Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-8645127-G-A c.*650C>T splice_region ADAMTS10 1 41708 2.39762E-5 20854 0 NA
19-8645782-G-A p.His1103Tyr missense ADAMTS10 1 79740 1.25408E-5 39870 0 NA
19-8645786-A-C p.His1101Gln missense ADAMTS10 77806 77822 0.999794 38911 38896 1.0
19-8645786-A-T p.His1101Gln missense ADAMTS10 3 79898 3.75479E-5 39949 0 NA
19-8645811-C-T p.Arg1093His missense ADAMTS10 2 80166 2.49482E-5 40083 0 7.09912E-5
19-8645812-G-T p.Arg1093Ser missense ADAMTS10 1 80150 1.24766E-5 40075 0 8.86682E-6
19-8645825-G-C p.Ser1088Arg missense ADAMTS10 1 80044 1.24931E-5 40022 0 NA
19-8645827-T-C p.Ser1088Gly missense ADAMTS10 2 79942 2.50181E-5 39971 0 9.67118E-5
19-8645835-T-C p.Gln1085Arg missense ADAMTS10 1 79938 1.25097E-5 39969 0 3.22685E-5
19-8645842-T-G p.Lys1083Gln missense ADAMTS10 1 79902 1.25153E-5 39951 0 NA
19-8645848-C-T p.Val1081Met missense ADAMTS10 1 79850 1.25235E-5 39925 0 NA
19-8645888-T-TTCA c.3203-3_3203-2insTGA splice_region ADAMTS10 2 79278 2.52277E-5 39639 0 NA
19-8645889-G-GGGCCGTCCC c.3203-4_3203-3insGGGACGGCC splice_region ADAMTS10 1 79314 1.26081E-5 39657 0 NA
19-8645890-CGG-C c.3203-6_3203-5delCC splice_region ADAMTS10 2 79262 2.52328E-5 39631 0 1.22949E-5
19-8645891-G-A c.3203-5C>T splice_region ADAMTS10 4 79266 5.0463E-5 39633 0 1.19301E-4
19-8649788-C-T p.Gly1065Ser missense ADAMTS10 149 51668 0.0028838 25834 0 0.00666709
19-8649788-C-G p.Gly1065Arg missense ADAMTS10 1 51682 1.93491E-5 25841 0 NA
19-8649793-C-A p.Gly1063Val missense ADAMTS10 1 50826 1.9675E-5 25413 0 NA
19-8649793-C-T p.Gly1063Glu missense ADAMTS10 1 50826 1.9675E-5 25413 0 2.23115E-4
19-8649832-G-A p.Thr1050Met missense ADAMTS10 1 46848 2.13456E-5 23424 0 7.08215E-6
19-8649839-G-C p.Pro1048Ala missense ADAMTS10 1 46200 2.1645E-5 23100 0 NA
19-8649840-C-A p.Pro1047Pro synonymous ADAMTS10 2 46060 4.34216E-5 23030 0 3.19163E-5
19-8649845-G-T p.Arg1046Arg synonymous ADAMTS10 1 45722 2.18713E-5 22861 0 NA
19-8649858-G-A p.Cys1041Cys synonymous ADAMTS10 3 45130 6.64746E-5 22565 0 7.24501E-6
19-8649879-C-T p.Thr1034Thr synonymous ADAMTS10 610 44230 0.0137915 22115 25 0.0304898
19-8649901-G-C p.Ser1027Trp missense ADAMTS10 1 43348 2.30691E-5 21674 0 NA
19-8649938-ACTGCGAGGGGGCACCACTCAGTTGCTGCCCCGCAGCCCCTGCCCTGGCCCCCACCCCTCTGGGGCGCGCCCTCCTAC-A c.3042+1_3043-1delGTAGGAGGGCGCGCCCCAGAGGGGTGGGGGCCAGGGCAGGGGCTGCGGGGCAGCAACTGAGTGGTGCCCCCTCGCAG splice_acceptor ADAMTS10 6 43486 1.37975E-4 21743 0 NA
19-8649943-G-GAGGGGGC c.3043-6_3043-5insGCCCCCT splice_region ADAMTS10 8082 43000 0.187953 21500 808 0.192285
19-8649943-G-A c.3043-5C>T splice_region ADAMTS10 6 43274 1.38651E-4 21637 0 1.06769E-4
19-8649946-G-A c.3043-8C>T splice_region ADAMTS10 5 43658 1.14527E-4 21829 0 5.80682E-5
19-8650045-C-G p.Ala1005Pro missense ADAMTS10 1 47576 2.1019E-5 23788 0 NA
19-8650052-G-A p.Cys1002Cys synonymous ADAMTS10 2 48142 4.15438E-5 24071 0 NA
19-8650076-G-C p.Thr994Thr synonymous ADAMTS10 27 52636 5.12957E-4 26318 0 0.00403226
19-8650082-C-A p.Pro992Pro synonymous ADAMTS10 1 53336 1.87491E-5 26668 0 6.76559E-5
19-8650102-A-G p.Ser986Pro missense ADAMTS10 1 56038 1.7845E-5 28019 0 NA
19-8650120-G-C p.Leu980Val missense ADAMTS10 1 61286 1.63169E-5 30643 0 4.56215E-5
19-8650140-C-G p.Ser973Thr missense ADAMTS10 2 68066 2.93832E-5 34033 0 0.00107066
19-8650150-G-A p.Leu970Phe missense ADAMTS10 1 70520 1.41804E-5 35260 0 NA
19-8650168-G-C p.Leu964Val missense ADAMTS10 1 72922 1.37133E-5 36461 0 2.20378E-5
19-8650187-G-A p.Thr957Thr synonymous ADAMTS10 1 74610 1.3403E-5 37305 0 NA
19-8650194-T-TCA c.2866-3_2866-2insTG splice_region ADAMTS10 1 75388 1.32647E-5 37694 0 NA
19-8650351-C-A p.Asp952Tyr missense ADAMTS10 1 60216 1.66069E-5 30108 0 NA
19-8650355-G-T p.Ala950Ala synonymous ADAMTS10 1 59702 1.67499E-5 29851 0 NA
19-8650360-C-T p.Ala949Thr missense ADAMTS10 26 59360 4.38005E-4 29680 0 0.00211864
19-8650367-C-T p.Pro946Pro synonymous ADAMTS10 3 59264 5.0621E-5 29632 0 7.05328E-6
19-8650395-T-C p.Glu937Gly missense ADAMTS10 2 55546 3.60062E-5 27773 0 7.05318E-5
19-8650397-C-T p.Leu936Leu synonymous ADAMTS10 1 55368 1.8061E-5 27684 0 6.49984E-6
19-8650399-G-A p.Leu936Leu synonymous ADAMTS10 1 55110 1.81455E-5 27555 0 6.50161E-6
19-8650417-G-A p.Gln930* stop_gained ADAMTS10 1 51012 1.96032E-5 25506 0 NA
19-8650424-T-TGCGCTGTCGTCCAGCGCCTTCTCCTCCGCGGCAGAGACG p.Ala927_Cys928insValSerAlaAlaGluGluLysAlaLeuAspAspSerAla disruptive_inframe_insertion ADAMTS10 1 50114 1.99545E-5 25057 0 6.38447E-5
19-8650427-G-T p.Ser926Arg missense ADAMTS10 3 49216 6.09558E-5 24608 0 4.01606E-5
19-8650432-C-T p.Asp925Asn missense ADAMTS10 4 48688 8.21558E-5 24344 0 7.09119E-5
19-8650453-C-T p.Ala918Thr missense ADAMTS10 1 45910 2.17817E-5 22955 0 NA
19-8650463-G-T p.Arg914Arg synonymous ADAMTS10 1 44946 2.22489E-5 22473 0 4.41108E-6
19-8650463-G-A p.Arg914Arg synonymous ADAMTS10 1 44946 2.22489E-5 22473 0 NA
19-8650477-C-A p.Val910Leu missense ADAMTS10 1 43650 2.29095E-5 21825 0 3.19101E-5
19-8650478-G-C p.Val909Val synonymous ADAMTS10 1 43402 2.30404E-5 21701 0 4.3281E-6
19-8650481-C-T p.Ser908Ser synonymous ADAMTS10 1 43116 2.31932E-5 21558 0 4.33028E-6
19-8650543-A-AGTCTGGAGGGCAAGGCTCCGTGTTGCAGGCGCGCTGCCTTTTGGGCAGCTT p.Asp887_Trp888insLysLeuProLysArgGlnArgAlaCysAsnThrGluProCysProProAsp conservative_inframe_insertion ADAMTS10 1 37034 2.70022E-5 18517 0 NA
19-8650544-G-T p.Asp887Glu missense+splice_region ADAMTS10 3 37016 8.1046E-5 18508 0 NA
19-8650552-A-C c.2661-8T>G splice_region ADAMTS10 5 36842 1.35715E-4 18421 0 6.25E-4
19-8651023-C-T p.Thr881Thr synonymous ADAMTS10 2 82324 2.42943E-5 41162 0 0.0020202
19-8651034-C-T p.Ala878Thr missense ADAMTS10 2 82186 2.4335E-5 41093 0 NA
19-8651035-G-T p.Arg877Arg synonymous ADAMTS10 1 82156 1.2172E-5 41078 0 NA
19-8651048-G-A p.Pro873Leu missense ADAMTS10 1 81564 1.22603E-5 40782 0 NA
19-8651048-G-C p.Pro873Arg missense ADAMTS10 1 81564 1.22603E-5 40782 0 NA
19-8651049-G-A p.Pro873Ser missense ADAMTS10 1 81572 1.22591E-5 40786 0 NA
19-8651071-G-A p.Tyr865Tyr synonymous ADAMTS10 2 81764 2.44606E-5 40882 0 4.01668E-6
19-8651076-G-C p.His864Asp missense ADAMTS10 1 81768 1.22297E-5 40884 0 NA
19-8651082-C-A p.Ala862Ser missense ADAMTS10 1180 81546 0.0144704 40773 47 0.0299445
19-8651089-G-A p.Ser859Ser synonymous ADAMTS10 1 81650 1.22474E-5 40825 0 8.05626E-6
19-8651103-G-T p.Gln855Lys missense ADAMTS10 1 81710 1.22384E-5 40855 0 8.06478E-6
19-8651107-G-A p.Arg853Arg synonymous ADAMTS10 1 81548 1.22627E-5 40774 0 2.59983E-5
19-8651120-G-A p.Ala849Val missense ADAMTS10 1 81372 1.22892E-5 40686 0 8.7014E-6
19-8651133-TACCTGGAGGGGAGGGTGAGAGGCCTGCTCAGCCCCTCCCGGCCCAGAGAACCTCAGCCCAGGTATCTTGTGCCTTCCCCCACCCCCGGCCTC-T p.Gly844fs frameshift ADAMTS10 7 81330 8.60691E-5 40665 0 NA
19-8651140-A-G c.2531-5T>C splice_region ADAMTS10 1 81204 1.23147E-5 40602 0 NA
19-8651245-G-C p.Ser838Trp missense ADAMTS10 1 80080 1.24875E-5 40040 0 NA
19-8651252-T-A p.Lys836* stop_gained ADAMTS10 1 80268 1.24583E-5 40134 0 NA
19-8651281-G-T p.Pro826His missense ADAMTS10 12 80940 1.48258E-4 40470 0 3.18451E-4
19-8651285-G-A p.Pro825Ser missense ADAMTS10 1 80876 1.23646E-5 40438 0 3.18532E-5
19-8651286-C-T p.Leu824Leu synonymous ADAMTS10 1 80888 1.23628E-5 40444 0 NA
19-8651289-C-G p.Ser823Ser synonymous ADAMTS10 4 80934 4.9423E-5 40467 0 4.01542E-6
19-8651289-C-T p.Ser823Ser synonymous ADAMTS10 1 80934 1.23557E-5 40467 0 1.70888E-5
19-8651297-G-A p.Arg821Cys missense ADAMTS10 1 81296 1.23007E-5 40648 0 8.02517E-6
19-8651311-T-C p.Asn816Ser missense ADAMTS10 4 81890 4.8846E-5 40945 0 NA
19-8651316-GC-TT p.Arg814Gln missense ADAMTS10 4 81982 4.87912E-5 40991 0 NA
19-8651318-G-A p.Arg814Cys missense ADAMTS10 1 82032 1.21904E-5 41016 0 NA
19-8651325-G-A p.Leu811Leu synonymous ADAMTS10 1 82284 1.2153E-5 41142 0 8.00307E-6
19-8651330-C-T p.Ala810Thr missense ADAMTS10 2 82254 2.43149E-5 41127 0 NA
19-8651335-A-C p.Leu808Arg missense ADAMTS10 1055 82294 0.0128199 41147 39 0.0266263
19-8651336-G-C p.Leu808Val missense ADAMTS10 2 82390 2.42748E-5 41195 0 8.48162E-6
19-8651337-C-G p.Glu807Asp missense ADAMTS10 1 82390 1.21374E-5 41195 0 3.18918E-5
19-8651338-T-C p.Glu807Gly missense ADAMTS10 1 82400 1.21359E-5 41200 0 1.69604E-5
19-8651339-C-T p.Glu807Lys missense ADAMTS10 2 82408 2.42695E-5 41204 0 9.56999E-5
19-8651340-G-T p.Thr806Thr synonymous ADAMTS10 1 82436 1.21306E-5 41218 0 1.69523E-5
19-8651343-C-T p.Arg805Arg synonymous ADAMTS10 15 82480 1.81862E-4 41240 0 2.8721E-4
19-8651349-C-G p.Leu803Leu synonymous ADAMTS10 39 82534 4.72533E-4 41267 0 0.00172172
19-8651352-CACCTGGAGAAAGGGGGCGGCAGCCAGTGGAAGGATCGCATGGAGTCTCTAATTCCAAAGGCTGCACCTTGCCCCCAGTCTCCCTGTT-C p.Val802fs frameshift ADAMTS10 7 82528 8.48197E-5 41264 0 NA
19-8651434-C-T c.2403+8G>A splice_region ADAMTS10 1 83064 1.20389E-5 41532 0 6.25E-4
19-8651438-T-C c.2403+4A>G splice_region ADAMTS10 744 83058 0.0089576 41529 4 0.00609095
19-8651438-T-G c.2403+4A>C splice_region ADAMTS10 1 83068 1.20383E-5 41534 0 NA
19-8651447-C-T p.Val800Ile missense ADAMTS10 1 83056 1.20401E-5 41528 0 3.18715E-5
19-8651447-C-A p.Val800Phe missense ADAMTS10 1 83056 1.20401E-5 41528 0 1.19476E-5
19-8651457-T-C p.Ala796Ala synonymous ADAMTS10 29 83056 3.49162E-4 41528 0 2.4784E-4
19-8651461-T-C p.Asn795Ser missense ADAMTS10 5 83044 6.0209E-5 41522 0 1.19393E-5
19-8651466-C-T p.Pro793Pro synonymous ADAMTS10 1 83006 1.20473E-5 41503 0 3.97991E-6
19-8651475-G-A p.Ala790Ala synonymous ADAMTS10 15 82924 1.80889E-4 41462 0 6.25E-4
19-8651478-T-G p.Glu789Asp missense ADAMTS10 2 82888 2.41289E-5 41444 0 NA
19-8651487-C-T p.Gln786Gln synonymous ADAMTS10 6 82772 7.24883E-5 41386 0 0.00125
19-8651492-C-A p.Val785Phe missense ADAMTS10 1 82684 1.20942E-5 41342 0 3.97798E-6
19-8651516-G-A p.Gln777* stop_gained ADAMTS10 1 82328 1.21465E-5 41164 0 NA
19-8651523-G-A p.Thr774Thr synonymous ADAMTS10 2 82286 2.43055E-5 41143 0 8.26228E-6
19-8651524-G-A p.Thr774Ile missense ADAMTS10 1 82282 1.21533E-5 41141 0 NA
19-8651528-C-T p.Gly773Arg missense ADAMTS10 1 82276 1.21542E-5 41138 0 NA
19-8651557-G-C p.Thr763Ser missense ADAMTS10 35 82444 4.24531E-4 41222 0 0.00125
19-8651557-G-T p.Thr763Asn missense ADAMTS10 1 82444 1.21294E-5 41222 0 NA
19-8651562-A-G p.Pro761Pro synonymous ADAMTS10 17660 82054 0.215224 41027 1904 0.231725
19-8651562-A-T p.Pro761Pro synonymous ADAMTS10 3 82592 3.63231E-5 41296 0 3.98877E-6
19-8651564-GCAGCCCCTCCAGCAGCAGGGAC-G p.Glu753fs frameshift ADAMTS10 1 82622 1.21033E-5 41311 0 NA
19-8651580-C-T p.Leu755Leu synonymous ADAMTS10 3 82916 3.61812E-5 41458 0 2.47942E-5
19-8651584-G-A p.Ser754Phe missense ADAMTS10 76 82966 9.16038E-4 41483 0 0.00197792
19-8651598-C-T p.Lys749Lys synonymous ADAMTS10 7 83090 8.4246E-5 41545 0 6.25E-4
19-8651601-C-T p.Leu748Leu synonymous ADAMTS10 1 83096 1.20343E-5 41548 0 NA
19-8651605-GCTGGGGGACGATGCAGGGTTCAGAATTCTAGTCATGCTGAAACCGCCCTCCCCACTGACCCCTAATCCTCATCCCCTCCCCACCATCTGCTCAC-G c.2239+1_2240-1delGTGAGCAGATGGTGGGGAGGGGATGAGGATTAGGGGTCAGTGGGGAGGGCGGTTTCAGCATGACTAGAATTCTGAACCCTGCATCGTCCCCCAG splice_acceptor ADAMTS10 11 83104 1.32364E-4 41552 4 NA
19-8651718-G-A p.Leu741Phe missense ADAMTS10 1 83312 1.20031E-5 41656 0 NA
19-8651746-G-C p.Ser731Ser synonymous ADAMTS10 1 83312 1.20031E-5 41656 0 3.18634E-5
19-8651746-G-A p.Ser731Ser synonymous ADAMTS10 2 83312 2.40061E-5 41656 0 4.94226E-5
19-8651750-C-G p.Gly730Ala missense ADAMTS10 2 83310 2.40067E-5 41655 0 8.23696E-6
19-8651767-G-A p.Val724Val synonymous ADAMTS10 1 83270 1.20091E-5 41635 0 2.47125E-5
19-8651776-G-A p.Tyr721Tyr synonymous ADAMTS10 15 83232 1.80219E-4 41616 0 6.3743E-4
19-8651787-A-G c.2159-7T>C splice_region ADAMTS10 1 83196 1.20198E-5 41598 0 NA
19-8654126-C-A p.Gly720Trp missense+splice_region ADAMTS10 2 81146 2.46469E-5 40573 0 6.37796E-5
19-8654127-G-C p.Ala719Ala splice_region+synonymous ADAMTS10 427 81120 0.00526381 40560 2 0.00462549
19-8654127-G-T p.Ala719Ala splice_region+synonymous ADAMTS10 1 81132 1.23256E-5 40566 0 4.43795E-5
19-8654130-C-T p.Gly718Gly synonymous ADAMTS10 56 81174 6.89876E-4 40587 0 0.00232795
19-8654143-G-A p.Pro714Leu missense ADAMTS10 2 81344 2.45869E-5 40672 0 3.19122E-5
19-8654153-C-T p.Val711Ile missense ADAMTS10 2 81262 2.46117E-5 40631 0 1.61379E-5
19-8654154-G-A p.Gly710Gly synonymous ADAMTS10 7 81224 8.61814E-5 40612 0 4.2342E-5
19-8654159-C-T p.Glu709Lys missense ADAMTS10 4 81360 4.91642E-5 40680 0 0.001875
19-8654160-G-A p.Ile708Ile synonymous ADAMTS10 3 81412 3.68496E-5 40706 0 4.2347E-5
19-8654164-G-A p.Thr707Ile missense ADAMTS10 2 81440 2.4558E-5 40720 0 NA
19-8654168-C-T p.Glu706Lys missense ADAMTS10 4 81352 4.9169E-5 40676 0 4.84035E-5
19-8654179-C-T p.Gly702Asp missense ADAMTS10 1 81446 1.22781E-5 40723 0 NA
19-8654180-C-T p.Gly702Ser missense ADAMTS10 2 81430 2.4561E-5 40715 0 6.05337E-5
19-8654181-G-A p.Asp701Asp synonymous ADAMTS10 5 81438 6.13964E-5 40719 0 5.08664E-5
19-8654184-A-T p.Gly700Gly synonymous ADAMTS10 4 81446 4.91123E-5 40723 0 3.63261E-5
19-8654186-C-T p.Gly700Ser missense ADAMTS10 6 81674 7.34628E-5 40837 0 6.38203E-5
19-8654212-C-G p.Arg691Pro missense ADAMTS10 1 81586 1.2257E-5 40793 0 NA
19-8654214-C-G p.Leu690Leu synonymous ADAMTS10 17 81522 2.08533E-4 40761 0 9.27719E-5
19-8654219-C-T p.Asp689Asn missense ADAMTS10 4 81400 4.914E-5 40700 0 2.01854E-5
19-8654238-G-A p.Cys682Cys synonymous ADAMTS10 1 80972 1.23499E-5 40486 0 1.62492E-5
19-8654246-C-T p.Val680Met missense ADAMTS10 2 80892 2.47243E-5 40446 0 5.12059E-5
19-8654249-GCTGCGTGGAGAAGGCGTGAGTGAGGCGACCCCCTAACCCACCCCCGCTCCCCATCCCCTCTCCACCTCCCTGGGAGTCCCCTCCAC-G c.2034+1_2035-1delGTGGAGGGGACTCCCAGGGAGGTGGAGAGGGGATGGGGAGCGGGGGTGGGTTAGGGGGTCGCCTCACTCACGCCTTCTCCACGCAG splice_acceptor ADAMTS10 11 80716 1.3628E-4 40358 5 NA
19-8654253-C-T c.2035-4G>A splice_region ADAMTS10 1 80566 1.24122E-5 40283 0 1.70847E-5
19-8654330-C-T c.2034+6G>A splice_region ADAMTS10 1 81838 1.22193E-5 40919 0 4.19041E-5
19-8654339-G-C p.Cys677Trp missense ADAMTS10 1 82198 1.21657E-5 41099 0 NA
19-8654353-C-T p.Val673Ile missense ADAMTS10 1 82558 1.21127E-5 41279 0 2.39467E-5
19-8654354-G-A p.Cys672Cys synonymous ADAMTS10 189 82556 0.00228936 41278 0 0.00368968
19-8654365-C-G p.Val669Leu missense ADAMTS10 16 82622 1.93653E-4 41311 0 2.58015E-4
19-8654365-C-A p.Val669Leu missense ADAMTS10 1 82622 1.21033E-5 41311 0 3.1955E-5
19-8654366-C-T p.Thr668Thr synonymous ADAMTS10 1 82618 1.21039E-5 41309 0 NA
19-8654367-G-A p.Thr668Met missense ADAMTS10 1 82600 1.21065E-5 41300 0 3.20431E-5
19-8654368-T-C p.Thr668Ala missense ADAMTS10 1 82610 1.21051E-5 41305 0 NA
19-8654376-C-T p.Arg665His missense ADAMTS10 8 82582 9.68734E-5 41291 0 1.08218E-4
19-8654381-G-A p.Pro663Pro synonymous ADAMTS10 3 82556 3.6339E-5 41278 0 NA
19-8654389-C-T p.Gly661Arg missense ADAMTS10 1 82512 1.21194E-5 41256 0 3.99243E-6
19-8654399-G-A p.Ala657Ala synonymous ADAMTS10 28 82424 3.39707E-4 41212 0 0.00138527
19-8654405-C-T p.Ala655Ala synonymous ADAMTS10 1 82318 1.2148E-5 41159 0 5.59942E-5
19-8654414-C-T p.Thr652Thr synonymous ADAMTS10 7 82190 8.51685E-5 41095 0 1.27992E-4
19-8654435-C-T p.Ala645Ala synonymous ADAMTS10 64 82016 7.80336E-4 41008 0 6.37592E-4
19-8654444-C-T p.Thr642Thr synonymous ADAMTS10 5 81922 6.10337E-5 40961 0 4.19315E-5
19-8654445-G-A p.Thr642Met missense ADAMTS10 17 81898 2.07575E-4 40949 0 2.26464E-4
19-8654450-C-T p.Ser640Ser synonymous ADAMTS10 24 81802 2.93391E-4 40901 0 2.552E-4
19-8654450-C-G p.Ser640Ser synonymous ADAMTS10 1 81802 1.22246E-5 40901 0 NA
19-8654453-G-A p.Cys639Cys synonymous ADAMTS10 1 81800 1.22249E-5 40900 0 1.60355E-5
19-8654458-C-A p.Ala125Ser missense+splice_region ADAMTS10 1 81636 1.22495E-5 40818 0 4.01584E-6
19-8654464-C-T p.Val636Met missense ADAMTS10 1 81514 1.22678E-5 40757 0 8.45952E-6
19-8654471-T-TG c.1901-3dupC splice_region ADAMTS10 1 81208 1.23141E-5 40604 0 8.49748E-6
19-8654477-G-A c.1901-8C>T splice_region ADAMTS10 6 81136 7.39499E-5 40568 0 6.38121E-5
19-8654767-A-G c.1900+6T>C splice_region ADAMTS10 1 82832 1.20726E-5 41416 0 8.42915E-6
19-8654778-C-T p.Arg632Gln missense ADAMTS10 1 82960 1.2054E-5 41480 0 4.16438E-5
19-8654779-G-A p.Arg632Trp missense ADAMTS10 1 82954 1.20549E-5 41477 0 8.75608E-5
19-8654779-G-C p.Arg632Gly missense ADAMTS10 1 82954 1.20549E-5 41477 0 NA
19-8654783-C-T p.Arg121His missense ADAMTS10 1 83024 1.20447E-5 41512 0 6.37024E-5
19-8654786-T-C p.Lys120Arg missense ADAMTS10 31 83070 3.73179E-4 41535 0 7.00994E-4
19-8654793-T-G p.Lys627Thr missense ADAMTS10 5 83090 6.01757E-5 41545 0 1.65431E-5
19-8654798-G-A p.Ser116Phe missense ADAMTS10 2 83110 2.40645E-5 41555 0 7.95634E-6
19-8654840-C-A p.Cys102Phe missense ADAMTS10 6 83094 7.22074E-5 41547 0 NA
19-8654868-G-T p.Pro602His missense ADAMTS10 1 82752 1.20843E-5 41376 0 NA
19-8654869-G-C p.Pro602Ala missense ADAMTS10 2 82740 2.41721E-5 41370 0 7.9841E-6
19-8654870-A-G p.Val92Ala missense ADAMTS10 210 82664 0.0025404 41332 0 0.00736748
19-8654881-G-A c.1798-6C>T splice_region ADAMTS10 75 82346 9.10791E-4 41173 0 0.00625
19-8656738-G-A p.Ser72Leu missense ADAMTS10 52 82384 6.31191E-4 41192 0 0.00100705
19-8656740-T-C p.Ile581Val missense ADAMTS10 1 82364 1.21412E-5 41182 0 7.9769E-6
19-8656742-G-A p.Thr580Ile missense ADAMTS10 1 82350 1.21433E-5 41175 0 NA
19-8656743-T-C p.Thr580Ala missense ADAMTS10 1 82334 1.21457E-5 41167 0 3.9888E-6
19-8656746-GCCTGGAAAGGGTGGTGGGATAGGAGAGGGATGAGGCAGTGGGCGATGGGGGCAGGGGTCGCGCTGCCCTCCCGGGTGGGGGTCCTGAGGGCTGA-G p.Arg578fs frameshift ADAMTS10 8 82272 9.72384E-5 41136 2 NA
19-8656752-A-G c.1734-5T>C splice_region ADAMTS10 2 82122 2.4354E-5 41061 0 4.13976E-5
19-8656849-T-C p.Ser576Gly missense ADAMTS10 1 79122 1.26387E-5 39561 0 NA
19-8656855-A-T p.Cys574Ser missense ADAMTS10 1 79308 1.26091E-5 39654 0 NA
19-8656856-G-A p.Thr64Ile missense ADAMTS10 125 79324 0.00157582 39662 0 0.00223143
19-8656865-A-G p.Leu61Pro missense ADAMTS10 2 79600 2.51256E-5 39800 0 3.18898E-5
19-8656882-C-T p.Gly565Ser missense ADAMTS10 2 80296 2.49078E-5 40148 0 3.18776E-5
19-8656883-G-A p.Ala55Val missense ADAMTS10 1 80336 1.24477E-5 40168 0 NA
19-8656887-C-A p.Cys563Phe missense ADAMTS10 1 80626 1.24029E-5 40313 0 4.05249E-6
19-8656901-G-A p.Thr49Ile missense ADAMTS10 1 81054 1.23375E-5 40527 0 NA
19-8656920-G-A p.Pro552Leu missense ADAMTS10 3 81366 3.68704E-5 40683 0 2.8247E-5
19-8656952-C-G p.Arg32Pro missense ADAMTS10 1 81860 1.2216E-5 40930 0 7.7474E-5
19-8656958-A-C p.Phe539Leu missense ADAMTS10 1 81972 1.21993E-5 40986 0 NA
19-8656972-C-T p.Val535Ile missense ADAMTS10 2 81876 2.44272E-5 40938 0 3.44964E-5
19-8656988-C-CCCCT p.Ser20fs frameshift ADAMTS10 1 81564 1.22603E-5 40782 0 NA
19-8656990-G-GTCGAT p.Gly21fs frameshift ADAMTS10 1 81502 1.22696E-5 40751 0 NA
19-8656992-G-A p.Pro19Ser missense ADAMTS10 1 81440 1.2279E-5 40720 0 4.05518E-6
19-8656993-T-TG p.Pro19fs frameshift ADAMTS10 1 81330 1.22956E-5 40665 0 1.27771E-4
19-8656994-G-C p.Pro18Arg missense ADAMTS10 983 81328 0.0120869 40664 38 0.0255037
19-8656997-G-A p.Pro17Leu missense ADAMTS10 1 81320 1.22971E-5 40660 0 NA
19-8656998-G-A p.Pro17Ser missense ADAMTS10 32 81294 3.93633E-4 40647 0 0.00146515
19-8656999-G-C p.Leu16Leu synonymous ADAMTS10 2 81272 2.46087E-5 40636 1 NA
19-8657000-A-C p.Leu16Arg missense ADAMTS10 3 81202 3.69449E-5 40601 0 2.17505E-4
19-8657000-A-T p.Leu16His missense ADAMTS10 1 81202 1.2315E-5 40601 0 NA
19-8657003-C-T p.Cys15Tyr missense ADAMTS10 2 81174 2.46384E-5 40587 0 NA
19-8657012-G-A p.Thr12Ile missense ADAMTS10 1 80978 1.2349E-5 40489 0 3.18613E-5
19-8657016-G-T p.Leu11Ile missense ADAMTS10 1 80866 1.23661E-5 40433 0 1.75756E-5
19-8657024-C-T p.Arg8Gln missense ADAMTS10 1 80640 1.24008E-5 40320 0 NA
19-8657025-G-A p.Arg8Trp missense ADAMTS10 1935 80554 0.0240212 40277 51 0.0352086
19-8657029-G-A p.Val6Val synonymous ADAMTS10 1 80534 1.24171E-5 40267 0 NA
19-8657038-C-G p.Pro3Pro synonymous ADAMTS10 3 80284 3.73673E-5 40142 0 1.81488E-5
19-8657038-C-T p.Pro3Pro synonymous ADAMTS10 2 80284 2.49116E-5 40142 0 3.62976E-5
19-8657038-C-A p.Pro3Pro synonymous ADAMTS10 3 80284 3.73673E-5 40142 0 2.72232E-5
19-8657042-C-T p.Gly2Glu missense ADAMTS10 1 80244 1.2462E-5 40122 0 NA
19-8657045-A-G p.Met1? start_lost ADAMTS10 1 80168 1.24738E-5 40084 0 2.91686E-5
19-8657050-C-T c.-4G>A 5_prime_UTR_premature_start_codon_gain ADAMTS10 1 79988 1.25019E-5 39994 0 NA
19-8657060-C-T c.-14G>A 5_prime_UTR_premature_start_codon_gain ADAMTS10 1 79758 1.25379E-5 39879 0 3.50976E-5
19-8657093-G-A c.-47C>T 5_prime_UTR_premature_start_codon_gain ADAMTS10 7 79390 8.81723E-5 39695 0 2.28781E-4
19-8657640-C-T c.1587+7G>A splice_region ADAMTS10 1 66634 1.50074E-5 33317 0 6.37471E-5
19-8657653-G-A p.Asp527Asp synonymous ADAMTS10 1 70404 1.42037E-5 35202 0 6.37227E-5
19-8657655-C-T p.Asp527Asn missense ADAMTS10 1 70840 1.41163E-5 35420 0 9.46145E-6
19-8657658-T-C p.Ile526Val missense ADAMTS10 1 71744 1.39384E-5 35872 0 NA
19-8657664-G-A p.His524Tyr missense ADAMTS10 1 72476 1.37977E-5 36238 0 NA
19-8657665-C-T p.Thr523Thr synonymous ADAMTS10 5 72472 6.89922E-5 36236 0 4.08163E-5
19-8657689-G-A p.Ala515Ala synonymous ADAMTS10 1 74980 1.33369E-5 37490 0 NA
19-8657692-C-T p.Pro514Pro synonymous ADAMTS10 6 75250 7.97342E-5 37625 0 5.03525E-4
19-8657703-T-C p.Asn511Asp missense ADAMTS10 1 76216 1.31206E-5 38108 0 NA
19-8657714-C-T p.Arg507Gln missense ADAMTS10 2 76284 2.62178E-5 38142 0 2.61844E-5
19-8657740-C-T p.Glu498Glu synonymous ADAMTS10 2 74950 2.66845E-5 37475 0 1.21993E-5
19-8657758-C-A c.1480-4G>T splice_region ADAMTS10 8 71266 1.12255E-4 35633 0 1.03944E-4
19-8657762-C-T c.1480-8G>A splice_region ADAMTS10 1 70180 1.42491E-5 35090 0 1.03515E-5
19-8660499-C-T n.574G>A splice_region ADAMTS10 103 73254 0.00140607 36627 0 4.78897E-4
19-8660499-C-G n.574G>C splice_region ADAMTS10 1 73264 1.36493E-5 36632 0 NA
19-8660662-C-T p.Arg488His missense ADAMTS10 2 83218 2.40333E-5 41609 0 2.38643E-5
19-8660677-T-C p.His483Arg missense ADAMTS10 2 83298 2.40102E-5 41649 0 NA
19-8660687-G-A p.Arg480Cys missense ADAMTS10 1 83314 1.20028E-5 41657 0 NA
19-8660694-C-T p.Glu477Glu synonymous ADAMTS10 1 83346 1.19982E-5 41673 0 8.23696E-6
19-8660694-C-G p.Glu477Asp missense ADAMTS10 1 83346 1.19982E-5 41673 0 3.97643E-6
19-8660703-A-G p.Asp474Asp synonymous ADAMTS10 1 83328 1.20008E-5 41664 0 NA
19-8660705-C-T p.Asp474Asn missense ADAMTS10 1 83332 1.20002E-5 41666 0 7.95286E-6
19-8660706-G-A p.Tyr473Tyr synonymous ADAMTS10 4 83314 4.80111E-5 41657 0 1.91168E-4
19-8660715-G-T p.Gly470Gly synonymous ADAMTS10 7 83294 8.40397E-5 41647 0 4.94226E-5
19-8660723-C-T p.Ala468Thr missense ADAMTS10 1 83250 1.2012E-5 41625 0 NA
19-8660730-C-T p.Pro465Pro synonymous ADAMTS10 5 83236 6.00702E-5 41618 0 1.59205E-4
19-8660737-A-G p.Val463Ala missense ADAMTS10 5 83144 6.01366E-5 41572 0 3.18634E-5
19-8660750-T-TG p.Arg459fs frameshift ADAMTS10 1 83136 1.20285E-5 41568 0 NA
19-8660751-G-A p.Pro458Pro synonymous ADAMTS10 1 83166 1.20241E-5 41583 0 8.23818E-6
19-8660751-G-T p.Pro458Pro synonymous ADAMTS10 1 83166 1.20241E-5 41583 0 1.07384E-4
19-8660751-G-C p.Pro458Pro synonymous ADAMTS10 1 83164 1.20244E-5 41582 0 6.25E-4
19-8660754-G-C p.Pro457Pro synonymous ADAMTS10 1 83160 1.2025E-5 41580 0 7.95342E-6
19-8660756-GCC-G p.Arg456fs frameshift ADAMTS10 1 83132 1.20291E-5 41566 0 NA
19-8660758-C-CGGG p.Asn455_Arg456insPro conservative_inframe_insertion ADAMTS10 1 83096 1.20343E-5 41548 0 NA
19-8660758-C-T p.Arg456Gln missense ADAMTS10 10 83096 1.20343E-4 41548 0 6.91981E-4
19-8660775-C-A p.Gly450Gly synonymous ADAMTS10 479 83044 0.00576803 41522 4 0.0111586
19-8660778-C-T p.Leu449Leu synonymous ADAMTS10 1 83080 1.20366E-5 41540 0 NA
19-8660785-G-A p.Ser447Leu missense+splice_region ADAMTS10 26 83034 3.13125E-4 41517 0 0.00125
19-8660795-G-C c.1338-8C>G splice_region ADAMTS10 1 83056 1.20401E-5 41528 0 3.97826E-6
19-8660958-C-T p.Asp446Asn missense+splice_region ADAMTS10 1 82618 1.21039E-5 41309 0 8.24158E-6
19-8660962-A-G p.Phe444Phe synonymous ADAMTS10 1 82674 1.20957E-5 41337 0 NA
19-8660965-G-A p.Ser443Ser synonymous ADAMTS10 1 82722 1.20887E-5 41361 0 NA
19-8660981-C-T p.Arg438His missense ADAMTS10 2 82882 2.41307E-5 41441 0 3.18593E-5
19-8660986-G-A p.Cys436Cys synonymous ADAMTS10 2 82910 2.41225E-5 41455 0 NA
19-8660990-G-A p.Ser435Phe missense ADAMTS10 1 82958 1.20543E-5 41479 0 8.24103E-6
19-8661010-G-T p.Thr428Thr synonymous ADAMTS10 2 83060 2.4079E-5 41530 0 6.37186E-5
19-8661029-G-A p.Ala422Val missense ADAMTS10 46 83110 5.53483E-4 41555 0 2.96667E-4
19-8661043-G-A p.Ala417Ala synonymous ADAMTS10 2 83130 2.40587E-5 41565 0 NA
19-8661046-T-C p.Pro416Pro synonymous ADAMTS10 1 83134 1.20288E-5 41567 0 8.24103E-6
19-8661059-C-T p.Arg412His missense ADAMTS10 1 83104 1.20331E-5 41552 0 1.64834E-5
19-8661064-C-T p.Gly410Gly synonymous ADAMTS10 1 83100 1.20337E-5 41550 0 8.24158E-6
19-8661081-C-T p.Val405Met missense ADAMTS10 1 83060 1.20395E-5 41530 0 3.97972E-6
19-8661104-C-T c.1191-1G>A splice_acceptor ADAMTS10 2 82928 2.41173E-5 41464 0 NA
19-8661190-C-G c.1190+1G>C splice_donor ADAMTS10 1 82254 1.21575E-5 41127 0 NA
19-8661191-G-A p.Thr397Ile missense+splice_region ADAMTS10 3 82246 3.64759E-5 41123 0 4.20444E-5
19-8661198-C-T p.Gly395Arg missense ADAMTS10 1 82310 1.21492E-5 41155 0 8.4364E-6
19-8661199-G-A p.Ile394Ile synonymous ADAMTS10 2 82316 2.42966E-5 41158 0 NA
19-8661200-A-G p.Ile394Thr missense ADAMTS10 1 82328 1.21465E-5 41164 0 NA
19-8661205-G-A p.His392His synonymous ADAMTS10 2 82330 2.42925E-5 41165 0 1.35304E-4
19-8661212-A-T p.Ile390Asn missense ADAMTS10 1 82446 1.21292E-5 41223 0 NA
19-8661220-C-T p.Ala387Ala synonymous ADAMTS10 7 82446 8.49041E-5 41223 0 3.18593E-5
19-8661226-G-A p.Ala385Ala synonymous ADAMTS10 1 82482 1.21239E-5 41241 0 8.474E-6
19-8661232-G-A p.Gly383Gly synonymous ADAMTS10 8 82488 9.69838E-5 41244 0 0.0025227
19-8661237-T-C p.Ile382Val missense ADAMTS10 3 82586 3.63258E-5 41293 0 6.37227E-5
19-8661244-A-G p.Asn379Asn synonymous ADAMTS10 2 82572 2.42213E-5 41286 0 NA
19-8661249-C-T p.Val378Ile missense ADAMTS10 1 82552 1.21136E-5 41276 0 3.39524E-5
19-8661250-G-A p.Ser377Ser synonymous ADAMTS10 2 82544 2.42295E-5 41272 0 NA
19-8661262-C-T p.Glu373Glu synonymous ADAMTS10 1 82586 1.21086E-5 41293 0 NA
19-8661264-C-T p.Glu373Lys missense ADAMTS10 2 82564 2.42236E-5 41282 0 1.20396E-5
19-8661265-G-C p.Arg372Arg synonymous ADAMTS10 4 82542 4.84602E-5 41271 0 5.10412E-5
19-8661267-G-A p.Arg372Cys missense ADAMTS10 1 82552 1.21136E-5 41276 0 4.01146E-6
19-8661279-C-T p.Gly368Arg missense ADAMTS10 2 82602 2.42125E-5 41301 0 5.04541E-4
19-8661280-G-A p.Gly367Gly synonymous ADAMTS10 4 82570 4.84437E-5 41285 0 1.27478E-4
19-8661286-C-T p.Pro365Pro synonymous ADAMTS10 5 82600 6.05327E-5 41300 0 3.40936E-5
19-8661294-G-A p.Leu363Leu splice_region+synonymous ADAMTS10 1 82684 1.20942E-5 41342 0 8.49603E-6
19-8661300-G-A c.1085-4C>T splice_region ADAMTS10 1 82698 1.20922E-5 41349 0 9.55779E-5
19-8661419-C-T c.1084+7G>A splice_region ADAMTS10 4 83226 4.80619E-5 41613 0 3.97804E-5
19-8661420-G-A c.1084+6C>T splice_region ADAMTS10 2 83226 2.4031E-5 41613 0 1.2333E-4
19-8661422-G-A c.1084+4C>T splice_region ADAMTS10 1 83226 1.20155E-5 41613 0 3.97772E-6
19-8661436-G-A p.Cys358Cys synonymous ADAMTS10 1 83252 1.20117E-5 41626 0 8.24783E-6
19-8661442-T-C p.Lys356Lys synonymous ADAMTS10 1 83252 1.20117E-5 41626 0 3.97731E-6
19-8661466-A-G p.Tyr348Tyr synonymous ADAMTS10 3 83228 3.60456E-5 41614 0 8.26487E-5
19-8661470-C-CGTGTGATGAGCACTGCTGTGTCATGGTTAGCCACACCGTTCTCTGGAATGGCA c.1041-2_1041-1insTGCCATTCCAGAGAACGGTGTGGCTAACCATGACACAGCAGTGCTCATCACAC splice_acceptor ADAMTS10 1 83214 1.20172E-5 41607 0 NA
19-8661907-C-T p.Gly335Asp missense ADAMTS10 1 83054 1.20404E-5 41527 0 NA
19-8661909-G-A p.Asn334Asn synonymous ADAMTS10 1 83048 1.20412E-5 41524 0 4.4586E-4
19-8661912-C-A p.Glu333Asp missense ADAMTS10 1 83058 1.20398E-5 41529 0 NA
19-8661917-G-A p.Pro332Ser missense ADAMTS10 1 83054 1.20404E-5 41527 0 8.2375E-6
19-8661935-C-T p.Gly326Ser missense ADAMTS10 2 83040 2.40848E-5 41520 0 3.18492E-5
19-8661936-G-A p.Ser325Ser synonymous ADAMTS10 2 83024 2.40894E-5 41512 0 9.55657E-5
19-8661942-G-A p.Asn323Asn synonymous ADAMTS10 2 83060 2.4079E-5 41530 0 1.5906E-5
19-8661947-C-T p.Val322Met missense ADAMTS10 1 83060 1.20395E-5 41530 0 3.18552E-5
19-8661948-G-A p.Ile321Ile synonymous ADAMTS10 4 83064 4.81556E-5 41532 0 NA
19-8661951-G-A p.Ser320Ser synonymous ADAMTS10 1 83062 1.20392E-5 41531 0 NA
19-8661981-G-A p.Ser310Ser synonymous ADAMTS10 1 83100 1.20337E-5 41550 0 NA
19-8661989-C-T p.Gly308Arg missense ADAMTS10 5 83118 6.01554E-5 41559 0 1.23573E-4
19-8661990-G-A p.Ala307Ala synonymous ADAMTS10 1 83126 1.20299E-5 41563 0 3.29522E-5
19-8661996-G-A p.His305His synonymous ADAMTS10 1 83142 1.20276E-5 41571 0 3.97678E-6
19-8662013-T-C p.Thr300Ala missense ADAMTS10 1 83136 1.20285E-5 41568 0 NA
19-8662016-GCTGGGGATGGACAGAGGGAAATGCATGGGCACCCACCACCCAGGGGACGGCAGGACATGCTGGTATGAAGGGGAAGGGGAAGGGGAGGAAGTCCCCCGCAC-G c.894+1_895-1del splice_acceptor ADAMTS10 7 83152 8.41832E-5 41576 0 NA
19-8662113-C-T c.894+5G>A splice_region ADAMTS10 9 83288 1.08059E-4 41644 0 9.56267E-5
19-8662114-G-A c.894+4C>T splice_region ADAMTS10 2 83282 2.40148E-5 41641 0 3.30437E-5
19-8662114-GC-G c.894+3delG splice_region ADAMTS10 1 83282 1.20074E-5 41641 0 NA
19-8662118-C-T p.Gln298Gln splice_region+synonymous ADAMTS10 1 83324 1.20013E-5 41662 0 3.97829E-6
19-8662127-C-A p.Thr295Thr synonymous ADAMTS10 1 83310 1.20034E-5 41655 0 7.95653E-6
19-8662127-C-T p.Thr295Thr synonymous ADAMTS10 1 83310 1.20034E-5 41655 0 1.65448E-5
19-8662132-G-T p.Leu294Ile missense ADAMTS10 1 83316 1.20025E-5 41658 0 4.14175E-5
19-8662139-G-A p.Leu291Leu synonymous ADAMTS10 6 83314 7.20167E-5 41657 0 2.86642E-4
19-8662143-C-T p.Arg290His missense ADAMTS10 1 83304 1.20042E-5 41652 0 NA
19-8662145-A-G p.Thr289Thr synonymous ADAMTS10 1 83298 1.20051E-5 41649 0 3.97858E-6
19-8662150-C-T p.Val288Ile missense ADAMTS10 1 83302 1.20045E-5 41651 0 8.33014E-6
19-8662162-C-T p.Val284Ile missense ADAMTS10 1 83290 1.20062E-5 41645 0 6.25E-4
19-8662177-T-C p.Ser279Gly missense ADAMTS10 1 83244 1.20129E-5 41622 0 NA
19-8662178-C-T p.Arg280Gln missense ADAMTS10 7 83236 8.40982E-5 41618 0 0.00100806
19-8662178-C-A p.Arg280Leu missense ADAMTS10 2 83236 2.40281E-5 41618 0 3.18654E-5
19-8662179-G-A p.Arg280* stop_gained ADAMTS10 2 83226 2.4031E-5 41613 0 3.9833E-6
19-8662207-C-G c.811-1G>C splice_acceptor ADAMTS10 1 83104 1.20331E-5 41552 0 NA
19-8665811-C-T c.810+1G>A splice_donor ADAMTS10 1 82302 1.21504E-5 41151 0 3.18654E-5
19-8665824-G-A p.Ala266Ala synonymous ADAMTS10 1 82604 1.2106E-5 41302 0 NA
19-8665836-C-A p.Gln262His missense ADAMTS10 1 82880 1.20656E-5 41440 0 NA
19-8665857-G-A p.His255His synonymous ADAMTS10 1 83064 1.20389E-5 41532 0 6.37146E-5
19-8665883-C-A p.Ala247Ser missense ADAMTS10 3 83188 3.60629E-5 41594 0 5.77825E-5
19-8665887-C-A p.Val245Val synonymous ADAMTS10 2 83196 2.40396E-5 41598 0 NA
19-8665901-C-T p.Val241Met missense ADAMTS10 2 83158 2.40506E-5 41579 0 8.25873E-6
19-8665902-G-A p.Tyr240Tyr synonymous ADAMTS10 2 83156 2.40512E-5 41578 0 8.25941E-6
19-8665906-C-T p.Arg239His missense ADAMTS10 66 83132 7.93918E-4 41566 0 7.96229E-4
19-8665907-G-A p.Arg239Cys missense ADAMTS10 1 83126 1.20299E-5 41563 0 4.77513E-5
19-8665920-C-T p.Ser234Ser synonymous ADAMTS10 2 83110 2.40645E-5 41555 0 2.38781E-5
19-8665921-G-A p.Ser234Leu missense ADAMTS10 1 83088 1.20354E-5 41544 0 NA
19-8665945-C-T p.Arg226His missense ADAMTS10 4 82954 4.82195E-5 41477 0 5.03525E-4
19-8665946-G-A p.Arg226Cys missense ADAMTS10 8 82940 9.64553E-5 41470 0 6.37105E-5
19-8665955-C-T p.Glu223Lys missense ADAMTS10 2 82954 2.41097E-5 41477 0 0.00151057
19-8665956-A-G p.Asn222Asn synonymous ADAMTS10 1 82958 1.20543E-5 41479 0 NA
19-8665968-C-T p.Arg218Arg synonymous ADAMTS10 4 82776 4.83232E-5 41388 0 8.33472E-6
19-8665977-C-T p.Pro215Pro synonymous ADAMTS10 7 82558 8.47889E-5 41279 0 2.23072E-4
19-8665978-G-A p.Pro215Leu missense ADAMTS10 4 82568 4.84449E-5 41284 0 3.59081E-5
19-8665979-G-A p.Pro215Ser missense ADAMTS10 20 82570 2.42219E-4 41285 0 1.2367E-4
19-8665993-C-T p.Arg210Gln missense ADAMTS10 7 82230 8.51271E-5 41115 0 5.03525E-4
19-8665994-G-A p.Arg210Trp missense ADAMTS10 6 82184 7.30069E-5 41092 0 1.27502E-4
19-8666002-C-A p.Trp207Leu missense ADAMTS10 1 82072 1.21844E-5 41036 0 NA
19-8666008-C-T p.Arg205Gln missense ADAMTS10 1 81858 1.22163E-5 40929 0 4.25655E-5
19-8666009-G-A p.Arg205Trp missense ADAMTS10 4 81730 4.89416E-5 40865 0 6.37511E-5
19-8666019-C-T p.Pro201Pro synonymous ADAMTS10 2 81458 2.45525E-5 40729 0 2.41354E-5
19-8666020-G-A p.Pro201Leu missense ADAMTS10 2 81370 2.45791E-5 40685 0 4.02544E-5
19-8666021-G-C p.Pro201Ala missense ADAMTS10 1 81298 1.23004E-5 40649 0 NA
19-8666021-G-A p.Pro201Ser missense ADAMTS10 5 81296 6.15036E-5 40648 0 2.81808E-5
19-8666030-C-CTCTCACTCCACAGGCTGTGTCCAGG c.593-2_593-1insCCTGGACACAGCCTGTGGAGTGAGA splice_acceptor ADAMTS10 2 80922 2.47152E-5 40461 0 NA
19-8666031-T-TCTCACTCCACA c.593-3_593-2insTGTGGAGTGAG splice_region ADAMTS10 1 80856 1.23677E-5 40428 0 NA
19-8668604-C-T c.592+8G>A splice_region ADAMTS10 3 83026 3.61333E-5 41513 0 5.78914E-5
19-8668607-T-C c.592+5A>G splice_region ADAMTS10 2 83068 2.40767E-5 41534 0 3.18532E-5
19-8668614-C-T p.Arg197Lys missense+splice_region ADAMTS10 1 83136 1.20285E-5 41568 0 NA
19-8668617-A-T p.Val196Glu missense ADAMTS10 2 83144 2.40547E-5 41572 0 7.95545E-5
19-8668633-C-G p.Asp191His missense ADAMTS10 1 83210 1.20178E-5 41605 0 3.97719E-6
19-8668635-A-G p.Leu190Pro missense ADAMTS10 1 83216 1.20169E-5 41608 0 1.19321E-5
19-8668647-C-T p.Arg186His missense ADAMTS10 7 83226 8.41083E-5 41613 0 5.03525E-4
19-8668648-G-A p.Arg186Cys missense ADAMTS10 4 83226 4.80619E-5 41613 0 2.47435E-5
19-8668660-G-A p.Arg182Cys missense ADAMTS10 1 83256 1.20111E-5 41628 0 8.24579E-6
19-8668676-T-G p.Pro176Pro synonymous ADAMTS10 3 83274 3.60256E-5 41637 0 NA
19-8668691-C-T p.Pro171Pro synonymous ADAMTS10 10 83276 1.20083E-4 41638 0 6.25E-4
19-8668691-C-G p.Pro171Pro synonymous ADAMTS10 1 83276 1.20083E-5 41638 0 3.18918E-5
19-8668695-C-G p.Ser170Thr missense ADAMTS10 5 83290 6.00312E-5 41645 0 3.1817E-5
19-8668698-C-T p.Arg169Gln missense ADAMTS10 45 83272 5.40398E-4 41636 0 0.0020141
19-8668699-G-A p.Arg169Trp missense ADAMTS10 3 83274 3.60256E-5 41637 0 NA
19-8668708-T-C p.Lys166Glu missense ADAMTS10 1 83286 1.20068E-5 41643 0 NA
19-8668711-G-A p.Pro165Ser missense ADAMTS10 1 83276 1.20083E-5 41638 0 NA
19-8668712-C-T p.Gly164Gly synonymous ADAMTS10 4 83270 4.80365E-5 41635 0 2.78456E-5
19-8668717-C-T p.Gly163Ser missense ADAMTS10 2 83304 2.40085E-5 41652 0 3.58078E-5
19-8668718-G-A p.His162His synonymous ADAMTS10 5 83292 6.00298E-5 41646 0 5.77358E-5
19-8668721-C-T p.Leu161Leu synonymous ADAMTS10 105 83304 0.00126044 41652 1 8.63427E-4
19-8668747-C-T p.Glu153Lys missense ADAMTS10 4 83306 4.80158E-5 41653 0 0.001875
19-8668755-A-C p.Val150Gly missense ADAMTS10 1 83316 1.20025E-5 41658 0 NA
19-8668756-C-T p.Val150Met missense ADAMTS10 4 83314 4.80111E-5 41657 0 8.42574E-6
19-8668757-G-A p.Ile149Ile synonymous ADAMTS10 1 83312 1.20031E-5 41656 0 3.99479E-6
19-8668766-G-A p.His146His splice_region+synonymous ADAMTS10 12 83304 1.44051E-4 41652 0 5.03525E-4
19-8668768-G-A p.His146Tyr missense+splice_region ADAMTS10 4 83302 4.80181E-5 41651 0 2.23172E-4
19-8669889-C-T c.435+8G>A splice_region ADAMTS10 2 78534 2.54667E-5 39267 0 NA
19-8669911-T-A p.Thr141Ser missense ADAMTS10 1 79204 1.26256E-5 39602 0 5.04541E-4
19-8669919-G-A p.Ala138Val missense ADAMTS10 1 79520 1.25755E-5 39760 0 NA
19-8669924-A-G p.His136His synonymous ADAMTS10 1 79718 1.25442E-5 39859 0 3.18878E-5
19-8669924-A-T p.His136Gln missense ADAMTS10 1 79718 1.25442E-5 39859 0 NA
19-8669931-G-C p.Thr134Ser missense ADAMTS10 43142 61106 0.706019 30553 14936 0.83125
19-8669931-G-T p.Thr134Asn missense ADAMTS10 3 79768 3.76091E-5 39884 0 NA
19-8669933-G-A p.Ser133Ser synonymous ADAMTS10 1 79854 1.25229E-5 39927 0 NA
19-8669946-T-G p.Gln129Pro missense ADAMTS10 2 80372 2.48843E-5 40186 0 NA
19-8669959-C-T p.Ala125Thr missense ADAMTS10 4 80620 4.96155E-5 40310 0 0.0015121
19-8669960-G-A p.Tyr124Tyr synonymous ADAMTS10 13 80742 1.61007E-4 40371 0 1.68738E-4
19-8669962-A-G p.Tyr124His missense ADAMTS10 2 80916 2.4717E-5 40458 0 NA
19-8669974-G-T p.Pro120Thr missense ADAMTS10 1 81042 1.23393E-5 40521 0 NA
19-8669976-C-T p.Arg119Gln missense ADAMTS10 374 81162 0.00460807 40581 9 0.0114294
19-8669977-G-A p.Arg119Trp missense ADAMTS10 1 81234 1.23101E-5 40617 0 3.1904E-5
19-8669981-C-T p.Ala117Ala synonymous ADAMTS10 48 81262 5.90682E-4 40631 0 0.00168994
19-8669982-G-A p.Ala117Val missense ADAMTS10 43 81256 5.29192E-4 40628 0 8.29505E-4
19-8669986-T-A p.Arg116Trp missense ADAMTS10 1 81388 1.22868E-5 40694 0 8.13412E-6
19-8669997-A-C p.Leu112Arg missense ADAMTS10 2 81480 2.45459E-5 40740 0 8.93591E-6
19-8670002-C-T p.Glu110Glu synonymous ADAMTS10 1 81556 1.22615E-5 40778 0 4.04675E-6
19-8670007-G-A p.Arg109Trp missense ADAMTS10 1 81546 1.2263E-5 40773 0 4.03825E-6
19-8670008-T-C p.Thr108Thr synonymous ADAMTS10 2 81620 2.45038E-5 40810 0 8.76916E-6
19-8670022-C-T p.Val104Met missense ADAMTS10 2 81720 2.44738E-5 40860 0 2.59421E-5
19-8670027-A-T p.Val102Asp missense ADAMTS10 1 81786 1.2227E-5 40893 0 8.61045E-6
19-8670028-C-T p.Val102Ile missense ADAMTS10 2 81772 2.44582E-5 40886 0 8.60719E-5
19-8670029-G-A p.His101His synonymous ADAMTS10 13 81848 1.58831E-4 40924 0 5.04032E-4
19-8670033-C-G p.Gly100Ala missense ADAMTS10 1 82120 1.21773E-5 41060 0 8.5282E-6
19-8670040-G-A p.Leu98Leu synonymous ADAMTS10 2 82190 2.43339E-5 41095 0 NA
19-8670045-C-T p.Arg96His missense ADAMTS10 4 82156 4.86879E-5 41078 1 4.24845E-5
19-8670049-A-G p.Ser95Pro missense ADAMTS10 1 82218 1.21628E-5 41109 0 5.04032E-4
19-8670054-C-T p.Arg93His missense ADAMTS10 11 82228 1.33774E-4 41114 0 1.91192E-4
19-8670055-G-A p.Arg93Cys missense ADAMTS10 3 82228 3.64839E-5 41114 0 1.20249E-5
19-8670068-C-T p.Leu88Leu synonymous ADAMTS10 1 82130 1.21758E-5 41065 0 NA
19-8670074-G-A p.His86His synonymous ADAMTS10 2 82074 2.43683E-5 41037 0 4.01684E-6
19-8670083-G-A p.Pro83Pro synonymous ADAMTS10 2 82032 2.43807E-5 41016 0 NA
19-8670086-C-T p.Ser82Ser synonymous ADAMTS10 1 81928 1.22058E-5 40964 0 3.18674E-5
19-8670086-C-A p.Ser82Ser synonymous ADAMTS10 1 81928 1.22058E-5 40964 0 NA
19-8670087-G-A p.Ser82Leu missense ADAMTS10 10 81920 1.2207E-4 40960 0 0.00162482
19-8670108-C-T p.Arg75His missense ADAMTS10 1 81544 1.22633E-5 40772 0 9.56389E-5
19-8670109-G-A p.Arg75Cys missense ADAMTS10 1 81560 1.22609E-5 40780 0 5.30588E-5
19-8670113-C-A p.Glu73Asp missense ADAMTS10 4 81264 4.92223E-5 40632 0 3.18735E-5
19-8670115-C-T p.Glu73Lys missense ADAMTS10 331 81196 0.00407656 40598 3 0.0050051
19-8670116-G-A p.Ala72Ala synonymous ADAMTS10 2 81182 2.4636E-5 40591 0 4.07458E-6
19-8670124-C-A p.Ala70Ser missense ADAMTS10 1 81050 1.23381E-5 40525 0 1.63871E-5
19-8670128-C-T p.Thr68Thr synonymous ADAMTS10 127 81088 0.0015662 40544 2 0.00296575
19-8670129-G-A p.Thr68Met missense ADAMTS10 3 80978 3.70471E-5 40489 0 3.18817E-5
19-8670133-C-T p.Gly67Ser missense ADAMTS10 2 80948 2.47072E-5 40474 0 5.34337E-5
19-8670134-G-A p.Arg66Arg synonymous ADAMTS10 27 80888 3.33795E-4 40444 0 6.25E-4
19-8670134-G-T p.Arg66Arg synonymous ADAMTS10 2 80888 2.47255E-5 40444 0 4.72063E-5
19-8670135-C-T p.Arg66His missense ADAMTS10 4 80862 4.9467E-5 40431 0 2.83661E-5
19-8670136-G-A p.Arg66Cys missense ADAMTS10 1 80892 1.23622E-5 40446 0 9.48317E-6
19-8670138-C-T p.Arg65His missense ADAMTS10 3 80838 3.71113E-5 40419 0 8.23947E-6
19-8670139-G-A p.Arg65Cys missense ADAMTS10 2 80748 2.47684E-5 40374 0 NA
19-8670147-C-T p.Arg62Gln missense ADAMTS10 3512 80668 0.0435365 40334 87 0.04
19-8670148-G-C p.Arg62Gly missense ADAMTS10 3 80786 3.71351E-5 40393 0 6.59826E-5
19-8670148-G-A p.Arg62Trp missense ADAMTS10 1 80786 1.23784E-5 40393 0 9.89962E-6
19-8670157-G-A p.Pro59Ser missense ADAMTS10 3 80756 3.71489E-5 40378 0 6.09088E-5
19-8670161-C-T p.Ser57Ser synonymous ADAMTS10 10 80576 1.24106E-4 40288 0 6.37836E-4
19-8670162-GAGA-G p.Phe56del disruptive_inframe_deletion ADAMTS10 16 80660 1.98364E-4 40330 0 4.14435E-4
19-8670162-G-A p.Ser57Leu missense ADAMTS10 2 80660 2.47954E-5 40330 0 6.20732E-5
19-8670165-AA-GC p.Phe56Ala missense ADAMTS10 1 80666 1.23968E-5 40333 0 NA
19-8670167-G-A p.Ala55Ala synonymous ADAMTS10 1 80672 1.23959E-5 40336 0 NA
19-8670178-C-T p.Ala52Thr missense ADAMTS10 2 80432 2.48657E-5 40216 0 4.15193E-6
19-8670182-G-A p.Asn50Asn synonymous ADAMTS10 16 80456 1.98866E-4 40228 0 0.00101112
19-8670187-G-T p.His49Asn missense ADAMTS10 1 80418 1.2435E-5 40209 0 8.34119E-6
19-8670193-C-T p.Val47Met missense ADAMTS10 1 80118 1.24816E-5 40059 0 1.59398E-4
19-8670195-C-T p.Arg46His missense ADAMTS10 2 79944 2.50175E-5 39972 0 9.56633E-5
19-8670196-G-A p.Arg46Cys missense ADAMTS10 5 79932 6.25532E-5 39966 0 1.68148E-5
19-8670202-G-A p.Pro44Ser missense ADAMTS10 1 79876 1.25194E-5 39938 0 NA
19-8670209-G-A p.Ile41Ile synonymous ADAMTS10 1 79464 1.25843E-5 39732 0 4.27402E-6
19-8670231-G-C p.Ser34Cys missense ADAMTS10 4 78092 5.12216E-5 39046 0 NA
19-8670233-C-T p.Leu33Leu synonymous ADAMTS10 1 77958 1.28274E-5 38979 0 3.27322E-5
19-8670248-G-GTCTCGCCGCCCC c.89-6_89-5insGGGGCGGCGAGA splice_region ADAMTS10 1 76490 1.30736E-5 38245 0 NA
19-8670516-C-T p.Arg27Gln missense ADAMTS10 3 79674 3.76534E-5 39837 0 3.23981E-5
19-8670523-C-T p.Ala25Thr missense ADAMTS10 5 79728 6.27132E-5 39864 0 3.23908E-5
19-8670526-G-A p.His24Tyr missense ADAMTS10 2 79792 2.50652E-5 39896 0 9.57121E-5
19-8670527-C-T p.Thr23Thr synonymous ADAMTS10 12 79774 1.50425E-4 39887 0 3.18979E-4
19-8670528-G-A p.Thr23Met missense ADAMTS10 8 79808 1.00241E-4 39904 1 1.519E-4
19-8670535-C-T p.Glu21Lys missense ADAMTS10 2 79902 2.50307E-5 39951 0 3.57405E-5
19-8670536-G-A p.Phe20Phe synonymous ADAMTS10 6 79898 7.50957E-5 39949 0 4.46867E-5
19-8670553-C-G p.Gly15Arg missense ADAMTS10 1 79876 1.25194E-5 39938 0 NA
19-8670559-C-T p.Ala13Thr missense ADAMTS10 1 79666 1.25524E-5 39833 0 1.86647E-5
19-8670581-G-A p.Cys5Cys synonymous ADAMTS10 1 79278 1.26138E-5 39639 0 NA
19-8670582-C-T p.Cys5Tyr missense ADAMTS10 1 79282 1.26132E-5 39641 0 4.21912E-6
19-8670586-C-T p.Ala4Thr missense ADAMTS10 4 78990 5.06393E-5 39495 0 8.18465E-5
19-8670587-G-A p.Pro3Pro synonymous ADAMTS10 4 79202 5.05038E-5 39601 0 1.14908E-4
19-8670687-C-T c.-92G>A 5_prime_UTR_premature_start_codon_gain ADAMTS10 1 72570 1.37798E-5 36285 0 3.18654E-5
19-8670689-G-A c.-94C>T 5_prime_UTR_premature_start_codon_gain ADAMTS10 1 72084 1.38727E-5 36042 0 NA
19-8670697-G-A c.-99-3C>T splice_region ADAMTS10 22 70962 3.10025E-4 35481 0 1.27551E-4
19-8670698-GGA-G c.-99-6_-99-5delTC splice_region ADAMTS10 2 70788 2.82534E-5 35394 0 NA
19-8670699-G-A c.-99-5C>T splice_region ADAMTS10 2 70692 2.82917E-5 35346 0 NA
19-8670702-G-T c.-99-8C>A splice_region ADAMTS10 2 70106 2.85282E-5 35053 0 3.18918E-5