAMTS10 11 78578 1.39988E-4 39289 5 NA
19-8654253-C-T c.2035-4G>A splice_region ADAMTS10 1 78428 1.27505E-5 39214 0 1.70847E-5
19-8654330-C-T c.2034+6G>A splice_region ADAMTS10 1 79690 1.25486E-5 39845 0 4.19041E-5
19-8654339-G-C p.Cys677Trp missense ADAMTS10 1 80046 1.24928E-5 40023 0 NA
19-8654353-C-T p.Val673Ile missense ADAMTS10 1 80410 1.24363E-5 40205 0 2.39467E-5
19-8654354-G-A p.Cys672Cys synonymous ADAMTS10 191 80410 0.00237533 40205 0 0.00368968
19-8654365-C-G p.Val669Leu missense ADAMTS10 16 80466 1.98842E-4 40233 0 2.58015E-4
19-8654365-C-A p.Val669Leu missense ADAMTS10 1 80466 1.24276E-5 40233 0 3.1955E-5
19-8654366-C-T p.Thr668Thr synonymous ADAMTS10 1 80462 1.24282E-5 40231 0 NA
19-8654367-G-A p.Thr668Met missense ADAMTS10 1 80452 1.24298E-5 40226 0 3.20431E-5
19-8654368-T-C p.Thr668Ala missense ADAMTS10 1 80458 1.24288E-5 40229 0 NA
19-8654376-C-T p.Arg665His missense ADAMTS10 7 80434 8.70279E-5 40217 0 1.08218E-4
19-8654381-G-A p.Pro663Pro synonymous ADAMTS10 3 80412 3.73079E-5 40206 0 NA
19-8654389-C-T p.Gly661Arg missense ADAMTS10 1 80374 1.24418E-5 40187 0 3.99243E-6
19-8654399-G-A p.Ala657Ala synonymous ADAMTS10 20 80292 2.49091E-4 40146 0 0.00138527
19-8654404-C-G p.Ala656Pro missense ADAMTS10 1 80180 1.24719E-5 40090 0 NA
19-8654405-C-T p.Ala655Ala synonymous ADAMTS10 1 80186 1.2471E-5 40093 0 5.59942E-5
19-8654414-C-T p.Thr652Thr synonymous ADAMTS10 7 80062 8.74322E-5 40031 0 1.27992E-4
19-8654435-C-T p.Ala645Ala synonymous ADAMTS10 64 79904 8.00961E-4 39952 0 6.37592E-4
19-8654444-C-T p.Thr642Thr synonymous ADAMTS10 5 79824 6.26378E-5 39912 0 4.19315E-5
19-8654445-G-A p.Thr642Met missense ADAMTS10 15 79800 1.8797E-4 39900 0 2.26464E-4
19-8654450-C-T p.Ser640Ser synonymous ADAMTS10 24 79716 3.01069E-4 39858 0 2.552E-4
19-8654450-C-G p.Ser640Ser synonymous ADAMTS10 1 79716 1.25445E-5 39858 0 NA
19-8654453-G-A p.Cys639Cys synonymous ADAMTS10 1 79720 1.25439E-5 39860 0 1.60355E-5
19-8654458-C-A p.Ala125Ser missense+splice_region ADAMTS10 1 79566 1.25682E-5 39783 0 4.01584E-6
19-8654471-T-TG c.1901-3dupC splice_region ADAMTS10 1 79198 1.26266E-5 39599 0 8.49748E-6
19-8654477-G-A c.1901-8C>T splice_region ADAMTS10 6 79154 7.58016E-5 39577 0 6.38121E-5
19-8654767-A-G c.1900+6T>C splice_region ADAMTS10 1 80786 1.23784E-5 40393 0 8.42915E-6
19-8654778-C-T p.Arg632Gln missense ADAMTS10 1 80868 1.23658E-5 40434 0 4.16438E-5
19-8654779-G-A p.Arg632Trp missense ADAMTS10 1 80860 1.23671E-5 40430 0 8.75608E-5
19-8654779-G-C p.Arg632Gly missense ADAMTS10 1 80860 1.23671E-5 40430 0 NA
19-8654783-C-T p.Arg121His missense ADAMTS10 1 80898 1.23612E-5 40449 0 6.37024E-5
19-8654786-T-C p.Lys120Arg missense ADAMTS10 31 80926 3.83066E-4 40463 0 7.00994E-4
19-8654793-T-G p.Lys627Thr missense ADAMTS10 5 80932 6.17803E-5 40466 0 1.65431E-5
19-8654798-G-A p.Ser116Phe missense ADAMTS10 2 80948 2.47072E-5 40474 0 7.95634E-6
19-8654868-G-T p.Pro602His missense ADAMTS10 1 80652 1.23989E-5 40326 0 NA
19-8654869-G-C p.Pro602Ala missense ADAMTS10 2 80636 2.48028E-5 40318 0 7.9841E-6
19-8654870-A-G p.Val92Ala missense ADAMTS10 212 80566 0.00263138 40283 0 0.00736748
19-8654881-G-A c.1798-6C>T splice_region ADAMTS10 75 80292 9.34091E-4 40146 0 0.00625
19-8656738-G-A p.Ser72Leu missense ADAMTS10 53 80102 6.61656E-4 40051 0 0.00100705
19-8656740-T-C p.Ile581Val missense ADAMTS10 1 80082 1.24872E-5 40041 0 7.9769E-6
19-8656742-G-A p.Thr580Ile missense ADAMTS10 1 80068 1.24894E-5 40034 0 NA
19-8656743-T-C p.Thr580Ala missense ADAMTS10 1 80054 1.24916E-5 40027 0 3.9888E-6
19-8656746-GCCTGGAAAGGGTGGTGGGATAGGAGAGGGATGAGGCAGTGGGCGATGGGGGCAGGGGTCGCGCTGCCCTCCCGGGTGGGGGTCCTGAGGGCTGA-G p.Arg578fs frameshift ADAMTS10 8 79990 1.00013E-4 39995 2 NA
19-8656752-A-G c.1734-5T>C splice_region ADAMTS10 2 79842 2.50495E-5 39921 0 4.13976E-5
19-8656849-T-C p.Ser576Gly missense ADAMTS10 1 76918 1.30009E-5 38459 0 NA
19-8656855-A-T p.Cys574Ser missense ADAMTS10 1 77110 1.29685E-5 38555 0 NA
19-8656856-G-A p.Thr64Ile missense ADAMTS10 123 77126 0.00159479 38563 0 0.00223143
19-8656865-A-G p.Leu61Pro missense ADAMTS10 2 77412 2.58358E-5 38706 0 3.18898E-5
19-8656882-C-T p.Gly565Ser missense ADAMTS10 2 78126 2.55997E-5 39063 0 3.18776E-5
19-8656883-G-A p.Ala55Val missense ADAMTS10 1 78162 1.27939E-5 39081 0 NA
19-8656887-C-A p.Cys563Phe missense ADAMTS10 1 78448 1.27473E-5 39224 0 4.05249E-6
19-8656901-G-A p.Thr49Ile missense ADAMTS10 1 78888 1.26762E-5 39444 0 NA
19-8656920-G-A p.Pro552Leu missense ADAMTS10 3 79198 3.78797E-5 39599 0 2.8247E-5
19-8656952-C-G p.Arg32Pro missense ADAMTS10 1 79702 1.25467E-5 39851 0 7.7474E-5
19-8656958-A-C p.Phe539Leu missense ADAMTS10 1 79806 1.25304E-5 39903 0 NA
19-8656972-C-T p.Val535Ile missense ADAMTS10 2 79742 2.50809E-5 39871 0 3.44964E-5
19-8656988-C-CCCCT p.Ser20fs frameshift ADAMTS10 1 79514 1.25764E-5 39757 0 NA
19-8656990-G-GTCGAT p.Gly21fs frameshift ADAMTS10 1 79466 1.2584E-5 39733 0 NA
19-8656992-G-A p.Pro19Ser missense ADAMTS10 1 79424 1.25907E-5 39712 0 4.05518E-6
19-8656993-T-TG p.Pro19fs frameshift ADAMTS10 1 79322 1.26068E-5 39661 0 1.27771E-4
19-8656994-G-C p.Pro18Arg missense ADAMTS10 977 79328 0.012316 39664 39 0.0255037
19-8656997-G-A p.Pro17Leu missense ADAMTS10 1 79344 1.26033E-5 39672 0 NA
19-8656998-G-A p.Pro17Ser missense ADAMTS10 30 79320 3.78215E-4 39660 0 0.00146515
19-8657000-A-C p.Leu16Arg missense ADAMTS10 3 79244 3.78578E-5 39622 0 2.17505E-4
19-8657000-A-T p.Leu16His missense ADAMTS10 1 79244 1.26193E-5 39622 0 NA
19-8657012-G-A p.Thr12Ile missense ADAMTS10 1 79064 1.2648E-5 39532 0 3.18613E-5
19-8657016-G-T p.Leu11Ile missense ADAMTS10 1 78976 1.26621E-5 39488 0 1.75756E-5
19-8657024-C-T p.Arg8Gln missense ADAMTS10 1 78788 1.26923E-5 39394 0 NA
19-8657025-G-A p.Arg8Trp missense ADAMTS10 1880 78702 0.0238876 39351 49 0.0352086
19-8657029-G-A p.Val6Val synonymous ADAMTS10 1 78688 1.27084E-5 39344 0 NA
19-8657038-C-G p.Pro3Pro synonymous ADAMTS10 3 78464 3.82341E-5 39232 0 1.81488E-5
19-8657038-C-T p.Pro3Pro synonymous ADAMTS10 2 78464 2.54894E-5 39232 0 3.62976E-5
19-8657038-C-A p.Pro3Pro synonymous ADAMTS10 3 78464 3.82341E-5 39232 0 2.72232E-5
19-8657042-C-T p.Gly2Glu missense ADAMTS10 1 78428 1.27505E-5 39214 0 NA
19-8657045-A-G p.Met1? start_lost ADAMTS10 2 78352 2.55258E-5 39176 0 2.91686E-5
19-8657050-C-T c.-4G>A 5_prime_UTR_premature_start_codon_gain ADAMTS10 1 78182 1.27907E-5 39091 0 NA
19-8657060-C-T c.-14G>A 5_prime_UTR_premature_start_codon_gain ADAMTS10 1 77952 1.28284E-5 38976 0 3.50976E-5
19-8657093-G-A c.-47C>T 5_prime_UTR_premature_start_codon_gain ADAMTS10 7 77596 9.02108E-5 38798 0 2.28781E-4
19-8657640-C-T c.1587+7G>A splice_region ADAMTS10 1 64484 1.55077E-5 32242 0 6.37471E-5
19-8657653-G-A p.Asp527Asp synonymous ADAMTS10 1 68202 1.46623E-5 34101 0 6.37227E-5
19-8657655-C-T p.Asp527Asn missense ADAMTS10 1 68636 1.45696E-5 34318 0 9.46145E-6
19-8657658-T-C p.Ile526Val missense ADAMTS10 1 69522 1.43839E-5 34761 0 NA
19-8657664-G-A p.His524Tyr missense ADAMTS10 1 70250 1.42349E-5 35125 0 NA
19-8657665-C-T p.Thr523Thr synonymous ADAMTS10 5 70250 7.11744E-5 35125 0 4.08163E-5
19-8657689-G-A p.Ala515Ala synonymous ADAMTS10 1 72750 1.37457E-5 36375 0 NA
19-8657692-C-T p.Pro514Pro synonymous ADAMTS10 6 73020 8.21693E-5 36510 0 5.03525E-4
19-8657703-T-C p.Asn511Asp missense ADAMTS10 1 73978 1.35175E-5 36989 0 NA
19-8657714-C-T p.Arg507Gln missense ADAMTS10 2 74056 2.70066E-5 37028 0 2.61844E-5
19-8657715-G-A p.Arg507Trp missense ADAMTS10 1 74012 1.35113E-5 37006 0 6.37633E-5
19-8657740-C-T p.Glu498Glu synonymous ADAMTS10 2 72722 2.7502E-5 36361 0 1.21993E-5
19-8657758-C-A c.1480-4G>T splice_region ADAMTS10 8 69104 1.15768E-4 34552 0 1.03944E-4
19-8657762-C-T c.1480-8G>A splice_region ADAMTS10 1 68034 1.46985E-5 34017 0 1.03515E-5
19-8660499-C-T n.574G>A splice_region ADAMTS10 101 71698 0.00140869 35849 0 4.78897E-4
19-8660499-C-G n.574G>C splice_region ADAMTS10 1 71708 1.39454E-5 35854 0 NA
19-8660662-C-T p.Arg488His missense ADAMTS10 2 80934 2.47115E-5 40467 0 2.38643E-5
19-8660677-T-C p.His483Arg missense ADAMTS10 2 81010 2.46883E-5 40505 0 NA
19-8660687-G-A p.Arg480Cys missense ADAMTS10 1 81028 1.23414E-5 40514 0 NA
19-8660694-C-T p.Glu477Glu synonymous ADAMTS10 1 81056 1.23371E-5 40528 0 8.23696E-6
19-8660694-C-G p.Glu477Asp missense ADAMTS10 1 81056 1.23371E-5 40528 0 3.97643E-6
19-8660703-A-G p.Asp474Asp synonymous ADAMTS10 1 81038 1.23399E-5 40519 0 NA
19-8660705-C-T p.Asp474Asn missense ADAMTS10 1 81042 1.23393E-5 40521 0 7.95286E-6
19-8660706-G-A p.Tyr473Tyr synonymous ADAMTS10 4 81024 4.93681E-5 40512 0 1.91168E-4
19-8660715-G-T p.Gly470Gly synonymous ADAMTS10 7 81004 8.64155E-5 40502 0 4.94226E-5
19-8660730-C-T p.Pro465Pro synonymous ADAMTS10 5 80950 6.17665E-5 40475 0 1.59205E-4
19-8660737-A-G p.Val463Ala missense ADAMTS10 5 80858 6.18368E-5 40429 0 3.18634E-5
19-8660750-T-TG p.Arg459fs frameshift ADAMTS10 1 80856 1.23677E-5 40428 0 NA
19-8660751-G-A p.Pro458Pro synonymous ADAMTS10 1 80884 1.23634E-5 40442 0 8.23818E-6
19-8660751-G-T p.Pro458Pro synonymous ADAMTS10 1 80884 1.23634E-5 40442 0 1.07384E-4
19-8660751-G-C p.Pro458Pro synonymous ADAMTS10 1 80882 1.23637E-5 40441 0 6.25E-4
19-8660754-G-C p.Pro457Pro synonymous ADAMTS10 1 80880 1.2364E-5 40440 0 7.95342E-6
19-8660756-GCC-G p.Arg456fs frameshift ADAMTS10 1 80856 1.23677E-5 40428 0 NA
19-8660758-C-CGGG p.Asn455_Arg456insPro conservative_inframe_insertion ADAMTS10 1 80824 1.23726E-5 40412 0 NA
19-8660758-C-T p.Arg456Gln missense ADAMTS10 10 80824 1.23726E-4 40412 0 6.91981E-4
19-8660775-C-A p.Gly450Gly synonymous ADAMTS10 469 80778 0.00580604 40389 4 0.0111586
19-8660778-C-T p.Leu449Leu synonymous ADAMTS10 1 80814 1.23741E-5 40407 0 NA
19-8660785-G-A p.Ser447Leu missense+splice_region ADAMTS10 25 80768 3.09529E-4 40384 0 0.00125
19-8660795-G-C c.1338-8C>G splice_region ADAMTS10 1 80786 1.23784E-5 40393 0 3.97826E-6
19-8660958-C-T p.Asp446Asn missense+splice_region ADAMTS10 1 80350 1.24456E-5 40175 0 8.24158E-6
19-8660962-A-G p.Phe444Phe synonymous ADAMTS10 1 80402 1.24375E-5 40201 0 NA
19-8660965-G-A p.Ser443Ser synonymous ADAMTS10 1 80450 1.24301E-5 40225 0 NA
19-8660981-C-T p.Arg438His missense ADAMTS10 2 80602 2.48133E-5 40301 0 3.18593E-5
19-8660986-G-A p.Cys436Cys synonymous ADAMTS10 2 80630 2.48047E-5 40315 0 NA
19-8660990-G-A p.Ser435Phe missense ADAMTS10 1 80672 1.23959E-5 40336 0 8.24103E-6
19-8661010-G-T p.Thr428Thr synonymous ADAMTS10 2 80778 2.47592E-5 40389 0 6.37186E-5
19-8661029-G-A p.Ala422Val missense ADAMTS10 47 80828 5.81482E-4 40414 0 2.96667E-4
19-8661043-G-A p.Ala417Ala synonymous ADAMTS10 2 80854 2.47359E-5 40427 0 NA
19-8661046-T-C p.Pro416Pro synonymous ADAMTS10 1 80856 1.23677E-5 40428 0 8.24103E-6
19-8661059-C-T p.Arg412His missense ADAMTS10 1 80828 1.2372E-5 40414 0 1.64834E-5
19-8661064-C-T p.Gly410Gly synonymous ADAMTS10 1 80826 1.23723E-5 40413 0 8.24158E-6
19-8661081-C-T p.Val405Met missense ADAMTS10 1 80788 1.23781E-5 40394 0 3.97972E-6
19-8661190-C-G c.1190+1G>C splice_donor ADAMTS10 1 80004 1.24994E-5 40002 0 NA
19-8661191-G-A p.Thr397Ile missense+splice_region ADAMTS10 3 79994 3.75028E-5 39997 0 4.20444E-5
19-8661198-C-T p.Gly395Arg missense ADAMTS10 1 80062 1.24903E-5 40031 0 8.4364E-6
19-8661199-G-A p.Ile394Ile synonymous ADAMTS10 2 80066 2.49794E-5 40033 0 NA
19-8661200-A-G p.Ile394Thr missense ADAMTS10 1 80076 1.24881E-5 40038 0 NA
19-8661205-G-A p.His392His synonymous ADAMTS10 2 80084 2.49738E-5 40042 0 1.35304E-4
19-8661212-A-T p.Ile390Asn missense ADAMTS10 1 80198 1.24691E-5 40099 0 NA
19-8661220-C-T p.Ala387Ala synonymous ADAMTS10 7 80200 8.72818E-5 40100 0 3.18593E-5
19-8661226-G-A p.Ala385Ala synonymous ADAMTS10 1 80238 1.24629E-5 40119 0 8.474E-6
19-8661232-G-A p.Gly383Gly synonymous ADAMTS10 6 80234 7.47813E-5 40117 0 0.0025227
19-8661237-T-C p.Ile382Val missense ADAMTS10 3 80324 3.73487E-5 40162 0 6.37227E-5
19-8661244-A-G p.Asn379Asn synonymous ADAMTS10 2 80316 2.49016E-5 40158 0 NA
19-8661249-C-T p.Val378Ile missense ADAMTS10 1 80302 1.2453E-5 40151 0 3.39524E-5
19-8661250-G-A p.Ser377Ser synonymous ADAMTS10 2 80294 2.49085E-5 40147 0 NA
19-8661262-C-T p.Glu373Glu synonymous ADAMTS10 1 80334 1.2448E-5 40167 0 NA
19-8661264-C-T p.Glu373Lys missense ADAMTS10 2 80316 2.49016E-5 40158 0 1.20396E-5
19-8661265-G-C p.Arg372Arg synonymous ADAMTS10 4 80296 4.98157E-5 40148 0 5.10412E-5
19-8661267-G-A p.Arg372Cys missense ADAMTS10 1 80304 1.24527E-5 40152 0 4.01146E-6
19-8661279-C-T p.Gly368Arg missense ADAMTS10 2 80346 2.48923E-5 40173 0 5.04541E-4
19-8661280-G-A p.Gly367Gly synonymous ADAMTS10 4 80316 4.98033E-5 40158 0 1.27478E-4
19-8661286-C-T p.Pro365Pro synonymous ADAMTS10 5 80340 6.22355E-5 40170 0 3.40936E-5
19-8661294-G-A p.Leu363Leu splice_region+synonymous ADAMTS10 1 80432 1.24329E-5 40216 0 8.49603E-6
19-8661300-G-A c.1085-4C>T splice_region ADAMTS10 1 80440 1.24316E-5 40220 0 9.55779E-5
19-8661419-C-T c.1084+7G>A splice_region ADAMTS10 4 80954 4.94108E-5 40477 0 3.97804E-5
19-8661420-G-A c.1084+6C>T splice_region ADAMTS10 2 80954 2.47054E-5 40477 0 1.2333E-4
19-8661422-G-A c.1084+4C>T splice_region ADAMTS10 1 80954 1.23527E-5 40477 0 3.97772E-6
19-8661436-G-A p.Cys358Cys synonymous ADAMTS10 1 80980 1.23487E-5 40490 0 8.24783E-6
19-8661442-T-C p.Lys356Lys synonymous ADAMTS10 1 80982 1.23484E-5 40491 0 3.97731E-6
19-8661466-A-G p.Tyr348Tyr synonymous ADAMTS10 3 80962 3.70544E-5 40481 0 8.26487E-5
19-8661470-C-CGTGTGATGAGCACTGCTGTGTCATGGTTAGCCACACCGTTCTCTGGAATGGCA c.1041-2_1041-1insTGCCATTCCAGAGAACGGTGTGGCTAACCATGACACAGCAGTGCTCATCACAC splice_acceptor ADAMTS10 1 80950 1.23533E-5 40475 0 NA
19-8661907-C-T p.Gly335Asp missense ADAMTS10 1 80794 1.23772E-5 40397 0 NA
19-8661909-G-A p.Asn334Asn synonymous ADAMTS10 1 80788 1.23781E-5 40394 0 4.4586E-4
19-8661912-C-A p.Glu333Asp missense ADAMTS10 1 80798 1.23765E-5 40399 0 NA
19-8661917-G-A p.Pro332Ser missense ADAMTS10 1 80790 1.23778E-5 40395 0 8.2375E-6
19-8661935-C-T p.Gly326Ser missense ADAMTS10 2 80772 2.47611E-5 40386 0 3.18492E-5
19-8661936-G-A p.Ser325Ser synonymous ADAMTS10 2 80756 2.4766E-5 40378 0 9.55657E-5
19-8661942-G-A p.Asn323Asn synonymous ADAMTS10 2 80788 2.47562E-5 40394 0 1.5906E-5
19-8661947-C-T p.Val322Met missense ADAMTS10 1 80786 1.23784E-5 40393 0 3.18552E-5
19-8661948-G-A p.Ile321Ile synonymous ADAMTS10 4 80790 4.95111E-5 40395 0 NA
19-8661951-G-A p.Ser320Ser synonymous ADAMTS10 1 80786 1.23784E-5 40393 0 NA
19-8661981-G-A p.Ser310Ser synonymous ADAMTS10 1 80826 1.23723E-5 40413 0 NA
19-8661989-C-T p.Gly308Arg missense ADAMTS10 5 80840 6.18506E-5 40420 0 1.23573E-4
19-8661990-G-A p.Ala307Ala synonymous ADAMTS10 1 80848 1.23689E-5 40424 0 3.29522E-5
19-8661996-G-A p.His305His synonymous ADAMTS10 1 80868 1.23658E-5 40434 0 3.97678E-6
19-8662013-T-C p.Thr300Ala missense ADAMTS10 1 80852 1.23683E-5 40426 0 NA
19-8662016-GCTGGGGATGGACAGAGGGAAATGCATGGGCACCCACCACCCAGGGGACGGCAGGACATGCTGGTATGAAGGGGAAGGGGAAGGGGAGGAAGTCCCCCGCAC-G c.894+1_895-1del splice_acceptor ADAMTS10 6 80868 7.4195E-5 40434 0 NA
19-8662113-C-T c.894+5G>A splice_region ADAMTS10 9 80988 1.11128E-4 40494 0 9.56267E-5
19-8662114-G-A c.894+4C>T splice_region ADAMTS10 2 80982 2.46968E-5 40491 0 3.30437E-5
19-8662114-GC-G c.894+3delG splice_region ADAMTS10 1 80982 1.23484E-5 40491 0 NA
19-8662118-C-T p.Gln298Gln splice_region+synonymous ADAMTS10 1 81020 1.23426E-5 40510 0 3.97829E-6
19-8662127-C-A p.Thr295Thr synonymous ADAMTS10 1 81008 1.23445E-5 40504 0 7.95653E-6
19-8662127-C-T p.Thr295Thr synonymous ADAMTS10 1 81008 1.23445E-5 40504 0 1.65448E-5
19-8662132-G-T p.Leu294Ile missense ADAMTS10 1 81014 1.23435E-5 40507 0 4.14175E-5
19-8662139-G-A p.Leu291Leu synonymous ADAMTS10 6 81012 7.40631E-5 40506 0 2.86642E-4
19-8662143-C-T p.Arg290His missense ADAMTS10 1 81002 1.23454E-5 40501 0 NA
19-8662145-A-G p.Thr289Thr synonymous ADAMTS10 1 80998 1.2346E-5 40499 0 3.97858E-6
19-8662150-C-T p.Val288Ile missense ADAMTS10 1 81002 1.23454E-5 40501 0 8.33014E-6
19-8662162-C-T p.Val284Ile missense ADAMTS10 1 80988 1.23475E-5 40494 0 6.25E-4
19-8662177-T-C p.Ser279Gly missense ADAMTS10 1 80946 1.23539E-5 40473 0 NA
19-8662178-C-T p.Arg280Gln missense ADAMTS10 7 80938 8.6486E-5 40469 0 0.00100806
19-8662178-C-A p.Arg280Leu missense ADAMTS10 2 80938 2.47103E-5 40469 0 3.18654E-5
19-8662179-G-A p.Arg280* stop_gained ADAMTS10 2 80928 2.47133E-5 40464 0 3.9833E-6
19-8662207-C-G c.811-1G>C splice_acceptor ADAMTS10 1 80808 1.2375E-5 40404 0 NA
19-8665811-C-T c.810+1G>A splice_donor ADAMTS10 1 80024 1.24963E-5 40012 0 3.18654E-5
19-8665824-G-A p.Ala266Ala synonymous ADAMTS10 1 80322 1.24499E-5 40161 0 NA
19-8665857-G-A p.His255His synonymous ADAMTS10 1 80780 1.23793E-5 40390 0 6.37146E-5
19-8665883-C-A p.Ala247Ser missense ADAMTS10 3 80916 3.70755E-5 40458 0 5.77825E-5
19-8665901-C-T p.Val241Met missense ADAMTS10 2 80886 2.47262E-5 40443 0 8.25873E-6
19-8665902-G-A p.Tyr240Tyr synonymous ADAMTS10 2 80886 2.47262E-5 40443 0 8.25941E-6
19-8665906-C-T p.Arg239His missense ADAMTS10 68 80868 8.40876E-4 40434 0 7.96229E-4
19-8665907-G-A p.Arg239Cys missense ADAMTS10 1 80860 1.23671E-5 40430 0 4.77513E-5
19-8665920-C-T p.Ser234Ser synonymous ADAMTS10 2 80842 2.47396E-5 40421 0 2.38781E-5
19-8665921-G-A p.Ser234Leu missense ADAMTS10 1 80818 1.23735E-5 40409 0 NA
19-8665945-C-T p.Arg226His missense ADAMTS10 4 80714 4.95577E-5 40357 0 5.03525E-4
19-8665946-G-A p.Arg226Cys missense ADAMTS10 8 80704 9.91277E-5 40352 0 6.37105E-5
19-8665955-C-T p.Glu223Lys missense ADAMTS10 2 80712 2.47795E-5 40356 0 0.00151057
19-8665956-A-G p.Asn222Asn synonymous ADAMTS10 1 80716 1.23891E-5 40358 0 NA
19-8665977-C-T p.Pro215Pro synonymous ADAMTS10 7 80374 8.70928E-5 40187 0 2.23072E-4
19-8665978-G-A p.Pro215Leu missense ADAMTS10 4 80390 4.97574E-5 40195 0 3.59081E-5
19-8665979-G-A p.Pro215Ser missense ADAMTS10 20 80398 2.48762E-4 40199 0 1.2367E-4
19-8665993-C-T p.Arg210Gln missense ADAMTS10 7 80116 8.73733E-5 40058 0 5.03525E-4
19-8665994-G-A p.Arg210Trp missense ADAMTS10 6 80078 7.49269E-5 40039 0 1.27502E-4
19-8666002-C-A p.Trp207Leu missense ADAMTS10 1 79988 1.25019E-5 39994 0 NA
19-8666004-T-C p.Pro206Pro synonymous ADAMTS10 1 79944 1.25088E-5 39972 0 NA
19-8666008-C-T p.Arg205Gln missense ADAMTS10 1 79816 1.25288E-5 39908 0 4.25655E-5
19-8666009-G-A p.Arg205Trp missense ADAMTS10 5 79714 6.27242E-5 39857 0 6.37511E-5
19-8666020-G-A p.Pro201Leu missense ADAMTS10 2 79410 2.51857E-5 39705 0 4.02544E-5
19-8666021-G-C p.Pro201Ala missense ADAMTS10 1 79346 1.2603E-5 39673 0 NA
19-8666021-G-A p.Pro201Ser missense ADAMTS10 5 79344 6.30167E-5 39672 0 2.81808E-5
19-8666030-C-CTCTCACTCCACAGGCTGTGTCCAGG c.593-2_593-1insCCTGGACACAGCCTGTGGAGTGAGA splice_acceptor ADAMTS10 2 79016 2.53113E-5 39508 0 NA
19-8666031-T-TCTCACTCCACA c.593-3_593-2insTGTGGAGTGAG splice_region ADAMTS10 1 78954 1.26656E-5 39477 0 NA
19-8668604-C-T c.592+8G>A splice_region ADAMTS10 3 80748 3.71526E-5 40374 0 5.78914E-5
19-8668607-T-C c.592+5A>G splice_region ADAMTS10 2 80790 2.47555E-5 40395 0 3.18532E-5
19-8668617-A-T p.Val196Glu missense ADAMTS10 2 80858 2.47347E-5 40429 0 7.95545E-5
19-8668633-C-G p.Asp191His missense ADAMTS10 1 80920 1.23579E-5 40460 0 3.97719E-6
19-8668635-A-G p.Leu190Pro missense ADAMTS10 1 80924 1.23573E-5 40462 0 1.19321E-5
19-8668647-C-T p.Arg186His missense ADAMTS10 5 80934 6.17787E-5 40467 0 5.03525E-4
19-8668648-G-A p.Arg186Cys missense ADAMTS10 4 80934 4.9423E-5 40467 0 2.47435E-5
19-8668660-G-A p.Arg182Cys missense ADAMTS10 1 80960 1.23518E-5 40480 0 8.24579E-6
19-8668676-T-G p.Pro176Pro synonymous ADAMTS10 3 80982 3.70453E-5 40491 0 NA
19-8668691-C-T p.Pro171Pro synonymous ADAMTS10 10 80986 1.23478E-4 40493 0 6.25E-4
19-8668691-C-G p.Pro171Pro synonymous ADAMTS10 1 80986 1.23478E-5 40493 0 3.18918E-5
19-8668695-C-G p.Ser170Thr missense ADAMTS10 5 81000 6.17284E-5 40500 0 3.1817E-5
19-8668698-C-T p.Arg169Gln missense ADAMTS10 45 80984 5.55665E-4 40492 0 0.0020141
19-8668699-G-A p.Arg169Trp missense ADAMTS10 3 80986 3.70434E-5 40493 0 NA
19-8668708-T-C p.Lys166Glu missense ADAMTS10 1 80996 1.23463E-5 40498 0 NA
19-8668711-G-A p.Pro165Ser missense ADAMTS10 1 80988 1.23475E-5 40494 0 NA
19-8668712-C-T p.Gly164Gly synonymous ADAMTS10 4 80986 4.93913E-5 40493 0 2.78456E-5
19-8668717-C-T p.Gly163Ser missense ADAMTS10 2 81008 2.46889E-5 40504 0 3.58078E-5
19-8668718-G-A p.His162His synonymous ADAMTS10 2 80998 2.4692E-5 40499 0 5.77358E-5
19-8668721-C-T p.Leu161Leu synonymous ADAMTS10 107 81006 0.00132089 40503 1 8.63427E-4
19-8668747-C-T p.Glu153Lys missense ADAMTS10 4 81016 4.9373E-5 40508 0 0.001875
19-8668756-C-T p.Val150Met missense ADAMTS10 4 81024 4.93681E-5 40512 0 8.42574E-6
19-8668766-G-A p.His146His splice_region+synonymous ADAMTS10 9 81014 1.11092E-4 40507 0 5.03525E-4
19-8668768-G-A p.His146Tyr missense+splice_region ADAMTS10 4 81016 4.9373E-5 40508 0 2.23172E-4
19-8669889-C-T c.435+8G>A splice_region ADAMTS10 2 76698 2.60763E-5 38349 0 NA
19-8669911-T-A p.Thr141Ser missense ADAMTS10 1 77296 1.29373E-5 38648 0 5.04541E-4
19-8669919-G-A p.Ala138Val missense ADAMTS10 1 77602 1.28863E-5 38801 0 NA
19-8669924-A-G p.His136His synonymous ADAMTS10 1 77780 1.28568E-5 38890 0 3.18878E-5
19-8669924-A-T p.His136Gln missense ADAMTS10 1 77780 1.28568E-5 38890 0 NA
19-8669931-G-C p.Thr134Ser missense ADAMTS10 41649 59266 0.702747 29633 14330 0.83125
19-8669931-G-T p.Thr134Asn missense ADAMTS10 3 77818 3.85515E-5 38909 0 NA
19-8669933-G-A p.Ser133Ser synonymous ADAMTS10 1 77900 1.2837E-5 38950 0 NA
19-8669946-T-G p.Gln129Pro missense ADAMTS10 2 78344 2.55284E-5 39172 0 NA
19-8669959-C-T p.Ala125Thr missense ADAMTS10 2 78546 2.54628E-5 39273 0 0.0015121
19-8669960-G-A p.Tyr124Tyr synonymous ADAMTS10 14 78654 1.77995E-4 39327 0 1.68738E-4
19-8669962-A-G p.Tyr124His missense ADAMTS10 2 78818 2.53749E-5 39409 0 NA
19-8669974-G-T p.Pro120Thr missense ADAMTS10 1 78912 1.26723E-5 39456 0 NA
19-8669976-C-T p.Arg119Gln missense ADAMTS10 369 79030 0.00466911 39515 9 0.0114294
19-8669977-G-A p.Arg119Trp missense ADAMTS10 1 79088 1.26441E-5 39544 0 3.1904E-5
19-8669981-C-T p.Ala117Ala synonymous ADAMTS10 48 79108 6.06765E-4 39554 0 0.00168994
19-8669982-G-A p.Ala117Val missense ADAMTS10 44 79088 5.56342E-4 39544 0 8.29505E-4
19-8669986-T-A p.Arg116Trp missense ADAMTS10 1 79202 1.26259E-5 39601 0 8.13412E-6
19-8669997-A-C p.Leu112Arg missense ADAMTS10 2 79274 2.5229E-5 39637 0 8.93591E-6
19-8670002-C-T p.Glu110Glu synonymous ADAMTS10 1 79350 1.26024E-5 39675 0 4.04675E-6
19-8670007-G-A p.Arg109Trp missense ADAMTS10 2 79332 2.52105E-5 39666 0 4.03825E-6
19-8670007-G-T p.Arg109Arg synonymous ADAMTS10 1 79332 1.26053E-5 39666 0 NA
19-8670008-T-C p.Thr108Thr synonymous ADAMTS10 2 79404 2.51876E-5 39702 0 8.76916E-6
19-8670022-C-T p.Val104Met missense ADAMTS10 2 79480 2.51636E-5 39740 0 2.59421E-5
19-8670027-A-T p.Val102Asp missense ADAMTS10 1 79540 1.25723E-5 39770 0 8.61045E-6
19-8670028-C-T p.Val102Ile missense ADAMTS10 2 79528 2.51484E-5 39764 0 8.60719E-5
19-8670029-G-A p.His101His synonymous ADAMTS10 14 79602 1.75875E-4 39801 0 5.04032E-4
19-8670033-C-G p.Gly100Ala missense ADAMTS10 1 79860 1.25219E-5 39930 0 8.5282E-6
19-8670045-C-T p.Arg96His missense ADAMTS10 4 79884 5.00726E-5 39942 1 4.24845E-5
19-8670049-A-G p.Ser95Pro missense ADAMTS10 1 79942 1.25091E-5 39971 0 5.04032E-4
19-8670054-C-T p.Arg93His missense ADAMTS10 11 79950 1.37586E-4 39975 0 1.91192E-4
19-8670055-G-A p.Arg93Cys missense ADAMTS10 3 79950 3.75235E-5 39975 0 1.20249E-5
19-8670068-C-T p.Leu88Leu synonymous ADAMTS10 1 79854 1.25229E-5 39927 0 NA
19-8670074-G-A p.His86His synonymous ADAMTS10 2 79802 2.5062E-5 39901 0 4.01684E-6
19-8670083-G-A p.Pro83Pro synonymous ADAMTS10 2 79756 2.50765E-5 39878 0 NA
19-8670086-C-T p.Ser82Ser synonymous ADAMTS10 1 79656 1.2554E-5 39828 0 3.18674E-5
19-8670086-C-A p.Ser82Ser synonymous ADAMTS10 1 79656 1.2554E-5 39828 0 NA
19-8670087-G-A p.Ser82Leu missense ADAMTS10 9 79648 1.12997E-4 39824 0 0.00162482
19-8670108-C-T p.Arg75His missense ADAMTS10 1 79280 1.26135E-5 39640 0 9.56389E-5
19-8670109-G-A p.Arg75Cys missense ADAMTS10 1 79300 1.26103E-5 39650 0 5.30588E-5
19-8670113-C-A p.Glu73Asp missense ADAMTS10 4 79012 5.06252E-5 39506 0 3.18735E-5
19-8670115-C-T p.Glu73Lys missense ADAMTS10 332 78948 0.0042053 39474 3 0.0050051
19-8670116-G-A p.Ala72Ala synonymous ADAMTS10 2 78936 2.5337E-5 39468 0 4.07458E-6
19-8670124-C-A p.Ala70Ser missense ADAMTS10 1 78812 1.26884E-5 39406 0 1.63871E-5
19-8670128-C-T p.Thr68Thr synonymous ADAMTS10 120 78842 0.00152203 39421 2 0.00296575
19-8670129-G-A p.Thr68Met missense ADAMTS10 3 78742 3.80991E-5 39371 0 3.18817E-5
19-8670133-C-T p.Gly67Ser missense ADAMTS10 1 78716 1.27039E-5 39358 0 5.34337E-5
19-8670134-G-A p.Arg66Arg synonymous ADAMTS10 24 78662 3.05103E-4 39331 0 6.25E-4
19-8670134-G-T p.Arg66Arg synonymous ADAMTS10 2 78662 2.54252E-5 39331 0 4.72063E-5
19-8670135-C-T p.Arg66His missense ADAMTS10 3 78634 3.81514E-5 39317 0 2.83661E-5
19-8670136-G-A p.Arg66Cys missense ADAMTS10 1 78662 1.27126E-5 39331 0 9.48317E-6
19-8670138-C-T p.Arg65His missense ADAMTS10 3 78606 3.8165E-5 39303 0 8.23947E-6
19-8670139-G-A p.Arg65Cys missense ADAMTS10 2 78522 2.54706E-5 39261 0 NA
19-8670147-C-T p.Arg62Gln missense ADAMTS10 3431 78434 0.0437438 39217 86 0.04
19-8670148-G-C p.Arg62Gly missense ADAMTS10 3 78546 3.81942E-5 39273 0 6.59826E-5
19-8670148-G-A p.Arg62Trp missense ADAMTS10 1 78546 1.27314E-5 39273 0 9.89962E-6
19-8670157-G-A p.Pro59Ser missense ADAMTS10 3 78540 3.81971E-5 39270 0 6.09088E-5
19-8670161-C-T p.Ser57Ser synonymous ADAMTS10 10 78360 1.27616E-4 39180 0 6.37836E-4
19-8670162-GAGA-G p.Phe56del disruptive_inframe_deletion ADAMTS10 16 78444 2.03967E-4 39222 0 4.14435E-4
19-8670162-G-A p.Ser57Leu missense ADAMTS10 2 78444 2.54959E-5 39222 0 6.20732E-5
19-8670165-AA-GC p.Phe56Ala missense ADAMTS10 1 78442 1.27483E-5 39221 0 NA
19-8670167-G-A p.Ala55Ala synonymous ADAMTS10 1 78454 1.27463E-5 39227 0 NA
19-8670178-C-T p.Ala52Thr missense ADAMTS10 2 78220 2.55689E-5 39110 0 4.15193E-6
19-8670182-G-A p.Asn50Asn synonymous ADAMTS10 17 78234 2.17297E-4 39117 0 0.00101112
19-8670187-G-T p.His49Asn missense ADAMTS10 1 78188 1.27897E-5 39094 0 8.34119E-6
19-8670193-C-T p.Val47Met missense ADAMTS10 1 77886 1.28393E-5 38943 0 1.59398E-4
19-8670195-C-T p.Arg46His missense ADAMTS10 2 77722 2.57327E-5 38861 0 9.56633E-5
19-8670196-G-A p.Arg46Cys missense ADAMTS10 5 77704 6.43468E-5 38852 0 1.68148E-5
19-8670209-G-A p.Ile41Ile synonymous ADAMTS10 1 77248 1.29453E-5 38624 0 4.27402E-6
19-8670231-G-C p.Ser34Cys missense ADAMTS10 4 75874 5.2719E-5 37937 0 NA
19-8670233-C-T p.Leu33Leu synonymous ADAMTS10 1 75738 1.32034E-5 37869 0 3.27322E-5
19-8670248-G-GTCTCGCCGCCCC c.89-6_89-5insGGGGCGGCGAGA splice_region ADAMTS10 1 74290 1.34608E-5 37145 0 NA
19-8670516-C-T p.Arg27Gln missense ADAMTS10 3 77412 3.87537E-5 38706 0 3.23981E-5
19-8670523-C-T p.Ala25Thr missense ADAMTS10 5 77464 6.45461E-5 38732 0 3.23908E-5
19-8670526-G-A p.His24Tyr missense ADAMTS10 2 77530 2.57965E-5 38765 0 9.57121E-5
19-8670527-C-T p.Thr23Thr synonymous ADAMTS10 12 77518 1.54803E-4 38759 0 3.18979E-4
19-8670528-G-A p.Thr23Met missense ADAMTS10 8 77550 1.03159E-4 38775 1 1.519E-4
19-8670535-C-T p.Glu21Lys missense ADAMTS10 2 77650 2.57566E-5 38825 0 3.57405E-5
19-8670536-G-A p.Phe20Phe synonymous ADAMTS10 6 77644 7.72758E-5 38822 0 4.46867E-5
19-8670553-C-G p.Gly15Arg missense ADAMTS10 1 77626 1.28823E-5 38813 0 NA
19-8670559-C-T p.Ala13Thr missense ADAMTS10 1 77428 1.29152E-5 38714 0 1.86647E-5
19-8670581-G-A p.Cys5Cys synonymous ADAMTS10 1 77044 1.29796E-5 38522 0 NA
19-8670582-C-T p.Cys5Tyr missense ADAMTS10 1 77048 1.29789E-5 38524 0 4.21912E-6
19-8670586-C-T p.Ala4Thr missense ADAMTS10 4 76764 5.21078E-5 38382 0 8.18465E-5
19-8670587-G-A p.Pro3Pro synonymous ADAMTS10 4 76970 5.19683E-5 38485 0 1.14908E-4
19-8670687-C-T c.-92G>A 5_prime_UTR_premature_start_codon_gain ADAMTS10 1 70704 1.41435E-5 35352 0 3.18654E-5
19-8670689-G-A c.-94C>T 5_prime_UTR_premature_start_codon_gain ADAMTS10 1 70248 1.42353E-5 35124 0 NA
19-8670697-G-A c.-99-3C>T splice_region ADAMTS10 21 69170 3.036E-4 34585 0 1.27551E-4
19-8670698-GGA-G c.-99-6_-99-5delTC splice_region ADAMTS10 2 69008 2.89821E-5 34504 0 NA
19-8670699-G-A c.-99-5C>T splice_region ADAMTS10 2 68918 2.902E-5 34459 0 NA
19-8670702-G-T c.-99-8C>A splice_region ADAMTS10 2 68354 2.92594E-5 34177 0 3.18918E-5