Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
21-28209916-T-C p.Thr962Thr synonymous ADAMTS1 1 80376 1.24415E-5 40188 0 3.1841E-5
21-28209918-T-G p.Thr962Pro missense ADAMTS1 1 80580 1.241E-5 40290 0 6.25E-4
21-28209920-C-G p.Cys961Ser missense ADAMTS1 1 80762 1.23821E-5 40381 0 8.30579E-6
21-28209925-G-A p.Asp959Asp synonymous ADAMTS1 1 81260 1.23062E-5 40630 0 8.29972E-6
21-28209935-T-C p.His956Arg missense ADAMTS1 1 82048 1.2188E-5 41024 0 8.28514E-6
21-28209937-T-C p.Lys955Lys synonymous ADAMTS1 2 82178 2.43374E-5 41089 0 NA
21-28209943-T-C p.Lys953Lys synonymous ADAMTS1 1 82476 1.21247E-5 41238 0 NA
21-28209954-G-A p.Pro950Ser missense ADAMTS1 1 82890 1.20642E-5 41445 0 NA
21-28209967-A-G p.His945His synonymous ADAMTS1 2 83150 2.40529E-5 41575 0 8.24538E-6
21-28209986-T-C p.Asp939Gly missense ADAMTS1 1 83312 1.20031E-5 41656 0 3.58021E-5
21-28209989-T-C p.His938Arg missense ADAMTS1 38 83328 4.56029E-4 41664 0 8.59654E-4
21-28209996-G-C p.Leu936Val missense ADAMTS1 1 83342 1.19988E-5 41671 0 NA
21-28210003-C-G p.Leu933Phe missense ADAMTS1 1 83360 1.19962E-5 41680 0 7.95444E-6
21-28210006-G-A p.Ser932Ser synonymous ADAMTS1 1 83356 1.19967E-5 41678 0 NA
21-28210010-C-CT p.Arg931fs frameshift ADAMTS1 1 83356 1.19967E-5 41678 0 4.9421E-5
21-28210014-T-C p.Lys930Glu missense ADAMTS1 1 83358 1.19964E-5 41679 0 3.97706E-6
21-28210030-A-G p.Cys924Cys synonymous ADAMTS1 1080 83332 0.0129602 41666 10 0.0112536
21-28210039-A-T p.Ser921Ser synonymous ADAMTS1 1 83380 1.19933E-5 41690 0 NA
21-28210048-T-G p.Ser918Ser synonymous ADAMTS1 1 83380 1.19933E-5 41690 0 NA
21-28210048-T-C p.Ser918Ser synonymous ADAMTS1 6 83380 7.19597E-5 41690 2 1.89438E-4
21-28210050-A-G p.Ser918Pro missense ADAMTS1 1 83376 1.19939E-5 41688 0 8.23642E-6
21-28210058-C-G p.Gly915Ala missense ADAMTS1 1 83378 1.19936E-5 41689 0 NA
21-28210058-C-T p.Gly915Glu missense ADAMTS1 2 83378 2.39871E-5 41689 0 3.18593E-5
21-28210065-G-A p.Gln913* stop_gained ADAMTS1 1 83368 1.1995E-5 41684 0 NA
21-28210069-C-G p.Gln911His missense ADAMTS1 2 83370 2.39894E-5 41685 0 NA
21-28210072-G-C p.Pro910Pro synonymous ADAMTS1 1 83378 1.19936E-5 41689 0 3.97649E-6
21-28210087-T-C p.Ala905Ala synonymous ADAMTS1 1 83392 1.19916E-5 41696 0 1.64728E-5
21-28210111-C-T p.Lys897Lys synonymous ADAMTS1 2 83392 2.39831E-5 41696 0 3.97659E-6
21-28210113-T-C p.Lys897Glu missense ADAMTS1 1 83390 1.19918E-5 41695 0 8.23655E-6
21-28210122-T-C p.Lys894Glu missense ADAMTS1 2 83392 2.39831E-5 41696 0 6.37389E-5
21-28210132-G-A p.Ser890Ser synonymous ADAMTS1 1 83370 1.19947E-5 41685 0 6.75993E-5
21-28210146-C-T p.Gly886Arg missense ADAMTS1 1 83394 1.19913E-5 41697 0 NA
21-28210154-T-C p.Asp883Gly missense ADAMTS1 1 83400 1.19904E-5 41700 0 3.97643E-6
21-28210157-C-T p.Arg882Gln missense ADAMTS1 1 83398 1.19907E-5 41699 0 NA
21-28210158-G-A p.Arg882* stop_gained ADAMTS1 1 83396 1.1991E-5 41698 0 3.18613E-5
21-28210165-T-C p.Val879Val synonymous ADAMTS1 16 83394 1.9186E-4 41697 0 1.59195E-4
21-28210186-C-T p.Leu872Leu synonymous ADAMTS1 2 83408 2.39785E-5 41704 0 3.97636E-6
21-28210190-T-G p.Glu871Ala missense ADAMTS1 2 83400 2.39808E-5 41700 0 3.29457E-5
21-28210209-C-T p.Glu865Lys missense ADAMTS1 1 83394 1.19913E-5 41697 0 8.23642E-5
21-28210209-C-G p.Glu865Gln missense ADAMTS1 3 83394 3.59738E-5 41697 0 6.36902E-5
21-28210227-C-A p.Val859Phe missense ADAMTS1 1 83400 1.19904E-5 41700 0 NA
21-28210228-C-A p.Trp858Cys missense ADAMTS1 1 83400 1.19904E-5 41700 0 NA
21-28210234-T-C p.Ser856Ser synonymous ADAMTS1 1 83402 1.19901E-5 41701 0 8.23683E-6
21-28210245-G-T p.Pro853Thr missense ADAMTS1 1 83402 1.19901E-5 41701 0 8.23683E-6
21-28210278-C-T p.Val842Ile missense ADAMTS1 6 83396 7.19459E-5 41698 0 3.97665E-5
21-28210279-G-A p.Phe841Phe synonymous ADAMTS1 1 83392 1.19916E-5 41696 0 1.98831E-5
21-28210304-C-T p.Arg833Gln missense ADAMTS1 10 83364 1.19956E-4 41682 0 3.57901E-5
21-28210305-G-A p.Arg833* stop_gained ADAMTS1 1 83364 1.19956E-5 41682 0 NA
21-28210309-G-A p.Ala831Ala synonymous ADAMTS1 1 83366 1.19953E-5 41683 0 3.97668E-6
21-28210310-G-A p.Ala831Val missense ADAMTS1 1 83368 1.1995E-5 41684 0 7.95342E-6
21-28210328-A-G p.Val825Ala missense ADAMTS1 9 83350 1.07978E-4 41675 0 NA
21-28210329-C-A p.Val825Phe missense ADAMTS1 4 83350 4.79904E-5 41675 0 3.97703E-6
21-28210331-T-C p.Gln824Arg missense ADAMTS1 1 83344 1.19985E-5 41672 0 NA
21-28210336-G-C p.Thr822Thr synonymous ADAMTS1 30 83334 3.59997E-4 41667 0 6.25E-4
21-28210343-G-C p.Pro820Arg missense ADAMTS1 3 83324 3.6004E-5 41662 0 3.1839E-5
21-28210351-G-T p.Leu817Leu synonymous ADAMTS1 1 83306 1.20039E-5 41653 0 8.24239E-6
21-28210368-G-A p.Arg812Cys missense ADAMTS1 321 83288 0.0038541 41644 0 0.00372611
21-28210373-C-A p.Arg810Ile missense ADAMTS1 1 83298 1.20051E-5 41649 0 3.97817E-6
21-28210380-A-G p.Leu808Leu synonymous ADAMTS1 10 83292 1.2006E-4 41646 0 4.12194E-5
21-28210384-C-T p.Ala806Ala synonymous ADAMTS1 6 83274 7.20513E-5 41637 0 6.37186E-5
21-28210385-G-A p.Ala806Val missense ADAMTS1 2 83280 2.40154E-5 41640 0 4.94723E-5
21-28210396-G-A p.Ser802Ser synonymous ADAMTS1 3 83260 3.60317E-5 41630 0 1.3192E-4
21-28210408-G-T p.Val798Val synonymous ADAMTS1 1 83242 1.20132E-5 41621 0 NA
21-28210417-T-C p.Lys795Lys synonymous ADAMTS1 1 83208 1.20181E-5 41604 0 NA
21-28210439-A-C p.Leu788* stop_gained ADAMTS1 1 83206 1.20184E-5 41603 0 NA
21-28210444-G-C p.Ser786Ser synonymous ADAMTS1 2 83196 2.40396E-5 41598 0 NA
21-28210444-G-A p.Ser786Ser synonymous ADAMTS1 4 83196 4.80792E-5 41598 0 6.37267E-5
21-28210450-A-G p.Thr784Thr synonymous ADAMTS1 1 83212 1.20175E-5 41606 0 3.30207E-5
21-28210457-T-C p.Asp782Gly missense ADAMTS1 359 83218 0.00431397 41609 2 0.008125
21-28210474-T-C p.Thr776Thr synonymous ADAMTS1 314 83250 0.00377177 41625 3 0.00707322
21-28210481-T-A p.Asp774Val missense ADAMTS1 1 83260 1.20106E-5 41630 0 NA
21-28210482-C-T p.Asp774Asn missense ADAMTS1 1 83264 1.201E-5 41632 0 NA
21-28210483-A-G p.Ala773Ala synonymous ADAMTS1 1 83258 1.20109E-5 41629 0 NA
21-28210504-G-C p.Ser766Arg missense ADAMTS1 1 83282 1.20074E-5 41641 0 8.27499E-6
21-28210513-G-A p.Asn763Asn synonymous ADAMTS1 1 83298 1.20051E-5 41649 0 NA
21-28210522-T-G p.Gly760Gly synonymous ADAMTS1 2 83302 2.4009E-5 41651 0 NA
21-28210531-G-T p.Asn757Lys missense ADAMTS1 1 83302 1.20045E-5 41651 0 NA
21-28210535-C-T p.Arg756Gln missense ADAMTS1 282 83296 0.00338552 41648 1 0.008125
21-28210535-C-G p.Arg756Pro missense ADAMTS1 4 83302 4.80181E-5 41651 0 3.986E-6
21-28210536-G-A p.Arg756Trp missense ADAMTS1 9 83302 1.08041E-4 41651 0 9.55597E-5
21-28210539-G-A p.Gln755* stop_gained ADAMTS1 1 83304 1.20042E-5 41652 0 NA
21-28210549-G-A p.Ile751Ile synonymous ADAMTS1 16 83312 1.92049E-4 41656 0 3.18512E-4
21-28210552-G-A p.Asn750Asn synonymous ADAMTS1 1 83306 1.20039E-5 41653 0 3.99205E-6
21-28210573-T-A p.Thr743Thr synonymous ADAMTS1 1 83280 1.20077E-5 41640 0 NA
21-28210577-A-G p.Ile742Thr missense ADAMTS1 1 83274 1.20085E-5 41637 0 3.18573E-5
21-28210589-T-A p.Tyr738Phe missense ADAMTS1 1 83236 1.2014E-5 41618 0 NA
21-28210592-C-A p.Gly737Val missense ADAMTS1 2 83228 2.40304E-5 41614 0 3.18471E-5
21-28210597-TCTGCAGGTGACAAAAACAGGCATAAATCTCTGATTCATTGGCTAATTAGATTATTTAGCTTAAAAACACATTAATCTTTTATGAGACATATTTTTTTCCCAGACCTGTTGAAAGGCCCATTTAAATTATAAGGTCTGCAAATAGGTGTTTTAAAACTTAC-T c.2204+1_2205-1del splice_acceptor ADAMTS1 1 83214 1.20172E-5 41607 0 NA
21-28210601-C-T c.2205-4G>A splice_region ADAMTS1 2 83190 2.40414E-5 41595 0 8.3861E-6
21-28210601-C-CA c.2205-5_2205-4insT splice_region ADAMTS1 1 83190 1.20207E-5 41595 0 3.35444E-5
21-28210763-A-T p.Ser733Arg missense ADAMTS1 1 83308 1.20036E-5 41654 0 NA
21-28210767-G-A p.Thr732Ile missense ADAMTS1 5 83316 6.00125E-5 41658 0 6.59805E-5
21-28210784-T-G p.Lys726Asn missense ADAMTS1 1 83316 1.20025E-5 41658 0 1.64826E-5
21-28210785-T-G p.Lys726Thr missense ADAMTS1 3 83314 3.60084E-5 41657 0 NA
21-28210794-G-C p.Thr723Ser missense ADAMTS1 4 83312 4.80123E-5 41656 0 NA
21-28210799-T-G p.Gly721Gly synonymous ADAMTS1 4 83306 4.80158E-5 41653 0 3.18573E-5
21-28210799-T-A p.Gly721Gly synonymous ADAMTS1 1 83306 1.20039E-5 41653 0 3.18573E-5
21-28210800-C-A p.Gly721Val missense ADAMTS1 1 83308 1.20036E-5 41654 0 8.23859E-6
21-28210807-C-G p.Gly719Arg missense ADAMTS1 1 83310 1.20034E-5 41655 0 NA
21-28210810-C-T p.Gly718Arg missense ADAMTS1 2 83316 2.4005E-5 41658 0 6.36902E-5
21-28210811-G-A p.Cys717Cys synonymous ADAMTS1 4 83312 4.80123E-5 41656 0 6.25E-4
21-28210818-C-T p.Gly715Asp missense ADAMTS1 2 83318 2.40044E-5 41659 0 3.97712E-6
21-28210840-T-C p.Lys708Glu missense ADAMTS1 1 83318 1.20022E-5 41659 0 NA
21-28210845-T-C p.Asp706Gly missense ADAMTS1 1 83322 1.20016E-5 41661 0 1.59086E-5
21-28210854-C-T p.Arg703His missense ADAMTS1 4728 83244 0.0567969 41622 158 0.091138
21-28210862-A-G p.Gly700Gly synonymous ADAMTS1 35 83316 4.20087E-4 41658 0 0.00108266
21-28210881-C-T p.Gly694Glu missense ADAMTS1 1 83302 1.20045E-5 41651 0 3.9775E-5
21-28210883-T-C p.Gln693Gln synonymous ADAMTS1 6 83300 7.20288E-5 41650 0 6.0498E-4
21-28210885-G-C p.Gln693Glu missense ADAMTS1 2 83300 2.40096E-5 41650 0 NA
21-28210888-C-T p.Val692Met missense ADAMTS1 2 83290 2.40125E-5 41645 0 3.97804E-6
21-28210892-G-A p.Val690Val synonymous ADAMTS1 1 83286 1.20068E-5 41643 0 NA
21-28210896-G-C p.Ser689Cys missense ADAMTS1 1 83282 1.20074E-5 41641 0 NA
21-28210930-C-T p.Val678Ile missense ADAMTS1 30 83132 3.60872E-4 41566 0 3.84148E-4
21-28211898-C-T c.2028+8G>A splice_region ADAMTS1 3 82062 3.65577E-5 41031 0 3.38696E-5
21-28211899-G-A c.2028+7C>T splice_region ADAMTS1 33 82234 4.01294E-4 41117 0 6.25E-4
21-28211900-A-T c.2028+6T>A splice_region ADAMTS1 2 82360 2.42836E-5 41180 0 NA
21-28211907-T-C p.Lys676Arg missense+splice_region ADAMTS1 1 83296 1.20054E-5 41648 0 8.35953E-6
21-28211920-C-T p.Val672Ile missense ADAMTS1 31 83312 3.72095E-4 41656 0 5.80739E-5
21-28211921-G-A p.Phe671Phe synonymous ADAMTS1 1 83316 1.20025E-5 41658 0 2.48682E-5
21-28211934-A-T p.Ile667Asn missense ADAMTS1 1 83322 1.20016E-5 41661 0 3.18451E-5
21-28211942-G-A p.Ala664Ala synonymous ADAMTS1 1 83322 1.20016E-5 41661 0 NA
21-28211980-C-T p.Val652Ile missense ADAMTS1 4 83324 4.80054E-5 41662 0 4.94315E-5
21-28211987-G-A p.Tyr649Tyr synonymous ADAMTS1 1 83338 1.19993E-5 41669 0 4.94324E-5
21-28211990-C-T p.Lys648Lys synonymous ADAMTS1 1 83336 1.19996E-5 41668 0 NA
21-28211991-T-C p.Lys648Arg missense ADAMTS1 7 83338 8.39953E-5 41669 0 5.03525E-4
21-28211997-A-G p.Ile646Thr missense ADAMTS1 5 83338 5.99966E-5 41669 0 1.59327E-4
21-28212006-A-G p.Val643Ala missense ADAMTS1 3 83338 3.5998E-5 41669 0 3.18613E-5
21-28212007-C-T p.Val643Met missense ADAMTS1 1 83330 1.20005E-5 41665 0 3.18573E-5
21-28212008-C-T p.Ala642Ala synonymous ADAMTS1 9 83330 1.08004E-4 41665 0 6.37186E-5
21-28212028-A-G p.Ser636Pro missense ADAMTS1 1 83344 1.19985E-5 41672 0 NA
21-28212041-C-A p.Glu631Asp missense ADAMTS1 1 83346 1.19982E-5 41673 0 NA
21-28212043-C-T p.Glu631Lys missense ADAMTS1 87 83338 0.00104394 41669 0 0.00280416
21-28212044-G-A p.Asn630Asn synonymous ADAMTS1 14 83348 1.6797E-4 41674 0 9.5584E-5
21-28212052-C-T p.Ala628Thr missense ADAMTS1 1 83348 1.19979E-5 41674 0 7.95874E-6
21-28212065-C-T p.Glu623Glu synonymous ADAMTS1 1 83352 1.19973E-5 41676 0 1.19751E-5
21-28212067-C-G p.Glu623Gln missense ADAMTS1 1 83356 1.19967E-5 41678 0 3.18471E-5
21-28212070-T-G p.Arg622Arg synonymous ADAMTS1 1 83352 1.19973E-5 41676 0 NA
21-28212191-C-T c.1852+3G>A splice_region ADAMTS1 1 83388 1.19921E-5 41694 0 NA
21-28212195-A-T p.Asn617Lys missense+splice_region ADAMTS1 1 83388 1.19921E-5 41694 0 2.4853E-5
21-28212219-G-T p.Asn609Lys missense ADAMTS1 1 83396 1.1991E-5 41698 0 8.25287E-6
21-28212222-A-G p.Cys608Cys synonymous ADAMTS1 12 83392 1.43899E-4 41696 0 2.2293E-4
21-28212226-G-A p.Ser607Phe missense ADAMTS1 2 83392 2.39831E-5 41696 0 7.95564E-6
21-28212229-C-T p.Arg606Lys missense ADAMTS1 1 83390 1.19918E-5 41695 0 NA
21-28212235-C-T p.Arg604His missense ADAMTS1 1 83386 1.19924E-5 41693 0 0.00125
21-28212236-G-A p.Arg604Cys missense ADAMTS1 1 83384 1.19927E-5 41692 0 2.47264E-5
21-28212237-C-T p.Val603Val synonymous ADAMTS1 1 83386 1.19924E-5 41693 0 3.97731E-6
21-28212246-G-T p.Gly600Gly synonymous ADAMTS1 1 83380 1.19933E-5 41690 0 NA
21-28212266-C-T p.Gly594Arg missense ADAMTS1 1 83382 1.1993E-5 41691 0 3.9769E-6
21-28212276-G-A p.Val590Val synonymous ADAMTS1 1 83380 1.19933E-5 41690 0 NA
21-28212300-C-T p.Thr582Thr synonymous ADAMTS1 2 83378 2.39871E-5 41689 0 3.18593E-5
21-28212301-G-A p.Thr582Met missense ADAMTS1 6 83382 7.1958E-5 41691 0 9.55779E-5
21-28212320-C-T p.Gly576Ser missense ADAMTS1 88 83376 0.00105546 41688 0 0.00191278
21-28212321-G-A p.Cys575Cys synonymous ADAMTS1 4 83378 4.79743E-5 41689 0 1.64821E-5
21-28212324-C-T p.Thr574Thr synonymous ADAMTS1 1 83372 1.19944E-5 41686 0 2.47251E-5
21-28212325-G-A p.Thr574Met missense ADAMTS1 1 83368 1.1995E-5 41684 0 6.37755E-5
21-28212328-C-G p.Arg573Thr missense ADAMTS1 1 83376 1.19939E-5 41688 0 NA
21-28212330-C-T p.Ser572Ser synonymous ADAMTS1 4 83372 4.79777E-5 41686 0 1.64861E-5
21-28212334-C-T p.Cys571Tyr missense ADAMTS1 1 83368 1.1995E-5 41684 0 NA
21-28212336-G-A p.Asp570Asp synonymous ADAMTS1 1 83370 1.19947E-5 41685 0 2.47419E-5
21-28212337-T-C p.Asp570Gly missense ADAMTS1 1 83364 1.19956E-5 41682 0 NA
21-28212345-A-G p.Pro567Pro synonymous ADAMTS1 3 83368 3.5985E-5 41684 0 1.07323E-4
21-28212346-G-A p.Pro567Leu missense ADAMTS1 1 83366 1.19953E-5 41683 0 NA
21-28212366-T-C p.Gly560Gly synonymous ADAMTS1 1 83334 1.19999E-5 41667 0 NA
21-28212379-G-A p.Thr556Met missense+splice_region ADAMTS1 24 83296 2.88129E-4 41648 0 5.09684E-4
21-28212386-T-C c.1666-6A>G splice_region ADAMTS1 5 83268 6.00471E-5 41634 0 3.18593E-5
21-28212612-C-A p.Asp550Tyr missense ADAMTS1 2 83366 2.39906E-5 41683 0 3.98819E-6
21-28212628-C-G p.Lys544Asn missense ADAMTS1 1 83372 1.19944E-5 41686 0 NA
21-28212633-C-G p.Gly543Arg missense ADAMTS1 1 83374 1.19941E-5 41687 0 NA
21-28212633-C-T p.Gly543Ser missense ADAMTS1 6 83374 7.19649E-5 41687 0 5.17314E-5
21-28212634-G-A p.Asn542Asn synonymous ADAMTS1 1 83372 1.19944E-5 41686 0 0.00100705
21-28212649-C-T p.Gly537Gly synonymous ADAMTS1 3 83368 3.5985E-5 41684 0 1.1932E-5
21-28212656-C-A p.Gly535Val missense ADAMTS1 1 83364 1.19956E-5 41682 0 8.23791E-6
21-28212673-C-T p.Ala529Ala synonymous ADAMTS1 61 83358 7.31783E-4 41679 0 0.00117812
21-28212674-G-A p.Ala529Val missense ADAMTS1 1 83358 1.19964E-5 41679 0 3.18512E-5
21-28212679-C-T p.Pro527Pro synonymous ADAMTS1 2 83354 2.3994E-5 41677 0 2.47154E-5
21-28212709-C-T p.Gly517Gly synonymous ADAMTS1 1 83344 1.19985E-5 41672 0 3.97722E-6
21-28212713-C-G p.Gly516Ala missense ADAMTS1 2 83344 2.39969E-5 41672 0 NA
21-28212717-A-T p.Ser515Thr missense ADAMTS1 1 83350 1.19976E-5 41675 0 NA
21-28212719-G-A p.Thr514Ile missense ADAMTS1 2 83348 2.39958E-5 41674 0 6.36821E-5
21-28212720-T-C p.Thr514Ala missense ADAMTS1 28 83342 3.35965E-4 41671 0 0.0020141
21-28212723-C-T p.Gly513Ser missense ADAMTS1 1 83346 1.19982E-5 41673 0 1.98891E-5
21-28212724-G-A p.Thr512Thr synonymous ADAMTS1 4 83346 4.79927E-5 41673 0 7.42427E-5
21-28212732-A-T p.Trp510Arg missense ADAMTS1 2 83340 2.39981E-5 41670 0 8.24878E-6
21-28212760-G-A p.Pro500Pro synonymous ADAMTS1 52346 82986 0.630781 41493 16740 0.668581
21-28212767-T-C p.His498Arg missense ADAMTS1 3 83332 3.60006E-5 41666 0 NA
21-28212782-C-T p.Gly493Glu missense ADAMTS1 2 83310 2.40067E-5 41655 0 8.25546E-6
21-28212788-G-A p.Thr491Ile missense ADAMTS1 42 83318 5.04093E-4 41659 0 0.00352467
21-28212802-C-A p.Arg486Arg synonymous ADAMTS1 163 83300 0.00195678 41650 1 0.0035985
21-28212804-G-A p.Arg486Trp missense ADAMTS1 2 83308 2.40073E-5 41654 0 4.7738E-5
21-28212804-G-T p.Arg486Arg synonymous ADAMTS1 1 83308 1.20036E-5 41654 0 NA
21-28212806-T-C p.Asn485Ser missense ADAMTS1 1 83314 1.20028E-5 41657 0 3.97725E-6
21-28212814-G-A p.Tyr482Tyr synonymous ADAMTS1 3 83308 3.60109E-5 41654 0 4.94911E-5
21-28212817-C-T p.Ser481Ser synonymous ADAMTS1 1 83304 1.20042E-5 41652 0 5.03525E-4
21-28212818-G-A p.Ser481Leu missense ADAMTS1 3 83302 3.60135E-5 41651 0 2.38633E-5
21-28212834-C-T p.Asp476Asn missense ADAMTS1 2 83292 2.40119E-5 41646 0 1.98932E-5
21-28212837-C-T p.Gly475Ser missense ADAMTS1 2 83258 2.40217E-5 41629 0 8.25546E-6
21-28212845-T-C p.Gln472Arg missense ADAMTS1 1 83226 1.20155E-5 41613 0 1.19411E-5
21-28212849-T-C p.Ile471Val missense ADAMTS1 7 83222 8.41124E-5 41611 0 4.96065E-5
21-28212861-G-C p.Pro467Ala missense ADAMTS1 27 83106 3.24886E-4 41553 1 6.3678E-4
21-28212866-T-G p.Asp465Ala missense ADAMTS1 1 83014 1.20462E-5 41507 0 3.98963E-6
21-28213314-C-T c.1378+3G>A splice_region ADAMTS1 32 83350 3.83923E-4 41675 0 2.90858E-4
21-28213333-A-C p.Phe454Leu missense ADAMTS1 9 83376 1.07945E-4 41688 0 5.03525E-4
21-28213343-A-G p.Ile451Thr missense ADAMTS1 5 83374 5.99707E-5 41687 0 5.76872E-5
21-28213374-G-A p.Gln441* stop_gained ADAMTS1 1 83384 1.19927E-5 41692 0 NA
21-28213386-G-T p.Leu437Met missense ADAMTS1 1 83382 1.1993E-5 41691 0 NA
21-28213391-G-T p.Ser435Tyr missense ADAMTS1 1 83382 1.1993E-5 41691 0 2.38572E-5
21-28213402-C-T p.Ala431Ala synonymous ADAMTS1 1 83378 1.19936E-5 41689 0 5.56673E-5
21-28213418-T-C p.Asp426Gly missense ADAMTS1 3 83386 3.59773E-5 41693 0 5.03525E-4
21-28213430-C-A p.Gly422Val missense ADAMTS1 3 83378 3.59807E-5 41689 0 3.1841E-5
21-28213459-A-G p.Asp412Asp synonymous ADAMTS1 15 83336 1.79994E-4 41668 0 0.00100705
21-28213461-C-T p.Asp412Asn missense ADAMTS1 1 83328 1.20008E-5 41664 0 NA
21-28213462-A-G p.His411His synonymous ADAMTS1 2 83334 2.39998E-5 41667 0 3.18241E-5
21-28213466-G-A p.Pro410Leu missense ADAMTS1 1 83314 1.20028E-5 41657 0 NA
21-28213468-C-T p.Met409Ile missense ADAMTS1 2 83316 2.4005E-5 41658 0 3.97905E-6
21-28213480-G-A p.His405His synonymous ADAMTS1 1 83246 1.20126E-5 41623 0 8.25518E-6
21-28213488-G-A c.1211-4C>T splice_region ADAMTS1 1 83194 1.20201E-5 41597 0 NA
21-28214172-CT-C c.1210+4delA splice_region ADAMTS1 4 83292 4.80238E-5 41646 0 3.1841E-5
21-28214195-T-C p.Thr398Ala missense ADAMTS1 1 83332 1.20002E-5 41666 0 NA
21-28214200-G-A p.Ala396Val missense ADAMTS1 3 83336 3.59988E-5 41668 0 3.1839E-5
21-28214222-C-G p.Glu389Gln missense ADAMTS1 1 83358 1.19964E-5 41679 0 NA
21-28214224-A-G p.Ile388Thr missense ADAMTS1 1 83360 1.19962E-5 41680 0 4.77297E-5
21-28214228-C-T p.Val387Ile missense ADAMTS1 8 83364 9.59647E-5 41682 0 6.25E-4
21-28214229-G-A p.Ser386Ser synonymous ADAMTS1 16 83362 1.91934E-4 41681 0 6.25E-4
21-28214238-T-C p.Arg383Arg synonymous ADAMTS1 435 83360 0.00521833 41680 6 0.00958416
21-28214244-C-T p.Pro381Pro synonymous ADAMTS1 7 83358 8.39751E-5 41679 0 9.55353E-5
21-28214244-C-G p.Pro381Pro synonymous ADAMTS1 2 83358 2.39929E-5 41679 0 NA
21-28214244-C-A p.Pro381Pro synonymous ADAMTS1 1 83358 1.19964E-5 41679 0 NA
21-28214245-G-A p.Pro381Leu missense ADAMTS1 2 83354 2.3994E-5 41677 0 3.97731E-6
21-28214248-T-A p.Asp380Val missense ADAMTS1 1 83362 1.19959E-5 41681 0 NA
21-28214255-C-A p.Val378Leu missense ADAMTS1 4 83350 4.79904E-5 41675 0 0.001875
21-28214257-G-T p.Thr377Asn missense ADAMTS1 2 83356 2.39935E-5 41678 0 NA
21-28214272-A-G p.Met372Thr missense ADAMTS1 1 83356 1.19967E-5 41678 0 3.97788E-6
21-28214282-TATCA-T p.Cys367fs frameshift ADAMTS1 1 83342 1.19988E-5 41671 0 NA
21-28214290-GT-G p.Thr366fs frameshift ADAMTS1 1 83336 1.19996E-5 41668 0 NA
21-28214293-TGGGA-T p.Ser364fs frameshift ADAMTS1 1 83322 1.20016E-5 41661 0 NA
21-28214300-CACACAAGTCCTACAAAAAGCAAAGGTAAATA-C p.Asp360_Gly363del splice_acceptor ADAMTS1 1 83304 1.20042E-5 41652 0 NA
21-28214313-C-CA c.1078-5_1078-4insT splice_region ADAMTS1 445 83234 0.00534637 41617 5 0.00997896
21-28214316-A-G c.1078-7T>C splice_region ADAMTS1 2 83228 2.40304E-5 41614 0 3.34001E-5
21-28214651-C-T c.1077+7G>A splice_region ADAMTS1 190 82928 0.00229114 41464 0 0.00375748
21-28214653-C-G c.1077+5G>C splice_region ADAMTS1 1 82946 1.2056E-5 41473 0 4.00879E-6
21-28214675-T-C p.Ile354Val missense ADAMTS1 3 83148 3.60802E-5 41574 0 7.97029E-6
21-28214686-T-C p.Tyr350Cys missense ADAMTS1 2 83230 2.40298E-5 41615 0 1.19396E-5
21-28214688-G-A p.His349His synonymous ADAMTS1 2 83242 2.40263E-5 41621 0 3.97943E-6
21-28214688-G-C p.His349Gln missense ADAMTS1 1 83242 1.20132E-5 41621 0 NA
21-28214694-T-G p.Ala347Ala synonymous ADAMTS1 2 83248 2.40246E-5 41624 0 NA
21-28214701-C-T p.Arg345Gln missense ADAMTS1 10 83262 1.20103E-4 41631 0 1.27413E-4
21-28214702-G-A p.Arg345Trp missense ADAMTS1 3 83278 3.60239E-5 41639 0 1.19346E-4
21-28214708-T-C p.Ser343Gly missense ADAMTS1 1 83292 1.2006E-5 41646 0 8.27856E-6
21-28214710-G-T p.Pro342His missense ADAMTS1 2 83288 2.40131E-5 41644 0 NA
21-28214719-T-C p.His339Arg missense ADAMTS1 1 83298 1.20051E-5 41649 0 NA
21-28214723-G-T p.Gln338Lys missense ADAMTS1 1 83302 1.20045E-5 41651 0 NA
21-28214729-G-C p.Gln336Glu missense ADAMTS1 2 83322 2.40033E-5 41661 0 1.19311E-5
21-28214745-C-T p.Arg330Arg synonymous ADAMTS1 1 83328 1.20008E-5 41664 0 NA
21-28214777-C-T p.Glu320Lys missense ADAMTS1 1 83348 1.19979E-5 41674 0 NA
21-28214778-C-T p.Pro319Pro synonymous ADAMTS1 1 83352 1.19973E-5 41676 0 8.24484E-6
21-28214778-C-A p.Pro319Pro synonymous ADAMTS1 1 83352 1.19973E-5 41676 0 1.64897E-5
21-28214779-G-A p.Pro319Leu missense ADAMTS1 9 83348 1.07981E-4 41674 0 5.03525E-4
21-28214784-C-T p.Lys317Lys synonymous ADAMTS1 1 83354 1.1997E-5 41677 0 3.97687E-6
21-28214792-C-T p.Glu315Lys missense ADAMTS1 2 83362 2.39917E-5 41681 0 2.47268E-5
21-28214797-T-C p.His313Arg missense ADAMTS1 2 83364 2.39912E-5 41682 0 7.95355E-6
21-28214805-C-A p.Leu310Phe missense ADAMTS1 1 83372 1.19944E-5 41686 0 NA
21-28214811-C-A p.Lys308Asn missense ADAMTS1 1 83368 1.1995E-5 41684 0 4.94397E-5
21-28214817-C-G p.Val306Val synonymous ADAMTS1 1 83372 1.19944E-5 41686 0 NA
21-28214819-C-T p.Val306Met missense ADAMTS1 1 83372 1.19944E-5 41686 0 3.97671E-6
21-28214820-C-T p.Val305Val synonymous ADAMTS1 6 83372 7.19666E-5 41686 0 1.27372E-4
21-28214838-A-G p.Arg299Arg synonymous ADAMTS1 5 83368 5.9975E-5 41684 0 1.98829E-4
21-28214839-C-T p.Arg299His missense ADAMTS1 1 83368 1.1995E-5 41684 0 8.23873E-6
21-28214840-G-T p.Arg299Ser missense ADAMTS1 1 83360 1.19962E-5 41680 0 8.23873E-6
21-28214850-G-A p.His295His synonymous ADAMTS1 6 83336 7.19977E-5 41668 0 1.64785E-5
21-28214863-C-G p.Arg291Thr missense ADAMTS1 1 83296 1.20054E-5 41648 0 NA
21-28214867-C-T p.Ala290Thr missense ADAMTS1 1 83282 1.20074E-5 41641 0 8.24198E-5
21-28214874-C-G p.Ser287Ser synonymous ADAMTS1 12 83234 1.44172E-4 41617 0 1.31363E-4
21-28214874-C-T p.Ser287Ser synonymous ADAMTS1 1 83234 1.20143E-5 41617 0 1.64913E-5
21-28214883-C-T p.Thr284Thr synonymous ADAMTS1 2 83214 2.40344E-5 41607 0 3.1839E-5
21-28214884-G-A p.Thr284Met missense ADAMTS1 1 83194 1.20201E-5 41597 0 3.18492E-5
21-28214884-G-C p.Thr284Arg missense ADAMTS1 1 83194 1.20201E-5 41597 0 NA
21-28214898-C-T p.Lys279Lys synonymous ADAMTS1 14 83042 1.68589E-4 41521 0 0.00125
21-28214906-C-T p.Gly277Ser missense ADAMTS1 2 82830 2.41458E-5 41415 0 1.65519E-5
21-28214907-A-G p.Ser276Ser synonymous ADAMTS1 2 82784 2.41593E-5 41392 0 NA
21-28214910-GC-TT p.Gly275Glu missense ADAMTS1 14 82678 1.69332E-4 41339 0 NA
21-28214910-G-T p.Gly275Gly synonymous ADAMTS1 1 82678 1.20951E-5 41339 0 5.09814E-4
21-28214911-C-T p.Gly275Asp missense ADAMTS1 1 82614 1.21045E-5 41307 0 5.09716E-4
21-28214912-C-A p.Gly275Cys missense ADAMTS1 1 82592 1.21077E-5 41296 0 NA
21-28214912-C-G p.Gly275Arg missense ADAMTS1 2 82592 2.42154E-5 41296 0 NA
21-28214913-G-A p.His274His synonymous ADAMTS1 1 82568 1.21112E-5 41284 0 7.99533E-6
21-28214926-A-G p.Met270Thr missense ADAMTS1 30 81996 3.65871E-4 40998 0 4.14065E-4
21-28214929-G-A p.Ser269Leu missense ADAMTS1 3 81766 3.66901E-5 40883 0 6.63724E-5
21-28214934-G-T p.Asp267Glu missense ADAMTS1 1 81400 1.2285E-5 40700 0 5.03525E-4
21-28214957-C-T p.Val260Met missense ADAMTS1 1 79734 1.25417E-5 39867 0 8.32834E-6
21-28214960-A-G p.Tyr259His missense ADAMTS1 1 79430 1.25897E-5 39715 0 8.33306E-6
21-28214962-C-T p.Arg258His missense ADAMTS1 2 78886 2.5353E-5 39443 0 1.66733E-5
21-28214963-G-T p.Arg258Ser missense ADAMTS1 2 78868 2.53588E-5 39434 0 NA
21-28214966-G-C p.His257Asp missense ADAMTS1 1 78462 1.2745E-5 39231 0 4.04655E-6
21-28214974-A-T p.Val254Glu missense ADAMTS1 2 77112 2.59363E-5 38556 0 3.18512E-4
21-28214981-GCTT-G p.Lys251del conservative_inframe_deletion ADAMTS1 1 74832 1.33633E-5 37416 0 NA
21-28214985-C-T p.Lys250Lys synonymous ADAMTS1 1 73976 1.35179E-5 36988 0 3.18634E-5
21-28214993-T-G p.Ile248Leu missense ADAMTS1 1 71692 1.39486E-5 35846 0 NA
21-28214994-G-A p.Ser247Ser synonymous ADAMTS1 1 71080 1.40687E-5 35540 0 8.42787E-5
21-28215312-A-G c.-60T>C 5_prime_UTR_premature_start_codon_gain ADAMTS1 1 5374 1.86081E-4 2687 0 6.37146E-5
21-28215778-A-G c.73+7T>C splice_region ADAMTS1 1 53362 1.87399E-5 26681 0 NA
21-28215781-G-A c.73+4C>T splice_region ADAMTS1 1 53360 1.87406E-5 26680 0 1.54121E-5
21-28215791-G-C p.His23Asp missense ADAMTS1 2 53354 3.74855E-5 26677 0 7.57507E-6
21-28215823-G-GCA p.Ala12fs frameshift ADAMTS1 1 53356 1.8742E-5 26678 0 NA
21-28215823-G-A p.Ala12Val missense ADAMTS1 1 53356 1.8742E-5 26678 0 NA
21-28215826-C-CACA p.Leu10dup conservative_inframe_insertion ADAMTS1 39847 53154 0.749652 26577 15120 0.784085
21-28215834-AG-A p.Pro8fs frameshift ADAMTS1 1 53338 1.87484E-5 26669 0 8.72905E-5
21-28215836-GC-G p.Pro8fs frameshift ADAMTS1 39790 53042 0.75016 26521 15122 0.783323
21-28215837-C-A p.Arg7Arg synonymous ADAMTS1 1 26504 3.77302E-5 13252 0 3.29056E-5
21-28215848-A-G p.Phe4Leu missense ADAMTS1 1 53342 1.8747E-5 26671 0 NA
21-28215853-C-A p.Arg2Leu missense ADAMTS1 1 53342 1.8747E-5 26671 0 NA
21-28215854-G-C p.Arg2Gly missense ADAMTS1 1 53340 1.87477E-5 26670 0 NA
21-28215856-C-T p.Cys1Tyr missense ADAMTS1 1 53340 1.87477E-5 26670 0 NA
21-28216053-C-T c.16+8G>A splice_region ADAMTS1 1 53342 1.8747E-5 26671 0 1.11786E-4
21-28216054-A-G c.16+7T>C splice_region ADAMTS1 2 53340 3.74953E-5 26670 0 3.18552E-5
21-28216059-A-G c.16+2T>C splice_donor ADAMTS1 11530 53096 0.217154 26548 1273 0.233163
21-28216066-C-T p.Trp4* stop_gained ADAMTS1 39644 52942 0.748819 26471 15042 0.786074
21-28216541-T-C c.730+3A>G splice_region ADAMTS1 2 77474 2.58151E-5 38737 0 NA
21-28216567-A-G p.Leu236Pro missense ADAMTS1 16 78210 2.04577E-4 39105 0 8.84964E-5
21-28216571-C-T p.Ala235Thr missense ADAMTS1 1 78200 1.27877E-5 39100 0 2.05749E-5
21-28216584-C-T p.Ser230Ser synonymous ADAMTS1 1 78198 1.27881E-5 39099 0 4.50897E-6
21-28216585-G-A p.Ser230Leu missense ADAMTS1 2 78230 2.55656E-5 39115 0 4.49895E-6
21-28216594-GCCCCTTC-G p.Glu225fs frameshift ADAMTS1 1 78682 1.27094E-5 39341 0 1.91205E-4
21-28216595-C-G p.Ala227Pro missense ADAMTS1 54057 74054 0.729967 37027 20051 0.786321
21-28216595-CC-GT p.GlyAla226GlyPro missense ADAMTS1 4 78656 5.08544E-5 39328 0 NA
21-28216595-C-A p.Ala227Ser missense ADAMTS1 2 78656 2.54272E-5 39328 0 1.88487E-5
21-28216596-C-T p.Gly226Gly synonymous ADAMTS1 13 78724 1.65134E-4 39362 0 0.00100705
21-28216598-C-T p.Gly226Arg missense ADAMTS1 5 78916 6.33585E-5 39458 0 1.45524E-4
21-28216602-GTCCTCGCCCTCAGT-G p.Thr220fs frameshift ADAMTS1 1 78898 1.26746E-5 39449 0 1.91131E-4
21-28216607-C-G p.Glu223Gln missense ADAMTS1 4 79096 5.05715E-5 39548 0 4.25887E-5
21-28216609-C-T p.Gly222Asp missense ADAMTS1 4 79216 5.04949E-5 39608 0 2.12148E-5
21-28216613-C-T p.Glu221Lys missense ADAMTS1 4 79370 5.03969E-5 39685 0 1.59286E-4
21-28216619-C-T p.Gly219Arg missense ADAMTS1 4 79492 5.03195E-5 39746 0 0.0025
21-28216622-C-T p.Glu218Lys missense ADAMTS1 2 79502 2.51566E-5 39751 0 4.20214E-6
21-28216623-G-A p.Asp217Asp synonymous ADAMTS1 1 79430 1.25897E-5 39715 0 1.07089E-5
21-28216627-T-A p.Glu216Val missense ADAMTS1 2 79522 2.51503E-5 39761 0 NA
21-28216635-G-A p.Thr213Thr synonymous ADAMTS1 2 79434 2.51781E-5 39717 0 6.37755E-5
21-28216636-G-C p.Thr213Ser missense ADAMTS1 2 79470 2.51667E-5 39735 0 7.20162E-5
21-28216642-G-T p.Ala211Glu missense ADAMTS1 11 79470 1.38417E-4 39735 0 1.10171E-4
21-28216649-C-T p.Gly209Arg missense ADAMTS1 2 79536 2.51458E-5 39768 0 1.12002E-5
21-28216651-G-A p.Thr208Ile missense ADAMTS1 1 79374 1.25986E-5 39687 0 NA
21-28216655-G-T p.Pro207Thr missense ADAMTS1 4 79078 5.0583E-5 39539 0 6.25E-4
21-28216658-G-A p.Arg206Trp missense ADAMTS1 1 79080 1.26454E-5 39540 0 NA
21-28216659-G-T p.Pro205Pro synonymous ADAMTS1 20 79096 2.52857E-4 39548 0 1.89926E-4
21-28216662-C-T p.Glu204Glu synonymous ADAMTS1 1 78870 1.26791E-5 39435 0 5.05561E-4
21-28216664-C-T p.Glu204Lys missense ADAMTS1 4 78720 5.0813E-5 39360 0 3.18796E-5
21-28216665-G-A p.Asp203Asp synonymous ADAMTS1 3 78464 3.82341E-5 39232 0 6.07002E-5
21-28216667-C-A p.Asp203Tyr missense ADAMTS1 1 78444 1.27479E-5 39222 0 2.43659E-5
21-28216668-G-T p.Asp202Glu missense ADAMTS1 2 78346 2.55278E-5 39173 0 5.06586E-4
21-28216674-G-C p.Val200Val synonymous ADAMTS1 13362 77376 0.172689 38688 1255 0.228001
21-28216679-C-A p.Gly199Trp missense ADAMTS1 1 78330 1.27665E-5 39165 0 NA
21-28216691-C-T p.Gly195Ser missense ADAMTS1 1 78126 1.27998E-5 39063 0 NA
21-28216692-G-T p.Val194Val synonymous ADAMTS1 53269 73558 0.724177 36779 19580 0.777359
21-28216695-G-C p.Asp193Glu missense ADAMTS1 1 77802 1.28531E-5 38901 0 3.18613E-5
21-28216697-C-T p.Asp193Asn missense ADAMTS1 1 77996 1.28212E-5 38998 0 4.92388E-6
21-28216701-C-T p.Gln191Gln synonymous ADAMTS1 3 78620 3.81582E-5 39310 0 1.24347E-4
21-28216719-G-A p.Leu185Leu synonymous ADAMTS1 8 78432 1.01999E-4 39216 0 3.18695E-5
21-28216721-G-C p.Leu185Val missense ADAMTS1 1 78422 1.27515E-5 39211 0 NA
21-28216725-G-T p.Phe183Leu missense ADAMTS1 1 78402 1.27548E-5 39201 0 1.86185E-5
21-28216725-G-A p.Phe183Phe synonymous ADAMTS1 1 78402 1.27548E-5 39201 0 NA
21-28216729-T-C p.Gln182Arg missense ADAMTS1 2 78438 2.54978E-5 39219 0 NA
21-28216734-T-C p.Pro180Pro synonymous ADAMTS1 1 78388 1.27571E-5 39194 0 NA
21-28216736-G-T p.Pro180Thr missense ADAMTS1 1 78272 1.2776E-5 39136 0 1.95442E-5
21-28216743-C-A p.Pro177Pro synonymous ADAMTS1 1 78014 1.28182E-5 39007 0 5.03054E-6
21-28216744-G-A p.Pro177Leu missense ADAMTS1 2 78126 2.55997E-5 39063 0 2.02429E-5
21-28216745-G-A p.Pro177Ser missense ADAMTS1 1 78138 1.27979E-5 39069 0 NA
21-28216751-C-A p.Glu175* stop_gained ADAMTS1 1 78166 1.27933E-5 39083 0 NA
21-28216752-C-T p.Gly174Gly synonymous ADAMTS1 1 78180 1.2791E-5 39090 0 NA
21-28216770-G-A p.Leu168Leu synonymous ADAMTS1 3 77912 3.8505E-5 38956 0 9.9687E-6
21-28216791-C-T p.Leu161Leu synonymous ADAMTS1 238 77796 0.00305928 38898 2 0.0150188
21-28216792-A-G p.Leu161Pro missense ADAMTS1 1 77866 1.28426E-5 38933 0 NA
21-28216795-G-C p.Pro160Arg missense ADAMTS1 1 77936 1.2831E-5 38968 0 2.14795E-5
21-28216800-G-A p.Ile158Ile synonymous ADAMTS1 1 78122 1.28005E-5 39061 0 NA
21-28216802-T-G p.Ile158Leu missense ADAMTS1 1 78128 1.27995E-5 39064 0 NA
21-28216810-G-C p.Ala155Gly missense ADAMTS1 10 78110 1.28025E-4 39055 0 0.00153531
21-28216821-C-T p.Leu151Leu synonymous ADAMTS1 2 78382 2.55161E-5 39191 0 NA
21-28216825-T-C p.Tyr150Cys missense ADAMTS1 2 78444 2.54959E-5 39222 0 5.90993E-5
21-28216830-G-C p.Ala148Ala synonymous ADAMTS1 1 78620 1.27194E-5 39310 0 1.8882E-5
21-28216850-A-C p.Cys142Gly missense ADAMTS1 1 78962 1.26643E-5 39481 0 8.46998E-5
21-28216851-G-C p.Leu141Leu synonymous ADAMTS1 1 79034 1.26528E-5 39517 0 8.42744E-5
21-28216859-G-A p.Leu139Phe missense ADAMTS1 1 79352 1.26021E-5 39676 0 3.18674E-5
21-28216862-C-A p.Ala138Ser missense ADAMTS1 96 79268 0.00121108 39634 0 0.00133219
21-28216863-G-C p.Ala137Ala synonymous ADAMTS1 3 79450 3.77596E-5 39725 0 2.17431E-5
21-28216863-G-T p.Ala137Ala synonymous ADAMTS1 2 79450 2.51731E-5 39725 0 8.69724E-6
21-28216863-G-A p.Ala137Ala synonymous ADAMTS1 1 79450 1.25865E-5 39725 0 4.34862E-6
21-28216867-G-A p.Ala136Val missense ADAMTS1 2 79854 2.50457E-5 39927 0 6.37308E-5
21-28216869-C-G p.Ser135Ser synonymous ADAMTS1 3 79880 3.75563E-5 39940 0 1.41884E-5
21-28216871-A-C p.Ser135Ala missense ADAMTS1 4 79910 5.00563E-5 39955 0 0.0010142
21-28216873-C-T p.Ser134Asn missense ADAMTS1 1 80012 1.24981E-5 40006 0 NA
21-28216876-G-A p.Pro133Leu missense ADAMTS1 2 80210 2.49345E-5 40105 0 4.19143E-6
21-28216877-G-C p.Pro133Ala missense ADAMTS1 1 80264 1.24589E-5 40132 0 NA
21-28216884-A-C p.Asn130Lys missense ADAMTS1 2 80432 2.48657E-5 40216 0 1.28989E-5
21-28216887-C-T p.Val129Val synonymous ADAMTS1 3 80478 3.72773E-5 40239 0 1.28057E-5
21-28216890-G-C p.Thr128Thr synonymous ADAMTS1 6 80458 7.45731E-5 40229 0 0.00125
21-28216890-G-A p.Thr128Thr synonymous ADAMTS1 1 80460 1.24285E-5 40230 0 3.18695E-5
21-28216891-G-A p.Thr128Ile missense ADAMTS1 2 80470 2.4854E-5 40235 0 NA
21-28216892-T-C p.Thr128Ala missense ADAMTS1 2 80454 2.48589E-5 40227 0 3.77786E-5
21-28216896-G-A p.Ser126Ser synonymous ADAMTS1 3 80494 3.72699E-5 40247 1 8.28981E-6
21-28216902-G-C p.Phe124Leu missense ADAMTS1 1 80580 1.241E-5 40290 0 2.48201E-5
21-28216907-AGTGCGCCAG-A p.Leu120_His122del conservative_inframe_deletion ADAMTS1 2 80584 2.48188E-5 40292 0 NA
21-28216907-A-G p.Cys123Arg missense ADAMTS1 1 80584 1.24094E-5 40292 0 4.13107E-6
21-28216911-C-A p.Ala121Ala synonymous ADAMTS1 5 80514 6.2101E-5 40257 0 1.00175E-4
21-28216912-G-A p.Ala121Val missense ADAMTS1 1 80534 1.24171E-5 40267 0 1.25276E-5
21-28216913-C-A p.Ala121Ser missense ADAMTS1 1 80518 1.24196E-5 40259 0 NA
21-28216919-C-G p.Asp119His missense ADAMTS1 2 80532 2.48348E-5 40266 0 4.99442E-5
21-28216919-C-T p.Asp119Asn missense ADAMTS1 1 80532 1.24174E-5 40266 0 4.16202E-6
21-28216927-G-A p.Pro116Leu missense ADAMTS1 1 80492 1.24236E-5 40246 0 NA
21-28216939-T-C p.Glu112Gly missense ADAMTS1 1 80412 1.2436E-5 40206 0 4.22654E-6
21-28216940-C-G p.Glu112Gln missense ADAMTS1 1 80390 1.24394E-5 40195 0 8.47501E-6
21-28216941-G-C p.Ser111Ser synonymous ADAMTS1 5 80380 6.22045E-5 40190 0 2.55086E-4
21-28216942-G-A p.Ser111Phe missense ADAMTS1 1 80380 1.24409E-5 40190 0 NA
21-28216952-T-G p.Lys108Gln missense ADAMTS1 1 80272 1.24576E-5 40136 0 NA
21-28216955-G-T p.Arg107Ser missense ADAMTS1 1 80184 1.24713E-5 40092 0 NA
21-28216962-G-C p.Asn104Lys missense ADAMTS1 5 80134 6.23955E-5 40067 0 6.27353E-4
21-28216968-G-A p.Leu102Leu synonymous ADAMTS1 2 80074 2.49769E-5 40037 0 1.61233E-5
21-28216970-G-A p.Leu102Phe missense ADAMTS1 2 80024 2.49925E-5 40012 0 4.49624E-6
21-28216977-G-T p.Gly99Gly synonymous ADAMTS1 2 79844 2.50488E-5 39922 0 NA
21-28216984-G-T p.Ala97Glu missense ADAMTS1 1 79728 1.25426E-5 39864 0 4.62411E-6
21-28216988-A-G p.Leu96Leu synonymous ADAMTS1 1 79728 1.25426E-5 39864 0 NA
21-28216996-C-T p.Ser93Asn missense ADAMTS1 2 79566 2.51364E-5 39783 0 NA
21-28217001-G-T p.Pro91Pro synonymous ADAMTS1 1 79358 1.26011E-5 39679 0 NA
21-28217004-C-T p.Arg90Arg synonymous ADAMTS1 1 79106 1.26413E-5 39553 0 NA
21-28217009-G-A p.Leu89Leu synonymous ADAMTS1 1 79070 1.2647E-5 39535 0 1.67476E-4
21-28217018-C-A p.Asp86Tyr missense ADAMTS1 2 78938 2.53363E-5 39469 0 NA
21-28217023-T-C p.Gln84Arg missense ADAMTS1 1 78788 1.26923E-5 39394 0 NA
21-28217034-G-A p.Ala80Ala synonymous ADAMTS1 6 78602 7.63339E-5 39301 0 6.25782E-4
21-28217043-G-T p.Arg77Arg synonymous ADAMTS1 1 78262 1.27776E-5 39131 0 2.6356E-5
21-28217044-C-T p.Arg77His missense ADAMTS1 13 78202 1.66236E-4 39101 0 1.85657E-4
21-28217045-G-A p.Arg77Cys missense ADAMTS1 2 78258 2.55565E-5 39129 0 2.71076E-5
21-28217054-T-C p.Thr74Ala missense ADAMTS1 1 78092 1.28054E-5 39046 0 NA
21-28217055-G-T p.Thr73Thr synonymous ADAMTS1 1 78130 1.27992E-5 39065 0 NA
21-28217059-C-T p.Gly72Glu missense ADAMTS1 586 78062 0.00750685 39031 3 0.0164198
21-28217060-C-G p.Gly72Arg missense ADAMTS1 4 78106 5.12125E-5 39053 0 8.7628E-5
21-28217064-T-C p.Gly70Gly synonymous ADAMTS1 3 77956 3.84832E-5 38978 0 9.88794E-5
21-28217068-G-C p.Pro69Arg missense ADAMTS1 2 77982 2.56469E-5 38991 0 6.37959E-5
21-28217082-C-T p.Glu64Glu synonymous ADAMTS1 1 77680 1.28733E-5 38840 0 NA
21-28217103-GTCC-G p.Glu56del disruptive_inframe_deletion ADAMTS1 1 76810 1.30191E-5 38405 0 NA
21-28217108-C-T p.Glu56Lys missense ADAMTS1 1 76524 1.30678E-5 38262 0 NA
21-28217109-C-T p.Glu55Glu synonymous ADAMTS1 30 76376 3.92794E-4 38188 0 0.00256937
21-28217114-A-T p.Ser54Thr missense ADAMTS1 1 75924 1.31711E-5 37962 0 NA
21-28217116-G-C p.Pro53Arg missense ADAMTS1 7 75726 9.24385E-5 37863 0 5.87356E-4
21-28217117-G-T p.Pro53Thr missense ADAMTS1 1 75516 1.32422E-5 37758 0 3.19101E-5
21-28217167-A-G p.Leu36Pro missense ADAMTS1 2 71274 2.80607E-5 35637 0 3.73692E-5
21-28217178-T-G p.Pro32Pro synonymous ADAMTS1 41816 59616 0.701422 29808 14860 0.787304
21-28217181-C-T p.Gly31Gly synonymous ADAMTS1 1 69482 1.43922E-5 34741 0 3.19122E-5
21-28217183-C-T p.Gly31Arg missense ADAMTS1 3 69406 4.32239E-5 34703 0 4.25706E-4
21-28217194-G-A p.Ser27Phe missense ADAMTS1 1 67878 1.47323E-5 33939 0 NA
21-28217201-G-C p.Pro25Ala missense ADAMTS1 1 66794 1.49714E-5 33397 0 NA
21-28217206-C-T p.Arg23Gln missense ADAMTS1 2 65848 3.0373E-5 32924 0 4.47201E-5
21-28217207-G-A p.Arg23Trp missense ADAMTS1 2 65490 3.0539E-5 32745 0 1.47885E-5
21-28217208-C-T p.Glu22Glu synonymous ADAMTS1 1 65614 1.52407E-5 32807 0 NA
21-28217213-C-T p.Ala21Thr missense ADAMTS1 1 64538 1.54947E-5 32269 0 1.27649E-4
21-28217239-C-T p.Arg12His missense ADAMTS1 1 59566 1.67881E-5 29783 0 NA
21-28217240-G-A p.Arg12Cys missense ADAMTS1 1 59442 1.68231E-5 29721 0 NA
21-28217242-C-T p.Arg11Lys missense ADAMTS1 1 59314 1.68594E-5 29657 0 NA
21-28217252-C-T p.Gly8Arg missense ADAMTS1 1 57132 1.75033E-5 28566 0 1.1381E-5
21-28217256-G-C p.Pro6Pro synonymous ADAMTS1 1 56040 1.78444E-5 28020 0 1.13199E-5
21-28217265-T-C p.Arg3Arg synonymous ADAMTS1 2 54374 3.67823E-5 27187 0 NA
21-28217266-C-T p.Arg3Gln missense ADAMTS1 2 54106 3.69645E-5 27053 0 1.90738E-5
21-28217269-T-G p.Gln2Pro missense ADAMTS1 2 53976 3.70535E-5 26988 0 NA
21-28217273-T-C p.Met1? start_lost ADAMTS1 1 53426 1.87175E-5 26713 0 6.25782E-4
21-28217435-G-A c.-162C>T 5_prime_UTR_premature_start_codon_gain ADAMTS1 97 27658 0.00350712 13829 0 1.59286E-4
21-28217477-G-C c.-204C>G 5_prime_UTR_premature_start_codon_gain ADAMTS1 1 20742 4.82114E-5 10371 0 3.18552E-5