Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
10-135076668-C-T p.Ala823Thr missense ADAM8 1 83010 1.20467E-5 41505 0 NA
10-135076674-G-C p.Pro821Ala missense ADAM8 20 83026 2.40888E-4 41513 0 7.00771E-4
10-135076676-G-A p.Ala820Val missense ADAM8 11 83004 1.32524E-4 41502 0 5.04541E-4
10-135076677-C-A p.Ala820Ser missense ADAM8 51 83010 6.14384E-4 41505 1 5.04541E-4
10-135076678-T-C p.Gly819Gly synonymous ADAM8 2 83028 2.40883E-5 41514 0 8.44837E-6
10-135076681-G-A p.Ala818Ala synonymous ADAM8 54 83022 6.5043E-4 41511 1 0.00151515
10-135076687-T-C p.Gln816Gln synonymous ADAM8 1 83034 1.20433E-5 41517 0 NA
10-135076694-C-T p.Arg814Lys missense ADAM8 1 83040 1.20424E-5 41520 0 1.72102E-4
10-135076701-T-TG p.Ile812fs frameshift ADAM8 1 83004 1.20476E-5 41502 0 4.01007E-6
10-135076711-C-A p.Leu808Leu synonymous ADAM8 1 83010 1.20467E-5 41505 0 NA
10-135076712-A-C p.Leu808Arg missense ADAM8 1 82992 1.20494E-5 41496 0 NA
10-135076714-G-A p.Ala807Ala synonymous ADAM8 2 82982 2.41016E-5 41491 0 4.03089E-6
10-135076720-C-G p.Lys805Asn missense ADAM8 1 82966 1.20531E-5 41483 0 6.36983E-5
10-135076728-C-G p.Gly803Arg missense ADAM8 2 82930 2.41167E-5 41465 0 9.55475E-5
10-135076731-C-T p.Val802Ile missense ADAM8 1 82922 1.20595E-5 41461 0 NA
10-135076738-C-T c.*2-1G>A splice_acceptor ADAM8 2 82848 2.41406E-5 41424 0 NA
10-135076740-G-A c.*2-3C>T splice_region ADAM8 1 82828 1.20732E-5 41414 0 NA
10-135076741-G-A c.*2-4C>T splice_region ADAM8 1 82800 1.20773E-5 41400 0 NA
10-135076744-G-A c.*2-7C>T splice_region ADAM8 3 82758 3.62503E-5 41379 0 1.34137E-4
10-135077159-GTGGACTCTGCCTGGTGTGTGCTGGGGCCT-G c.*1+4_*1+32delAGGCCCCAGCACACACCAGGCAGAGTCCA splice_region ADAM8 1 80046 1.24928E-5 40023 0 NA
10-135077186-CCT-C c.*1+4_*1+5delAG splice_region ADAM8 21 80810 2.59869E-4 40405 0 7.01262E-4
10-135077186-C-T c.*1+6G>A splice_region ADAM8 1 80810 1.23747E-5 40405 0 7.07174E-6
10-135077192-CTCAGCTGG-C p.Ser741fs frameshift ADAM8 22 80906 2.7192E-4 40453 0 1.91058E-4
10-135077203-CAGGGTTGG-C p.Gln738fs frameshift ADAM8 22 81024 2.71524E-4 40512 0 2.61324E-4
10-135077214-G-A p.Ala792Val missense ADAM8 2 80986 2.46956E-5 40493 0 6.25782E-4
10-135077220-G-A p.Ala790Val missense ADAM8 1 81078 1.23338E-5 40539 0 NA
10-135077222-C-G p.Gly734Arg missense ADAM8 1 81068 1.23353E-5 40534 0 3.31807E-5
10-135077224-C-T p.Arg733Gln missense ADAM8 1 81074 1.23344E-5 40537 0 3.27289E-5
10-135077224-C-CG p.Arg733fs frameshift ADAM8 1 81074 1.23344E-5 40537 0 3.83347E-5
10-135077225-G-A p.Arg733Trp missense ADAM8 8 81080 9.8668E-5 40540 0 0.00130073
10-135077226-G-A p.Pro788Leu missense ADAM8 1 81108 1.23292E-5 40554 0 NA
10-135077233-C-G p.Ser730Thr missense ADAM8 1 81014 1.23435E-5 40507 0 1.12494E-4
10-135077238-G-A p.Pro784Leu missense ADAM8 1 81038 1.23399E-5 40519 0 5.18565E-6
10-135077243-T-TG p.Ser727fs frameshift ADAM8 3 81036 3.70206E-5 40518 0 2.99491E-5
10-135077243-T-C p.Ser727Gly missense ADAM8 1 81036 1.23402E-5 40518 0 2.09644E-4
10-135077246-G-A p.Pro726Ser missense ADAM8 1 81068 1.23353E-5 40534 0 NA
10-135077248-G-T p.Thr725Asn missense ADAM8 1 81040 1.23396E-5 40520 0 NA
10-135077251-C-T p.Arg724His missense ADAM8 74 80960 9.14032E-4 40480 0 0.00304878
10-135077251-C-G p.Arg724Pro missense ADAM8 5 80964 6.17558E-5 40482 0 8.92432E-5
10-135077252-G-A p.Arg724Cys missense ADAM8 4 80978 4.93961E-5 40489 0 5.91471E-5
10-135077256-G-A p.Thr778Met missense ADAM8 10 80974 1.23496E-4 40487 0 3.00833E-4
10-135077260-G-C p.Ala721Gly missense ADAM8 1 80996 1.23463E-5 40498 0 5.31898E-6
10-135077265-A-G p.Ile775Thr missense ADAM8 2737 80874 0.0338428 40437 264 0.0641467
10-135080872-C-T p.Arg768Gln missense ADAM8 8 81262 9.8447E-5 40631 0 0.00125
10-135080872-CG-C p.Pro712fs frameshift ADAM8 1 81262 1.23059E-5 40631 0 1.15417E-5
10-135080873-G-A p.Pro712Leu missense ADAM8 11 81286 1.35325E-4 40643 0 0.0015121
10-135080877-G-A p.His711Tyr missense ADAM8 1 81280 1.23031E-5 40640 0 3.18532E-5
10-135080886-A-T p.Ser708Thr missense ADAM8 2 81202 2.46299E-5 40601 0 2.22272E-5
10-135080899-G-A p.Pro759Leu missense ADAM8 1 81080 1.23335E-5 40540 0 3.18695E-5
10-135080905-G-C p.Ser757Cys missense ADAM8 1 81020 1.23426E-5 40510 0 NA
10-135080913-G-A p.His699Tyr missense ADAM8 2 80910 2.47188E-5 40455 0 8.35108E-6
10-135080916-C-T p.Gly698Ser missense ADAM8 6 80822 7.42372E-5 40411 0 1.27502E-4
10-135080928-G-A c.2087-7C>T splice_region ADAM8 1 80584 1.24094E-5 40292 0 NA
10-135081442-C-T p.Ala693Thr missense ADAM8 3 33820 8.87049E-5 16910 0 NA
10-135081443-G-A p.Pro748Leu missense ADAM8 1 33940 2.94638E-5 16970 0 NA
10-135081460-C-T p.Gly687Ser missense ADAM8 1 34438 2.90377E-5 17219 0 2.57599E-4
10-135081461-G-A p.Ser742Leu missense ADAM8 1 34614 2.889E-5 17307 0 2.50752E-4
10-135081464-G-T p.Ser741Tyr missense ADAM8 2 34768 5.75242E-5 17384 0 7.31351E-4
10-135081464-G-A p.Ser741Phe missense ADAM8 2 34768 5.75242E-5 17384 0 7.31351E-4
10-135081466-G-A p.Leu685Phe missense ADAM8 1 34838 2.87043E-5 17419 0 0.00265393
10-135081470-G-A p.Pro739Leu missense ADAM8 18 34992 5.14403E-4 17496 0 0.00938967
10-135081471-G-GGTGTC p.Pro683fs frameshift ADAM8 1 35040 2.85388E-5 17520 0 NA
10-135081476-C-T p.Arg737Gln missense ADAM8 1 35118 2.84754E-5 17559 0 0.00106045
10-135081477-G-A p.Arg737* stop_gained ADAM8 1 35190 2.84172E-5 17595 0 9.55962E-5
10-135081481-G-A p.Arg680Cys missense ADAM8 1 35362 2.82789E-5 17681 0 2.43072E-4
10-135081491-G-A p.Pro732Leu missense ADAM8 10 35756 2.79673E-4 17878 0 0.00285908
10-135081495-G-C p.Pro675Arg missense ADAM8 1 35938 2.78257E-5 17969 0 NA
10-135081506-A-G p.Val727Ala missense ADAM8 1 36186 2.7635E-5 18093 0 NA
10-135081519-G-T p.Pro667His missense ADAM8 1 36568 2.73463E-5 18284 0 NA
10-135081519-G-A p.Pro667Leu missense ADAM8 1 36568 2.73463E-5 18284 0 NA
10-135081521-C-A p.Gly722Val missense ADAM8 33 36540 9.0312E-4 18270 1 0.0109098
10-135081530-G-A p.Pro719Leu missense ADAM8 33 36870 8.95037E-4 18435 1 0.0113336
10-135081543-C-T p.Arg659Gln missense ADAM8 2 37050 5.39811E-5 18525 0 6.28931E-4
10-135081553-C-T p.Gly656Ser missense ADAM8 2 37186 5.37837E-5 18593 0 3.18878E-5
10-135081558-C-T p.Arg654His missense ADAM8 60 37188 0.00161342 18594 1 0.00691128
10-135081559-G-A p.Arg654Cys missense ADAM8 13 37208 3.49387E-4 18604 0 0.00335154
10-135081560-C-T p.Arg709His missense ADAM8 81 37198 0.00217754 18599 0 0.00488878
10-135081566-G-A p.Ala707Val missense ADAM8 1 37288 2.68183E-5 18644 0 NA
10-135081570-C-A p.Gly650Val missense+splice_region ADAM8 1 37164 2.69078E-5 18582 0 2.07297E-4
10-135081580-CAG-C p.Leu702fs frameshift ADAM8 6 37134 1.61577E-4 18567 0 9.38438E-4
10-135081583-G-C p.Pro701Pro synonymous ADAM8 2 37094 5.39171E-5 18547 0 0.00375469
10-135081594-G-A p.Arg698Cys missense ADAM8 2 36622 5.4612E-5 18311 0 8.83236E-5
10-135081618-C-T p.Val690Met missense ADAM8 2 36202 5.52456E-5 18101 0 0.00211786
10-135081619-G-A p.Asn689Asn synonymous ADAM8 2 36206 5.52395E-5 18103 0 9.28678E-5
10-135081624-T-TG c.2064-3_2064-2insC splice_region ADAM8 68 36104 0.00188345 18052 0 0.0013446
10-135082246-C-T c.2063+6G>A splice_region ADAM8 7 82128 8.52328E-5 41064 0 9.55657E-5
10-135082250-A-G c.2063+2T>C splice_donor ADAM8 1 82114 1.21782E-5 41057 0 NA
10-135082254-G-A p.Ser687Ser splice_region+synonymous ADAM8 2 82222 2.43244E-5 41111 0 4.07505E-6
10-135082265-G-A p.Arg684Cys missense ADAM8 1 82344 1.21442E-5 41172 0 0.00100705
10-135082270-C-T p.Arg682Gln missense ADAM8 1 82394 1.21368E-5 41197 0 3.18613E-5
10-135082271-G-A p.Arg682Trp missense ADAM8 2 82386 2.4276E-5 41193 0 5.4021E-5
10-135082273-G-T p.Ala681Asp missense ADAM8 1 82402 1.21356E-5 41201 0 1.24951E-4
10-135082279-C-T p.Arg679His missense ADAM8 10 82498 1.21215E-4 41249 0 3.50452E-4
10-135082280-G-A p.Arg679Cys missense ADAM8 5 82528 6.05855E-5 41264 0 6.3743E-5
10-135082283-A-AGAC p.Val677dup conservative_inframe_insertion ADAM8 1 82544 1.21148E-5 41272 0 NA
10-135082286-C-T p.Val677Ile missense ADAM8 3 82540 3.6346E-5 41270 0 5.2518E-5
10-135082286-C-G p.Val677Leu missense ADAM8 1 82540 1.21153E-5 41270 0 1.74131E-5
10-135082287-G-T p.Ile676Ile synonymous ADAM8 1 82574 1.21103E-5 41287 0 4.04076E-6
10-135082294-C-T p.Gly674Asp missense ADAM8 1 82566 1.21115E-5 41283 0 8.62322E-6
10-135082296-T-C p.Ala673Ala synonymous ADAM8 2 82548 2.42283E-5 41274 0 8.60644E-6
10-135082300-AG-A p.Leu672fs frameshift ADAM8 1 82578 1.21098E-5 41289 0 NA
10-135082313-C-G p.Val668Leu missense ADAM8 2 82602 2.42125E-5 41301 0 4.042E-6
10-135082318-G-A p.Ala666Val missense ADAM8 3 82592 3.63231E-5 41296 0 8.52559E-6
10-135082326-C-T p.Val663Val synonymous ADAM8 1 82542 1.2115E-5 41271 0 NA
10-135082327-A-G p.Val663Ala missense ADAM8 1 82564 1.21118E-5 41282 0 8.50962E-6
10-135082330-A-G p.Leu662Pro missense ADAM8 1 82540 1.21153E-5 41270 0 8.49935E-6
10-135082340-C-A p.Val659Leu missense ADAM8 3 82398 3.64087E-5 41199 0 6.37267E-5
10-135082343-C-T p.Val658Met missense ADAM8 8 82330 9.71699E-5 41165 0 3.18715E-5
10-135082344-G-A p.Phe657Phe synonymous ADAM8 4 82288 4.86098E-5 41144 0 6.25E-4
10-135082346-A-G p.Phe657Leu missense ADAM8 68749 81856 0.839877 40928 29104 0.888125
10-135082348-A-C p.Val656Gly missense ADAM8 1 82162 1.21711E-5 41081 0 NA
10-135082350-G-C p.Pro655Pro synonymous ADAM8 1 82124 1.21767E-5 41062 0 2.04671E-5
10-135082350-G-A p.Pro655Pro synonymous ADAM8 3 82124 3.65301E-5 41062 0 1.76997E-5
10-135082351-G-C p.Pro655Arg missense ADAM8 1 82154 1.21723E-5 41077 0 NA
10-135082359-C-A p.Gly652Gly synonymous ADAM8 1 81954 1.2202E-5 40977 0 NA
10-135082361-C-T p.Gly652Arg missense ADAM8 1 81898 1.22103E-5 40949 0 2.79966E-5
10-135082362-G-A p.Ser651Ser synonymous ADAM8 11 81774 1.34517E-4 40887 0 1.59347E-4
10-135082365-C-T p.Ala650Ala splice_region+synonymous ADAM8 3 81660 3.67377E-5 40830 0 5.03525E-4
10-135082366-G-A p.Ala650Val missense+splice_region ADAM8 1 81558 1.22612E-5 40779 0 2.0853E-5
10-135082372-G-A c.1949-6C>T splice_region ADAM8 9 81418 1.10541E-4 40709 0 3.18634E-5
10-135082942-G-C c.1948+7C>G splice_region ADAM8 1 57588 1.73647E-5 28794 0 6.56513E-5
10-135082944-C-T c.1948+5G>A splice_region ADAM8 9 57954 1.55296E-4 28977 0 8.2149E-5
10-135082953-G-A p.His648His synonymous ADAM8 1 59944 1.66822E-5 29972 0 4.51255E-6
10-135082954-T-A p.His648Leu missense ADAM8 1 60346 1.65711E-5 30173 0 3.18715E-5
10-135082965-C-T p.Leu644Leu synonymous ADAM8 7 62580 1.11857E-4 31290 0 3.6421E-5
10-135082967-G-A p.Leu644Leu synonymous ADAM8 1 62732 1.59408E-5 31366 0 NA
10-135082974-C-T p.Ala641Ala synonymous ADAM8 1 63156 1.58338E-5 31578 0 9.56328E-5
10-135082975-G-A p.Ala641Val missense ADAM8 2 63034 3.17289E-5 31517 0 NA
10-135082976-C-T p.Ala641Thr missense ADAM8 1 63152 1.58348E-5 31576 0 1.75013E-5
10-135082977-G-A p.Cys640Cys synonymous ADAM8 5 63256 7.90439E-5 31628 0 3.06637E-4
10-135082979-A-G p.Cys640Arg missense ADAM8 1 63606 1.57218E-5 31803 0 1.12849E-5
10-135082983-G-A p.Pro638Pro synonymous ADAM8 6 63826 9.40056E-5 31913 0 3.49846E-5
10-135082985-G-A p.Pro638Ser missense ADAM8 2 63814 3.13411E-5 31907 0 6.37471E-5
10-135082986-C-T p.Pro637Pro synonymous ADAM8 18 63756 2.82326E-4 31878 0 0.00303644
10-135082987-G-A p.Pro637Leu missense ADAM8 1 64056 1.56113E-5 32028 0 7.86694E-5
10-135082989-G-A p.Ala636Ala synonymous ADAM8 1 64054 1.56118E-5 32027 0 2.19776E-5
10-135082994-A-C p.Trp635Gly missense ADAM8 3 64412 4.65752E-5 32206 0 9.56145E-5
10-135082998-C-T p.Ala633Ala synonymous ADAM8 1 64778 1.54373E-5 32389 0 9.10498E-5
10-135082999-G-A p.Ala633Val missense ADAM8 3 64262 4.66839E-5 32131 0 2.2842E-5
10-135083001-G-A p.His632His synonymous ADAM8 1 64832 1.54245E-5 32416 0 3.43729E-5
10-135083014-TCCTGCTTGTGGTTGCACA-T p.Val622_Gln627del disruptive_inframe_deletion ADAM8 1 66192 1.51076E-5 33096 0 1.31836E-5
10-135083024-G-A p.His625Tyr missense ADAM8 13 66522 1.95424E-4 33261 0 6.69899E-4
10-135083033-C-T p.Val622Met missense+splice_region ADAM8 3 65976 4.54711E-5 32988 0 4.08578E-5
10-135083037-C-T c.1864-4G>A splice_region ADAM8 2 65356 3.06016E-5 32678 0 3.88903E-5
10-135083038-G-A c.1864-5C>T splice_region ADAM8 1 65402 1.52901E-5 32701 0 9.33376E-6
10-135083400-C-T c.1863+1G>A splice_donor ADAM8 1 70142 1.42568E-5 35071 0 NA
10-135083405-T-C p.His620Arg missense ADAM8 2 69790 2.86574E-5 34895 0 6.25E-4
10-135083434-G-A p.Ser610Ser synonymous ADAM8 10 64642 1.54698E-4 32321 0 1.91192E-4
10-135083445-C-T p.Val607Ile missense ADAM8 2 61472 3.25351E-5 30736 0 6.37389E-5
10-135083446-G-A p.His606His synonymous ADAM8 2 61030 3.27708E-5 30515 0 2.52955E-5
10-135083461-A-C p.Arg601Arg synonymous ADAM8 1 56684 1.76417E-5 28342 0 8.44067E-6
10-135083463-G-A p.Arg601Cys missense ADAM8 36 55946 6.43478E-4 27973 0 2.28006E-4
10-135083467-T-G p.Lys599Asn missense ADAM8 1 55054 1.8164E-5 27527 0 NA
10-135083470-C-A p.Trp598Cys missense ADAM8 11 54178 2.03034E-4 27089 0 0.001875
10-135083483-G-T c.1786-5C>A splice_region ADAM8 1 50970 1.96194E-5 25485 0 NA
10-135083484-G-A c.1786-6C>T splice_region ADAM8 11 50812 2.16484E-4 25406 2 1.02477E-4
10-135083856-G-A c.1785+8C>T splice_region ADAM8 1 81074 1.23344E-5 40537 0 4.18996E-6
10-135083861-C-T c.1785+3G>A splice_region ADAM8 3 81300 3.69004E-5 40650 0 6.25E-4
10-135083865-T-C p.Lys595Arg missense+splice_region ADAM8 1 81418 1.22823E-5 40709 0 0.001875
10-135083866-TC-T p.Lys595fs frameshift ADAM8 1 81428 1.22808E-5 40714 0 NA
10-135083870-T-C p.Pro593Pro synonymous ADAM8 3 81510 3.68053E-5 40755 0 NA
10-135083879-C-G p.Arg590Arg synonymous ADAM8 33 81686 4.03986E-4 40843 0 0.001875
10-135083880-C-T p.Arg590Gln missense ADAM8 19 81688 2.32592E-4 40844 0 0.00151057
10-135083881-G-A p.Arg590Trp missense ADAM8 43 81682 5.26432E-4 40841 0 8.28712E-4
10-135083890-C-G p.Glu587Gln missense ADAM8 7 81896 8.54743E-5 40948 0 7.74447E-5
10-135083890-C-T p.Glu587Lys missense ADAM8 4 81896 4.88424E-5 40948 0 6.25E-4
10-135083891-G-A p.Pro586Pro synonymous ADAM8 1 81858 1.22163E-5 40929 0 3.18674E-5
10-135083898-G-A p.Pro584Leu missense ADAM8 2 82132 2.4351E-5 41066 0 0.00125
10-135083902-C-T p.Glu583Lys missense ADAM8 2 82210 2.43279E-5 41105 0 3.4035E-5
10-135083906-C-A p.Ala581Ala synonymous ADAM8 1 82262 1.21563E-5 41131 0 8.49517E-6
10-135083907-G-A p.Ala581Val missense ADAM8 6 82204 7.29891E-5 41102 0 7.64188E-5
10-135083908-C-T p.Ala581Thr missense ADAM8 2 82276 2.43084E-5 41138 0 1.20617E-5
10-135083910-G-A p.Thr580Ile missense ADAM8 2 82306 2.42996E-5 41153 0 4.01826E-6
10-135083913-C-A p.Gly579Val missense ADAM8 26 82338 3.15772E-4 41169 1 6.69131E-4
10-135083916-T-G p.Asp578Ala missense ADAM8 1 82354 1.21427E-5 41177 0 NA
10-135083916-T-C p.Asp578Gly missense ADAM8 1 82354 1.21427E-5 41177 0 3.18735E-5
10-135083920-CTG-C p.Thr576fs frameshift ADAM8 3 82366 3.64228E-5 41183 0 1.20371E-5
10-135083930-C-T p.Ala573Ala synonymous ADAM8 1 82316 1.21483E-5 41158 0 6.25E-4
10-135083931-G-A p.Ala573Val missense ADAM8 2 82314 2.42972E-5 41157 0 8.43811E-5
10-135083932-C-T p.Ala573Thr missense ADAM8 2 82324 2.42943E-5 41162 0 8.43597E-6
10-135083933-G-A p.His572His synonymous ADAM8 8 82366 9.71275E-5 41183 0 4.46172E-4
10-135083947-C-T p.Val568Met missense ADAM8 2 82388 2.42754E-5 41194 0 2.00357E-5
10-135083948-G-A p.Ile567Ile synonymous ADAM8 1 82388 1.21377E-5 41194 0 6.25E-4
10-135083948-G-T p.Ile567Ile synonymous ADAM8 1 82388 1.21377E-5 41194 0 6.37349E-5
10-135083961-C-T p.Arg563His missense ADAM8 10 82306 1.21498E-4 41153 0 3.18735E-4
10-135083962-G-A p.Arg563Cys missense ADAM8 1 82282 1.21533E-5 41141 0 8.4273E-6
10-135083977-G-A p.Gln558* stop_gained ADAM8 2 82098 2.43611E-5 41049 0 3.18776E-5
10-135083982-C-T p.Gly556Asp missense ADAM8 1 82066 1.21853E-5 41033 0 NA
10-135083987-G-A p.Cys554Cys synonymous ADAM8 1 82034 1.21901E-5 41017 0 4.01674E-6
10-135083996-A-G p.Val551Val synonymous ADAM8 10 81928 1.22058E-4 40964 0 1.53547E-4
10-135083998-C-T p.Val551Ile missense ADAM8 1 81884 1.22124E-5 40942 0 3.18796E-5
10-135083999-G-A p.Gly550Gly synonymous ADAM8 1 81818 1.22222E-5 40909 0 8.55315E-6
10-135084003-C-T p.Cys549Tyr missense ADAM8 3 81780 3.66838E-5 40890 0 2.02344E-5
10-135084005-CAT-C p.Met548fs frameshift ADAM8 311 81734 0.00380503 40867 2 0.0040282
10-135084007-T-C p.Met548Val missense ADAM8 6 81654 7.34808E-5 40827 0 3.18979E-5
10-135084009-T-A p.Asp547Val missense ADAM8 1 81658 1.22462E-5 40829 0 3.18878E-5
10-135084012-G-A p.Ala546Val missense+splice_region ADAM8 1 81580 1.22579E-5 40790 0 NA
10-135084232-C-CAGA c.1634+7_1634+8insTCT splice_region ADAM8 67625 78074 0.866165 39037 29376 0.879237
10-135084244-A-G p.Tyr544His missense ADAM8 3 79852 3.75695E-5 39926 0 6.38407E-5
10-135084246-C-T p.Arg543Gln missense ADAM8 8 79920 1.001E-4 39960 0 1.276E-4
10-135084247-G-A p.Arg543Trp missense ADAM8 11 79974 1.37545E-4 39987 0 9.57121E-5
10-135084248-G-C p.Ser542Arg missense ADAM8 2 80066 2.49794E-5 40033 0 4.17042E-5
10-135084252-GC-G p.Ala541fs frameshift ADAM8 1 80210 1.24673E-5 40105 0 NA
10-135084253-C-T p.Ala541Thr missense ADAM8 1 80000 1.25E-5 40000 0 NA
10-135084260-G-GC p.Cys539fs frameshift ADAM8 1 80346 1.24462E-5 40173 0 NA
10-135084265-G-C p.Pro537Ala missense ADAM8 1 80546 1.24153E-5 40273 0 NA
10-135084265-G-A p.Pro537Ser missense ADAM8 1 80546 1.24153E-5 40273 0 8.2224E-6
10-135084276-T-C p.Tyr533Cys missense ADAM8 2 80818 2.4747E-5 40409 0 4.62629E-5
10-135084284-G-A p.Cys530Cys synonymous ADAM8 1 80872 1.23652E-5 40436 0 3.18939E-5
10-135084295-C-T p.Glu527Lys missense ADAM8 3 80914 3.70764E-5 40457 0 6.13512E-5
10-135084296-G-A p.Ala526Ala synonymous ADAM8 2 80876 2.47292E-5 40438 0 5.51734E-5
10-135084297-G-A p.Ala526Val missense ADAM8 1 80892 1.23622E-5 40446 0 NA
10-135084304-G-A p.Gln524* stop_gained ADAM8 25 80962 3.08787E-4 40481 0 0.00151822
10-135084306-CCACCTGTGGGACCAGAAGCGGGTTAGCCCTGGCAAGGCCTGCAGCCACCCTGCCAGGCCAGCTCTGTGCCCACTT-C p.Gly523del splice_acceptor ADAM8 8 80998 9.87679E-5 40499 0 NA
10-135084378-A-T c.1564+7T>A splice_region ADAM8 4 80820 4.94927E-5 40410 0 8.54569E-6
10-135084389-C-T p.Gly520Gly synonymous ADAM8 1 80970 1.23503E-5 40485 0 3.18674E-5
10-135084391-C-T p.Gly520Arg missense ADAM8 5 81078 6.1669E-5 40539 0 1.21278E-5
10-135084407-C-G p.Gln514His missense ADAM8 4 81522 4.90665E-5 40761 0 5.73541E-4
10-135084409-G-A p.Gln514* stop_gained ADAM8 2 81502 2.45393E-5 40751 0 8.49473E-6
10-135084423-G-A p.Pro509Leu missense ADAM8 6 81836 7.33174E-5 40918 0 1.69385E-5
10-135084430-C-T p.Ala507Thr missense ADAM8 3 81948 3.66086E-5 40974 0 2.53708E-5
10-135084432-C-G p.Gly506Ala missense ADAM8 1 81980 1.21981E-5 40990 0 3.18878E-5
10-135084433-C-T p.Gly506Arg missense ADAM8 2 82002 2.43896E-5 41001 0 2.53515E-5
10-135084434-G-A p.Asn505Asn synonymous ADAM8 3 82058 3.65595E-5 41029 0 2.53443E-5
10-135084440-G-A p.Cys503Cys synonymous ADAM8 1 82134 1.21752E-5 41067 0 1.20435E-5
10-135084447-C-T p.Gly501Asp missense ADAM8 28 82174 3.4074E-4 41087 0 0.00130731
10-135084450-C-T p.Gly500Glu missense ADAM8 2 82246 2.43173E-5 41123 0 1.68557E-5
10-135084451-C-T p.Gly500Arg missense ADAM8 2 82286 2.43055E-5 41143 0 1.20474E-5
10-135084452-G-A p.Ser499Ser synonymous ADAM8 4 82300 4.86027E-5 41150 0 1.68492E-5
10-135084461-C-T p.Thr496Thr synonymous ADAM8 78 82278 9.48006E-4 41139 0 0.005
10-135084462-G-A p.Thr496Met missense ADAM8 7 82298 8.50567E-5 41149 0 5.04032E-4
10-135084467-G-A p.Asn494Asn synonymous ADAM8 29 82356 3.5213E-4 41178 0 1.9267E-4
10-135084481-C-T p.Ala490Thr missense ADAM8 168 82344 0.00204022 41172 2 0.00484323
10-135084482-G-A p.Asp489Asp synonymous ADAM8 1 82360 1.21418E-5 41180 0 1.20538E-5
10-135084488-C-T p.Pro487Pro synonymous ADAM8 1 82322 1.21474E-5 41161 0 1.17683E-4
10-135084489-G-A p.Pro487Leu missense ADAM8 3 82294 3.64547E-5 41147 0 6.37592E-5
10-135084499-G-C p.Pro484Ala missense ADAM8 1 82298 1.2151E-5 41149 0 NA
10-135084504-C-T p.Arg482Gln missense ADAM8 3 82210 3.64919E-5 41105 0 2.5219E-5
10-135084505-G-A p.Arg482Trp missense ADAM8 9 82184 1.0951E-4 41092 0 5.04032E-4
10-135084508-C-T p.Gly481Ser missense ADAM8 2 82242 2.43185E-5 41121 0 3.18654E-5
10-135084509-G-A p.Asp480Asp synonymous ADAM8 29 82228 3.52678E-4 41114 2 0.00125
10-135084512-A-C p.Cys479Trp missense ADAM8 5 82212 6.08184E-5 41106 0 0.00100806
10-135084524-G-A p.Leu475Leu synonymous ADAM8 2 82122 2.4354E-5 41061 0 6.25E-4
10-135084533-CAT-C p.Met472fs frameshift ADAM8 9 82062 1.09673E-4 41031 0 4.02969E-5
10-135084533-C-A p.Met472Ile missense ADAM8 8 82062 9.74873E-5 41031 0 3.36508E-4
10-135084535-T-C p.Met472Val missense ADAM8 2 82028 2.43819E-5 41014 0 3.18837E-5
10-135084546-G-C p.Pro468Arg missense ADAM8 1 81708 1.22387E-5 40854 0 NA
10-135084549-C-T p.Arg467His missense ADAM8 3 81606 3.6762E-5 40803 0 0.00100705
10-135084550-G-A p.Arg467Cys missense ADAM8 5 81578 6.1291E-5 40789 0 6.73991E-5
10-135084565-C-A p.Ala462Ser missense ADAM8 3 81266 3.69158E-5 40633 0 0.00151057
10-135084567-G-A p.Pro461Leu missense ADAM8 3 81242 3.69267E-5 40621 0 2.53263E-5
10-135084567-G-C p.Pro461Arg missense ADAM8 1 81242 1.23089E-5 40621 0 NA
10-135084581-C-T c.1375-7G>A splice_region ADAM8 1 81184 1.23177E-5 40592 0 NA
10-135084698-A-G c.1374+6T>C splice_region ADAM8 1 81850 1.22175E-5 40925 0 3.70108E-5
10-135084706-TG-T p.Cys457fs frameshift ADAM8 1 81936 1.22046E-5 40968 0 4.08771E-6
10-135084708-C-T p.Cys457Tyr missense ADAM8 1 81924 1.22064E-5 40962 0 4.65125E-5
10-135084727-C-T p.Gly451Ser missense ADAM8 1 82032 1.21904E-5 41016 0 4.61774E-5
10-135084728-G-A p.His450His synonymous ADAM8 10 82044 1.21886E-4 41022 0 0.00151362
10-135084731-C-A p.Ala449Ala synonymous ADAM8 2 82024 2.43831E-5 41012 0 3.68874E-5
10-135084732-G-A p.Ala449Val missense ADAM8 46 82028 5.60784E-4 41014 0 5.05051E-4
10-135084732-G-T p.Ala449Glu missense ADAM8 1 82028 1.2191E-5 41014 0 4.05884E-6
10-135084736-A-G p.Cys448Arg missense ADAM8 2 82052 2.43748E-5 41026 0 NA
10-135084750-G-T p.Ala443Asp missense ADAM8 1 81996 1.21957E-5 40998 0 9.26595E-6
10-135084753-A-G p.Leu442Pro missense ADAM8 2 81984 2.4395E-5 40992 0 NA
10-135084757-G-A p.Gln441* stop_gained ADAM8 2 81944 2.44069E-5 40972 0 4.05387E-6
10-135084765-G-T p.Thr438Asn missense ADAM8 1 81976 1.21987E-5 40988 0 NA
10-135084780-C-T p.Arg433His missense ADAM8 3 81744 3.66999E-5 40872 0 1.22417E-5
10-135084780-C-A p.Arg433Leu missense ADAM8 1 81744 1.22333E-5 40872 0 4.08057E-6
10-135084781-G-A p.Arg433Cys missense ADAM8 910 81722 0.0111353 40861 30 0.0208559
10-135084785-C-T p.Arg431Arg synonymous ADAM8 9 81626 1.10259E-4 40813 0 0.00101317
10-135084787-G-A p.Arg431Trp missense ADAM8 2 81548 2.45254E-5 40774 0 9.56267E-5
10-135084787-GGCAGTCCTGGGGCGACGGCAAAGGCCTTGGCAGGCTGCACTGGGGCCGGGCTGGGCTCCAGGGCGGACCTGGCC-G p.Asp429_Arg431del splice_acceptor ADAM8 1 81548 1.22627E-5 40774 0 9.01891E-5
10-135084800-C-T c.1285-7G>A splice_region ADAM8 18 81058 2.22063E-4 40529 0 2.28743E-4
10-135084801-G-A c.1285-8C>T splice_region ADAM8 4 81024 4.93681E-5 40512 0 3.18776E-5
10-135085027-C-T c.1284+5G>A splice_region ADAM8 1 69350 1.44196E-5 34675 0 3.24844E-5
10-135085028-G-A c.1284+4C>T splice_region ADAM8 8 69240 1.1554E-4 34620 0 2.81849E-4
10-135085028-G-T c.1284+4C>A splice_region ADAM8 2 69240 2.8885E-5 34620 0 3.18857E-5
10-135085034-C-CG p.Glu428fs frameshift ADAM8 2 68684 2.91189E-5 34342 0 0.00264831
10-135085034-C-T p.Glu428Lys missense+splice_region ADAM8 2 68686 2.9118E-5 34343 0 2.64033E-5
10-135085035-G-A p.Pro427Pro synonymous ADAM8 1 68640 1.45688E-5 34320 0 3.19285E-5
10-135085036-G-C p.Pro427Arg missense ADAM8 3 68722 4.36541E-5 34361 0 1.97785E-4
10-135085036-G-T p.Pro427His missense ADAM8 2 68722 2.91028E-5 34361 0 NA
10-135085037-G-T p.Pro427Thr missense ADAM8 1 68564 1.45849E-5 34282 0 0.00315126
10-135085040-G-T p.Pro426Thr missense ADAM8 5 67932 7.3603E-5 33966 0 1.28657E-5
10-135085040-G-A p.Pro426Ser missense ADAM8 1 67932 1.47206E-5 33966 0 NA
10-135085044-G-A p.Cys424Cys synonymous ADAM8 1 67958 1.4715E-5 33979 0 6.38716E-6
10-135085047-G-A p.Asp423Asp synonymous ADAM8 16 68488 2.33618E-4 34244 0 1.91412E-4
10-135085049-C-T p.Asp423Asn missense ADAM8 1 68382 1.46237E-5 34191 0 1.25628E-5
10-135085050-G-A p.Cys422Cys synonymous ADAM8 2 68002 2.94109E-5 34001 0 0.00209424
10-135085050-G-C p.Cys422Trp missense ADAM8 2 68002 2.94109E-5 34001 0 1.87699E-5
10-135085064-G-A p.Arg418Cys missense ADAM8 2 67716 2.95351E-5 33858 0 3.19122E-5
10-135085067-C-T p.Glu417Lys missense ADAM8 1 68284 1.46447E-5 34142 0 NA
10-135085068-C-T p.Val416Val synonymous ADAM8 1 68324 1.46361E-5 34162 0 NA
10-135085074-C-A p.Leu414Leu synonymous ADAM8 1 68484 1.4602E-5 34242 0 NA
10-135085079-T-C p.Asn413Asp missense ADAM8 1 68216 1.46593E-5 34108 0 NA
10-135085083-A-T p.Cys411* stop_gained ADAM8 1 68416 1.46165E-5 34208 0 3.19142E-5
10-135085084-C-T p.Cys411Tyr missense ADAM8 1 68494 1.45998E-5 34247 0 1.86384E-5
10-135085088-C-T p.Val410Met missense ADAM8 203 68010 0.00298486 34005 0 0.0119543
10-135085088-CG-C p.Val410fs frameshift ADAM8 13 68024 1.91109E-4 34012 0 2.13927E-4
10-135085088-C-G p.Val410Leu missense ADAM8 1 68026 1.47003E-5 34013 0 6.37918E-5
10-135085095-G-A p.Gly407Gly synonymous ADAM8 4 67732 5.90563E-5 33866 0 9.57182E-5
10-135085104-G-T p.His404Gln missense ADAM8 4 68634 5.82802E-5 34317 0 3.18776E-5
10-135085110-G-C p.Leu402Leu synonymous ADAM8 1 68882 1.45176E-5 34441 0 NA
10-135085113-G-T p.Asp401Glu missense ADAM8 1 68940 1.45054E-5 34470 0 NA
10-135085121-C-T p.Ala399Thr missense ADAM8 3 69218 4.33413E-5 34609 0 6.29628E-5
10-135085122-G-A p.Asn398Asn synonymous ADAM8 15 69830 2.14807E-4 34915 0 4.19375E-4
10-135085128-G-A p.Leu396Leu synonymous ADAM8 1 70054 1.42747E-5 35027 0 3.18857E-5
10-135085132-C-T p.Cys395Tyr missense ADAM8 1 70072 1.4271E-5 35036 0 NA
10-135085134-C-T p.Val394Val synonymous ADAM8 1 70410 1.42025E-5 35205 0 6.30469E-6
10-135085138-G-A p.Ser393Leu missense ADAM8 8 70694 1.13164E-4 35347 0 1.20057E-4
10-135085143-C-A p.Pro391Pro synonymous ADAM8 1 71316 1.40221E-5 35658 0 3.19101E-5
10-135085147-C-T p.Arg390Gln missense ADAM8 6 71554 8.38528E-5 35777 0 1.27657E-4
10-135085148-G-C p.Arg390Gly missense ADAM8 3 71718 4.18305E-5 35859 0 NA
10-135085148-G-A p.Arg390Trp missense ADAM8 1 71716 1.39439E-5 35858 0 NA
10-135085158-G-T p.Ser386Arg missense ADAM8 1 72630 1.37684E-5 36315 0 NA
10-135085162-T-C p.Glu385Gly missense ADAM8 1 72826 1.37314E-5 36413 0 NA
10-135085166-G-C p.Leu384Val missense ADAM8 1 73100 1.36799E-5 36550 0 9.22594E-5
10-135085179-G-A p.Cys379Cys synonymous ADAM8 3 73226 4.09691E-5 36613 0 8.30427E-5
10-135085190-A-T p.Phe376Ile missense ADAM8 2 73044 2.73808E-5 36522 0 NA
10-135085196-T-C p.Arg374Gly missense ADAM8 5 72700 6.87758E-5 36350 0 6.93674E-5
10-135085204-C-A p.Ser371Ile missense ADAM8 2 72204 2.76993E-5 36102 0 NA
10-135085204-CTG-C p.Ser371fs frameshift ADAM8 5 72204 6.92482E-5 36102 0 1.26767E-4
10-135085204-C-T p.Ser371Asn missense ADAM8 1 72202 1.385E-5 36101 0 3.53589E-5
10-135085209-GCTGGGGAGGCGGGGCAGCATTGGGGGAGGCGGCCTGGCCCCTTCCCCACCCACCTCGTACCTCCAGCATACCCTGGCTCTGCAGGGCCTGGCCGCCTCAC-G c.1106+1_1107-1delGTGAGGCGGCCAGGCCCTGCAGAGCCAGGGTATGCTGGAGGTACGAGGTGGGTGGGGAAGGGGCCAGGCCGCCTCCCCCAATGCTGCCCCGCCTCCCCAG splice_acceptor ADAM8 5 71588 6.98441E-5 35794 0 NA
10-135085211-TG-T c.1107-3delC splice_region ADAM8 12 71224 1.68483E-4 35612 0 1.51112E-4
10-135085211-T-TGGGGAGGCGGGGCAGCATTG c.1107-3_1107-2insCAATGCTGCCCCGCCTCCCC splice_region ADAM8 2 71228 2.80788E-5 35614 0 NA
10-135085214-G-A c.1107-5C>T splice_region ADAM8 1 70972 1.40901E-5 35486 0 NA
10-135085217-G-A c.1107-8C>T splice_region ADAM8 1 70022 1.42812E-5 35011 0 5.86441E-5
10-135085302-C-T c.1106+8G>A splice_region ADAM8 742 59876 0.0123923 29938 32 0.0350689
10-135085303-G-A c.1106+7C>T splice_region ADAM8 7 59920 1.16822E-4 29960 0 4.37063E-5
10-135085308-A-C c.1106+2T>G splice_donor ADAM8 1 61998 1.61296E-5 30999 0 1.65456E-4
10-135085310-C-T p.Gly369Asp missense+splice_region ADAM8 2 62572 3.19632E-5 31286 0 NA
10-135085313-A-G p.Ile368Thr missense ADAM8 4 63012 6.348E-5 31506 0 2.60421E-5
10-135085318-G-C n.1579C>G splice_region ADAM8 1 63602 1.57228E-5 31801 0 0.00654582
10-135085321-C-T p.Ala365Ala synonymous ADAM8 53745 62118 0.865208 31059 23406 0.889375
10-135085325-A-G p.Met364Thr missense ADAM8 32 69156 4.62722E-4 34578 0 0.00100705
10-135085326-T-C p.Met364Val missense ADAM8 1 69432 1.44026E-5 34716 0 NA
10-135085334-C-T p.Arg361His missense ADAM8 7 70594 9.91586E-5 35297 0 3.38983E-5
10-135085335-G-A p.Arg361Cys missense ADAM8 3 71154 4.21621E-5 35577 0 5.92748E-5
10-135085337-C-T p.Gly360Asp missense ADAM8 1 71478 1.39903E-5 35739 0 2.53884E-5
10-135085338-C-T p.Gly360Ser missense ADAM8 39 71764 5.43448E-4 35882 0 4.46599E-4
10-135085339-G-A p.Ala359Ala synonymous ADAM8 12 72082 1.66477E-4 36041 0 2.06593E-4
10-135085344-C-T p.Glu358Lys missense ADAM8 5 73136 6.83658E-5 36568 0 1.27502E-4
10-135085345-G-A p.Phe357Phe synonymous ADAM8 4 73278 5.45866E-5 36639 0 6.25E-4
10-135085349-C-T p.Arg356His missense ADAM8 2 73790 2.71039E-5 36895 0 1.91205E-4
10-135085350-G-A p.Arg356Cys missense ADAM8 2 74272 2.6928E-5 37136 0 9.29023E-5
10-135085355-TG-T p.Gln354fs frameshift ADAM8 2 74960 2.66809E-5 37480 0 NA
10-135085361-C-T p.Arg352His missense ADAM8 2 74944 2.66866E-5 37472 0 1.68999E-5
10-135085362-G-A p.Arg352Cys missense ADAM8 2 75110 2.66276E-5 37555 0 2.41926E-5
10-135085367-C-A p.Gly350Val missense ADAM8 3 75472 3.97498E-5 37736 0 NA
10-135085372-G-A p.Val348Val synonymous ADAM8 1 76158 1.31306E-5 38079 0 8.42417E-6
10-135085374-C-T p.Val348Ile missense ADAM8 1 76276 1.31103E-5 38138 0 3.18715E-5
10-135085375-G-A p.Asn347Asn synonymous ADAM8 3 76386 3.92742E-5 38193 0 1.1261E-4
10-135085405-G-A p.Gly337Gly synonymous ADAM8 1 79428 1.259E-5 39714 0 4.20027E-5
10-135085421-A-G p.Met332Thr missense ADAM8 1 80472 1.24267E-5 40236 0 8.01584E-6
10-135085426-A-G p.Cys330Cys synonymous ADAM8 68312 76326 0.895003 38163 30642 0.924794
10-135085435-G-A p.Gly327Gly synonymous ADAM8 2 80998 2.4692E-5 40499 0 1.67487E-5
10-135085436-C-T p.Gly327Asp missense ADAM8 1 81060 1.23365E-5 40530 0 8.02304E-6
10-135085436-C-A p.Gly327Val missense ADAM8 2 81060 2.46731E-5 40530 0 NA
10-135085440-C-T p.Val326Met missense ADAM8 3 81172 3.69586E-5 40586 0 1.676E-5
10-135085441-G-A p.Pro325Pro synonymous ADAM8 3 81164 3.69622E-5 40582 0 3.10226E-4
10-135085444-G-A p.Asn324Asn synonymous ADAM8 221 81254 0.00271987 40627 0 0.00295213
10-135085460-T-C c.958-2A>G splice_acceptor ADAM8 3 81212 3.69404E-5 40606 0 8.04052E-6
10-135085462-C-T c.958-4G>A splice_region ADAM8 1 81160 1.23213E-5 40580 0 6.03224E-5
10-135085689-C-T c.957+8G>A splice_region ADAM8 2 77564 2.57852E-5 38782 0 1.30787E-5
10-135085690-C-T c.957+7G>A splice_region ADAM8 2 77578 2.57805E-5 38789 0 1.30722E-5
10-135085694-C-T c.957+3G>A splice_region ADAM8 1 77732 1.28647E-5 38866 0 6.53373E-6
10-135085701-T-C p.Asn318Ser missense ADAM8 1 77760 1.28601E-5 38880 0 NA
10-135085709-C-T p.Gly315Gly synonymous ADAM8 14 77870 1.79787E-4 38935 0 1.7618E-4
10-135085710-C-T p.Gly315Glu missense ADAM8 1 77880 1.28403E-5 38940 0 NA
10-135085712-T-G p.Ser314Ser synonymous ADAM8 7 78010 8.97321E-5 39005 0 1.17137E-4
10-135085731-G-A p.Ala308Val missense ADAM8 15 77904 1.92545E-4 38952 0 6.12745E-4
10-135085732-C-T p.Ala308Thr missense ADAM8 3 77836 3.85426E-5 38918 0 6.55643E-6
10-135085753-C-T p.Val301Met missense ADAM8 2 77768 2.57175E-5 38884 0 3.18939E-5
10-135085754-G-A p.Thr300Thr synonymous ADAM8 63926 74842 0.854146 37421 27359 0.885625
10-135085760-C-T p.Gly298Gly synonymous ADAM8 13 77464 1.6782E-4 38732 0 0.00189633
10-135085760-C-G p.Gly298Gly synonymous ADAM8 2 77468 2.58171E-5 38734 0 2.02203E-5
10-135085761-C-G p.Gly298Ala missense ADAM8 14 77428 1.80813E-4 38714 0 5.43803E-5
10-135085762-C-T p.Gly298Arg missense ADAM8 1 77352 1.29279E-5 38676 0 7.5071E-5
10-135085763-G-C p.Thr297Thr synonymous ADAM8 14 77308 1.81094E-4 38654 0 5.60553E-4
10-135085763-G-A p.Thr297Thr synonymous ADAM8 4 77308 5.17411E-5 38654 0 7.85423E-5
10-135085771-C-T p.Asp295Asn missense ADAM8 1 76840 1.30141E-5 38420 0 2.08385E-5
10-135085772-G-A p.Val294Val synonymous ADAM8 19 76594 2.48061E-4 38297 0 5.23469E-4
10-135085773-A-G p.Val294Ala missense ADAM8 1 76606 1.30538E-5 38303 0 NA
10-135085782-G-A c.876-4C>T splice_region ADAM8 1 76248 1.31151E-5 38124 0 NA
10-135085919-C-T c.875+1G>A splice_donor ADAM8 1 78312 1.27694E-5 39156 0 NA
10-135085920-G-A p.Thr292Met missense+splice_region ADAM8 6 78476 7.64565E-5 39238 0 3.43746E-5
10-135085920-GTGAT-G p.Ile291fs frameshift ADAM8 3 78476 3.82282E-5 39238 0 NA
10-135085933-C-T p.Val288Ile missense ADAM8 2 80094 2.49707E-5 40047 0 3.2144E-5
10-135085934-G-A p.Asn287Asn synonymous ADAM8 1 80192 1.24701E-5 40096 0 2.42832E-5
10-135085941-T-C p.His285Arg missense ADAM8 1 80628 1.24026E-5 40314 0 8.58443E-6
10-135085941-T-A p.His285Leu missense ADAM8 1 80628 1.24026E-5 40314 0 NA
10-135085946-G-C p.His283Gln missense ADAM8 2 80820 2.47464E-5 40410 0 NA
10-135085951-G-A p.Arg282Trp missense ADAM8 4 81068 4.93413E-5 40534 0 4.01942E-6
10-135085951-GC-G p.Arg282fs frameshift ADAM8 1 81068 1.23353E-5 40534 0 NA
10-135085953-C-T p.Arg281Gln missense ADAM8 1 81188 1.23171E-5 40594 0 5.22055E-5
10-135085954-G-A p.Arg281Trp missense ADAM8 3 81274 3.69122E-5 40637 0 0.00252016
10-135085957-T-C p.Thr280Ala missense ADAM8 1 81400 1.2285E-5 40700 0 8.42545E-6
10-135085959-C-T p.Arg279Gln missense ADAM8 1 81436 1.22796E-5 40718 0 6.39672E-5
10-135085965-C-T p.Arg277Gln missense ADAM8 9 81662 1.1021E-4 40831 0 6.39264E-5
10-135085966-G-A p.Arg277Trp missense ADAM8 7 81662 8.57192E-5 40831 0 5.87475E-5
10-135085971-T-C p.Gln275Arg missense ADAM8 3 81796 3.66766E-5 40898 0 6.38896E-5
10-135085986-T-C p.Asn270Ser missense ADAM8 12 81902 1.46517E-4 40951 0 2.0418E-4
10-135086002-T-C p.Ser265Gly missense ADAM8 2 82058 2.4373E-5 41029 0 4.00323E-6
10-135086004-G-C p.Pro264Arg missense ADAM8 27 82070 3.28987E-4 41035 0 2.16211E-4
10-135086006-G-A p.Asp263Asp synonymous ADAM8 1 82038 1.21895E-5 41019 0 1.20121E-5
10-135086009-G-A p.Pro262Pro synonymous ADAM8 2 82026 2.43825E-5 41013 0 1.27624E-4
10-135086017-C-T p.Val260Ile missense ADAM8 2 82002 2.43896E-5 41001 0 1.2017E-5
10-135086018-G-A p.His259His synonymous ADAM8 3 82028 3.65729E-5 41014 0 1.84285E-4
10-135086019-T-C p.His259Arg missense ADAM8 2 82028 2.43819E-5 41014 0 1.67213E-5
10-135086052-C-A p.Gly248Val missense ADAM8 1 81792 1.22261E-5 40896 0 NA
10-135086060-G-A p.Val245Val synonymous ADAM8 3 81752 3.66964E-5 40876 0 NA
10-135086067-C-T p.Arg243His missense ADAM8 6 81626 7.3506E-5 40813 0 2.41622E-5
10-135086069-G-A p.Phe242Phe synonymous ADAM8 11 81574 1.34847E-4 40787 0 6.37674E-5
10-135086073-T-C p.Asn241Ser missense ADAM8 68 81490 8.34458E-4 40745 0 0.00140512
10-135086086-A-G p.Tyr237His missense ADAM8 1 81236 1.23098E-5 40618 0 1.72628E-5
10-135086096-AGGT-A c.706-10_706-8delACC splice_region ADAM8 1 80714 1.23894E-5 40357 0 NA
10-135086097-G-A c.706-8C>T splice_region ADAM8 1 80718 1.23888E-5 40359 0 NA
10-135086242-A-AC n.1121dupG splice_region ADAM8 5 77326 6.46613E-5 38663 0 0.00149701
10-135086310-C-T p.Val233Met missense ADAM8 1 81022 1.23423E-5 40511 0 2.00894E-5
10-135086310-C-CGTGATTCT p.Val233fs frameshift ADAM8 5 81024 6.17101E-5 40512 0 2.23842E-4
10-135086311-G-A p.His232His synonymous ADAM8 1 81046 1.23387E-5 40523 0 1.20563E-5
10-135086331-C-T p.Val226Met missense ADAM8 3 81604 3.67629E-5 40802 0 6.39264E-5
10-135086333-C-T p.Arg225Gln missense ADAM8 3 81652 3.67413E-5 40826 0 3.19836E-5
10-135086339-C-T p.Arg223His missense ADAM8 1 81700 1.22399E-5 40850 0 3.19591E-5
10-135086340-G-A p.Arg223Cys missense ADAM8 2 81662 2.44912E-5 40831 0 3.19918E-5
10-135086343-C-T p.Val222Met missense ADAM8 1 81702 1.22396E-5 40851 0 6.25782E-4
10-135086344-G-A p.Ala221Ala synonymous ADAM8 4 81712 4.89524E-5 40856 0 6.40041E-5
10-135086352-C-T p.Glu219Lys missense ADAM8 1 81702 1.22396E-5 40851 0 2.81E-5
10-135086353-G-T p.Ser218Arg missense ADAM8 1 81596 1.22555E-5 40798 0 NA
10-135086358-C-G p.Gly217Arg missense ADAM8 1 81750 1.22324E-5 40875 0 4.01374E-6
10-135086367-G-A p.Gln214* stop_gained ADAM8 2 81702 2.44792E-5 40851 0 1.2056E-4
10-135086370-ACTGGGGACACGAGACCCTCAGGCTGGAGCCCACACACCCCCCATGCCCCCGCCGCCGGCTGCTCTCCCACCTTCCCTGCCCCCAACACAC-A c.636+1_637-1delGTGTGTTGGGGGCAGGGAAGGTGGGAGAGCAGCCGGCGGCGGGGGCATGGGGGGTGTGTGGGCTCCAGCCTGAGGGTCTCGTGTCCCCAG splice_acceptor ADAM8 7 81700 8.56793E-5 40850 3 NA
10-135086462-T-A p.Glu212Val missense+splice_region ADAM8 1 82014 1.2193E-5 41007 0 8.35199E-6
10-135086463-CT-C p.Glu212fs frameshift ADAM8 1 82062 1.21859E-5 41031 0 NA
10-135086469-T-C p.Asn210Asp missense ADAM8 1 82096 1.21809E-5 41048 0 4.00125E-6
10-135086483-T-C p.Tyr205Cys missense ADAM8 1 82150 1.21729E-5 41075 0 6.38366E-5
10-135086493-C-T p.Val202Met missense ADAM8 1 82124 1.21767E-5 41062 0 1.19999E-5
10-135086498-C-T p.Arg200His missense ADAM8 1 82116 1.21779E-5 41058 0 6.25E-4
10-135086500-G-A p.Thr199Thr synonymous ADAM8 2 82160 2.43427E-5 41080 0 8.34209E-6
10-135086501-GTC-G p.Glu198fs frameshift ADAM8 10 82142 1.2174E-4 41071 0 6.38407E-5
10-135086508-G-A p.Arg197* stop_gained ADAM8 1 82114 1.21782E-5 41057 0 1.08456E-4
10-135086508-G-C p.Arg197Gly missense ADAM8 1 82114 1.21782E-5 41057 0 NA
10-135086509-G-T p.Ser196Ser synonymous ADAM8 1 82140 1.21743E-5 41070 0 NA
10-135086524-C-CT c.574-2_574-1insA splice_acceptor ADAM8 1 82076 1.21838E-5 41038 0 8.34794E-6
10-135086528-G-A c.574-5C>T splice_region ADAM8 12 82086 1.46188E-4 41043 0 6.68003E-5
10-135086753-C-T c.573+5G>A splice_region ADAM8 20 74278 2.69259E-4 37139 1 1.48346E-5
10-135086760-C-T p.Gly191Arg missense+splice_region ADAM8 2 74042 2.70117E-5 37021 0 1.51208E-5
10-135086761-G-T p.Pro190Pro synonymous ADAM8 25 73798 3.38763E-4 36899 0 6.04339E-4
10-135086761-G-A p.Pro190Pro synonymous ADAM8 21 73796 2.84568E-4 36898 0 5.28541E-4
10-135086763-G-A p.Pro190Ser missense ADAM8 1 73594 1.35881E-5 36797 0 NA
10-135086765-C-T p.Arg189Gln missense ADAM8 1 73514 1.36029E-5 36757 0 1.52513E-5
10-135086766-G-A p.Arg189Trp missense ADAM8 2822 73176 0.0385646 36588 71 0.0512206
10-135086766-G-C p.Arg189Gly missense ADAM8 1 73412 1.36218E-5 36706 0 NA
10-135086779-G-A p.Ala184Ala synonymous ADAM8 1 72310 1.38293E-5 36155 0 5.24109E-4
10-135086785-C-T p.Thr182Thr synonymous ADAM8 5 71984 6.94599E-5 35992 0 3.6295E-5
10-135086786-G-A p.Thr182Met missense ADAM8 6 71826 8.35352E-5 35913 0 0.00105042
10-135086789-C-T p.Arg181Gln missense ADAM8 2 71778 2.78637E-5 35889 0 3.75728E-5
10-135086790-G-A p.Arg181Trp missense ADAM8 2 71672 2.79049E-5 35836 0 6.32911E-4
10-135086790-G-T p.???246??? splice_region+synonymous ADAM8 1 71672 1.39524E-5 35836 0 NA
10-135086803-GC-G p.Ser176fs frameshift ADAM8 7 70588 9.9167E-5 35294 0 9.86407E-6
10-135086805-TGCCCAGGCTGTCGTCGCTGAC-T p.Val169_Gly175del conservative_inframe_deletion ADAM8 6 70538 8.50605E-5 35269 0 9.84581E-6
10-135086817-C-T p.Asp172Asn missense ADAM8 2 69058 2.89612E-5 34529 0 1.05285E-4
10-135086820-C-T p.Asp171Asn missense ADAM8 2 68600 2.91545E-5 34300 0 5.52669E-5
10-135086821-G-A p.Ser170Ser synonymous ADAM8 2 68094 2.93712E-5 34047 0 6.25782E-4
10-135086829-C-T p.Gly168Arg missense ADAM8 2 67480 2.96384E-5 33740 0 3.08318E-5
10-135086829-C-G p.Gly168Arg missense ADAM8 1 67480 1.48192E-5 33740 0 NA
10-135086830-G-A p.Cys167Cys synonymous ADAM8 2 67136 2.97903E-5 33568 0 0.00627615
10-135086831-C-T p.Cys167Tyr missense ADAM8 7 67280 1.04043E-4 33640 0 1.90743E-4
10-135086834-G-T p.Thr166Asn missense ADAM8 1 66890 1.49499E-5 33445 0 NA
10-135086834-G-C p.Thr166Ser missense ADAM8 1 66892 1.49495E-5 33446 0 NA
10-135086842-C-A p.Thr163Thr synonymous ADAM8 15 65822 2.27887E-4 32911 0 2.55037E-4
10-135086843-G-A p.Thr163Met missense ADAM8 10 65602 1.52434E-4 32801 0 1.59398E-4
10-135086848-C-T p.Leu161Leu synonymous ADAM8 8 65208 1.22684E-4 32604 0 3.53551E-4
10-135086849-A-G p.Leu161Pro missense ADAM8 4 65108 6.14364E-5 32554 0 NA
10-135086858-T-C p.Glu158Gly missense ADAM8 36 64040 5.62149E-4 32020 0 0.00140235
10-135086871-C-T p.Val154Met missense ADAM8 5 62238 8.03368E-5 31119 0 1.27502E-4
10-135086872-G-A p.Ala153Ala synonymous ADAM8 8 61842 1.29362E-4 30921 0 0.00105042
10-135086874-C-T p.Ala153Thr missense ADAM8 2 60802 3.28937E-5 30401 0 1.12663E-4
10-135086880-G-A p.Arg151Trp missense ADAM8 1 60314 1.65799E-5 30157 0 1.18596E-4
10-135086884-G-A p.Gly149Gly synonymous ADAM8 7 59432 1.17782E-4 29716 0 6.00528E-5
10-135086885-C-T p.Gly149Asp missense ADAM8 3 59558 5.03711E-5 29779 0 6.03209E-5
10-135086890-G-A p.Gly147Gly synonymous ADAM8 2 58216 3.43548E-5 29108 0 6.37633E-5
10-135086903-A-G p.Leu143Pro missense ADAM8 1 57024 1.75365E-5 28512 0 1.35177E-5
10-135086911-G-A p.Arg106* stop_gained ADAM8 1 55098 1.81495E-5 27549 0 3.18776E-5
10-135086911-G-T p.Ile140Ile synonymous ADAM8 2 55098 3.6299E-5 27549 0 NA
10-135086917-G-A p.Pro104Ser missense ADAM8 2 54342 3.68039E-5 27171 0 2.53154E-4
10-135086924-T-G p.Asp136Ala missense ADAM8 1 53142 1.88175E-5 26571 0 NA
10-135086935-C-G c.280-1G>C splice_acceptor ADAM8 55 51808 0.00106161 25904 0 0.00255021
10-135086948-C-A c.384-1G>T splice_acceptor ADAM8 1 49882 2.00473E-5 24941 0 NA
10-135086953-G-GTGCTGAGGCT c.384-7_384-6insAGCCTCAGCA splice_region ADAM8 1 49156 2.03434E-5 24578 0 NA
10-135086954-G-C c.384-7C>G splice_region ADAM8 2 49024 4.07963E-5 24512 0 NA
10-135087262-C-G c.383+4G>C splice_region ADAM8 2 70506 2.83664E-5 35253 0 NA
10-135087273-C-T p.Gly126Ser missense ADAM8 1 72476 1.37977E-5 36238 0 5.2306E-5
10-135087274-G-A p.Arg91Trp missense ADAM8 5 72610 6.8861E-5 36305 0 6.30517E-4
10-135087278-C-G p.Cys124Ser missense ADAM8 3 73348 4.09009E-5 36674 0 9.56877E-5
10-135087292-G-T p.Gln85Lys missense ADAM8 1 74560 1.3412E-5 37280 0 NA
10-135087294-C-T p.Ala119Thr missense ADAM8 1 74468 1.34286E-5 37234 0 3.19E-5
10-135087294-C-A p.Ala119Ser missense ADAM8 1 74468 1.34286E-5 37234 0 NA
10-135087295-G-A p.Arg84Cys missense ADAM8 177 74718 0.00236891 37359 2 0.006
10-135087304-C-T p.Gly81Arg missense ADAM8 2 75552 2.64718E-5 37776 0 6.5161E-6
10-135087305-G-A p.Pro115Leu missense ADAM8 63 75632 8.32981E-4 37816 0 0.00133963
10-135087309-A-AC p.Tyr114fs frameshift ADAM8 3 75794 3.9581E-5 37897 0 NA
10-135087313-C-G p.Glu112Asp missense ADAM8 5 76144 6.56651E-5 38072 0 5.2019E-5
10-135087315-C-T p.Glu112Lys missense ADAM8 1 76114 1.31382E-5 38057 0 NA
10-135087317-A-G p.Val111Ala missense ADAM8 1 76150 1.3132E-5 38075 0 3.19183E-5
10-135087319-G-A p.Arg76Cys missense ADAM8 1 75902 1.31749E-5 37951 0 9.56938E-5
10-135087334-G-A p.Leu71Phe missense ADAM8 1 76258 1.31134E-5 38129 0 NA
10-135087341-TCCTGCGGGGGAAGCAGGAGAGGGGTCCACAGGCTGTGCCCCCATGGCCCCACAGGCTCGGGGAGGGCCGCCCAGCCCCTACCTGCCCGCCCAGCTGCTCCGCCCGACCCATA-T p.Asp103fs frameshift ADAM8 9 76096 1.18272E-4 38048 4 NA
10-135087344-T-C c.307-2A>G splice_acceptor ADAM8 2 76062 2.62943E-5 38031 0 6.3804E-5
10-135087346-C-T c.307-4G>A splice_region ADAM8 40 75866 5.27245E-4 37933 1 7.3384E-4
10-135087347-G-A c.307-5C>T splice_region ADAM8 5 75894 6.58814E-5 37947 0 3.9141E-5
10-135087348-G-A c.307-6C>T splice_region ADAM8 1 76024 1.31537E-5 38012 0 NA
10-135087349-G-C c.307-7C>G splice_region ADAM8 1 75938 1.31686E-5 37969 0 5.51207E-5
10-135087452-T-C c.306+3A>G splice_region ADAM8 7 75904 9.22218E-5 37952 0 1.59918E-4
10-135087460-C-T p.Gly101Arg missense ADAM8 820 76530 0.0107148 38265 7 0.0151838
10-135087461-G-A p.Arg66Trp missense ADAM8 2 76586 2.61144E-5 38293 0 1.31852E-4
10-135087461-G-T p.Arg100Arg synonymous ADAM8 2 76586 2.61144E-5 38293 0 3.2963E-5
10-135087462-C-T p.Arg100His missense ADAM8 2 76748 2.60593E-5 38374 0 4.87171E-5
10-135087463-G-A p.Arg100Cys missense ADAM8 1 77258 1.29436E-5 38629 0 8.64513E-6
10-135087466-G-C p.Pro99Ala missense ADAM8 2 77642 2.57593E-5 38821 0 6.25E-4
10-135087473-C-T p.Gly62Arg missense ADAM8 3 78260 3.83338E-5 39130 0 6.38407E-5
10-135087474-G-A p.Thr96Met missense ADAM8 26 78162 3.32642E-4 39081 0 0.00101523
10-135087474-G-T p.Thr96Lys missense ADAM8 4 78160 5.11771E-5 39080 0 1.44479E-4
10-135087477-A-T p.Val95Glu missense ADAM8 2 78450 2.54939E-5 39225 0 3.84221E-5
10-135087481-C-T p.Glu94Lys missense ADAM8 8 78806 1.01515E-4 39403 0 2.04907E-4
10-135087482-G-A p.Arg59* stop_gained ADAM8 15 78814 1.90322E-4 39407 0 1.07788E-4
10-135087489-T-C p.Asn91Ser missense ADAM8 1 79620 1.25597E-5 39810 0 6.3888E-5
10-135087496-C-G p.Ala89Pro missense ADAM8 1 79804 1.25307E-5 39902 0 NA
10-135087498-G-A p.Thr88Met missense ADAM8 3 79934 3.7531E-5 39967 0 8.38283E-5
10-135087499-T-A p.Thr88Ser missense ADAM8 1 80022 1.24966E-5 40011 0 NA
10-135087501-TA-T p.Tyr87fs frameshift ADAM8 1 80228 1.24645E-5 40114 0 2.08328E-5
10-135087508-C-G p.Glu85Gln missense ADAM8 1 80550 1.24146E-5 40275 0 NA
10-135087517-C-T p.Gly82Ser missense ADAM8 15 80794 1.85657E-4 40397 0 5.05561E-4
10-135087518-G-A p.Arg47Trp missense ADAM8 1 80816 1.23738E-5 40408 0 6.25E-4
10-135087521-G-A p.Leu46Phe missense ADAM8 51748 70006 0.739194 35003 19348 0.815037
10-135087525-A-G p.Leu79Pro missense ADAM8 1 81048 1.23384E-5 40524 0 NA
10-135087541-A-G c.228-8T>C splice_region ADAM8 373 81342 0.00458558 40671 2 0.004375
10-135087656-C-A c.227+7G>T splice_region ADAM8 1 81882 1.22127E-5 40941 0 NA
10-135087668-C-A p.Glu40* stop_gained ADAM8 1 82002 1.21948E-5 41001 0 9.82511E-6
10-135087672-C-T p.Arg73Gln missense ADAM8 5 82008 6.09697E-5 41004 0 3.19795E-5
10-135087673-G-A p.Arg73Trp missense ADAM8 3 82010 3.65809E-5 41005 0 9.71855E-6
10-135087674-C-T p.Ala38Thr missense ADAM8 2 81996 2.43914E-5 40998 0 9.68467E-6
10-135087683-G-A p.Pro35Ser missense ADAM8 1 81990 1.21966E-5 40995 0 9.51891E-6
10-135087683-G-C p.Pro35Ala missense ADAM8 2 81990 2.43932E-5 40995 0 NA
10-135087685-T-C p.Thr69Ala missense ADAM8 1 81940 1.22041E-5 40970 0 NA
10-135087689-G-A p.Leu33Phe missense ADAM8 1 82028 1.2191E-5 41014 0 4.33719E-6
10-135087708-A-C p.Leu61Arg missense ADAM8 2 81908 2.44176E-5 40954 0 NA
10-135087712-C-T p.Val60Ile missense ADAM8 2 81884 2.44248E-5 40942 0 3.20287E-5
10-135087722-C-G p.Arg56Ser missense ADAM8 2 81788 2.44535E-5 40894 0 NA
10-135087725-C-T p.Glu21Lys missense ADAM8 2 81814 2.44457E-5 40907 0 NA
10-135087727-CTG-C p.Pro54fs frameshift ADAM8 2 81776 2.44571E-5 40888 0 3.82256E-5
10-135087736-G-T p.Leu52Met missense ADAM8 2 81680 2.44858E-5 40840 0 0.00125313
10-135087739-C-T p.Gly51Ser missense+splice_region ADAM8 2 81614 2.45056E-5 40807 0 3.99652E-5
10-135087745-C-T c.151-6G>A splice_region ADAM8 38 81436 4.66624E-4 40718 0 2.78951E-4
10-135087746-G-A c.151-7C>T splice_region ADAM8 1 81472 1.22742E-5 40736 0 1.58111E-5
10-135088318-C-G p.Arg109Ser missense ADAM8 2 8898 2.2477E-4 4449 0 7.59878E-4
10-135088330-C-T p.Trp105* stop_gained ADAM8 1 8964 1.11557E-4 4482 0 1.27486E-4
10-135088352-G-GTGC p.Cys97_Thr98insSer conservative_inframe_insertion ADAM8 1 8980 1.11359E-4 4490 0 NA
10-135088357-G-A p.Ala96Ala synonymous ADAM8 1 8978 1.11383E-4 4489 0 4.97009E-4
10-135088368-G-A p.Arg93* stop_gained ADAM8 1 8998 1.11136E-4 4499 0 3.18837E-5
10-135088405-C-T p.Pro80Pro synonymous ADAM8 1 9030 1.10742E-4 4515 0 1.27437E-4
10-135088406-G-A p.Pro80Leu missense ADAM8 1 9034 1.10693E-4 4517 0 3.18735E-5
10-135088420-A-G p.Pro75Pro synonymous ADAM8 9 9028 9.96899E-4 4514 1 0.00353864
10-135088427-C-T p.Arg73His missense ADAM8 2 8988 2.22519E-4 4494 0 4.08998E-4
10-135088435-T-G p.Arg70Arg synonymous ADAM8 4 9004 4.44247E-4 4502 0 2.17675E-4
10-135088451-C-T p.Arg65Gln missense ADAM8 1 8972 1.11458E-4 4486 0 2.10606E-5
10-135088995-G-A p.Ser48Phe missense ADAM8 10 81154 1.23223E-4 40577 0 2.72183E-4
10-135088997-G-A p.Pro47Pro synonymous ADAM8 1 81142 1.23241E-5 40571 0 NA
10-135089001-A-G p.Leu46Pro missense ADAM8 1 81148 1.23232E-5 40574 0 NA
10-135089003-A-G p.Ala45Ala synonymous ADAM8 1 81146 1.23235E-5 40573 0 NA
10-135089004-G-A p.Ala45Val missense ADAM8 1 81134 1.23253E-5 40567 0 NA
10-135089007-C-T p.Arg44Gln missense ADAM8 1 81138 1.23247E-5 40569 0 NA
10-135089008-G-A p.Arg44* stop_gained ADAM8 1 81142 1.23241E-5 40571 0 1.45873E-5
10-135089009-G-T p.Arg43Arg synonymous ADAM8 2 81142 2.46481E-5 40571 0 NA
10-135089010-C-T p.Arg43His missense ADAM8 4 81140 4.92975E-5 40570 0 3.64166E-5
10-135089010-C-A p.Arg43Leu missense ADAM8 2 81140 2.46488E-5 40570 0 NA
10-135089011-G-A p.Arg43Cys missense ADAM8 9 81128 1.10936E-4 40564 0 0.00105708
10-135089016-C-G p.Arg41Pro missense ADAM8 1 81106 1.23295E-5 40553 0 NA
10-135089017-G-A p.Arg41* stop_gained ADAM8 10 81098 1.23308E-4 40549 0 1.58999E-4
10-135089028-A-C p.Leu37Arg missense ADAM8 3 81020 3.70279E-5 40510 0 NA
10-135089031-C-T p.Arg36His missense ADAM8 106 80990 0.0013088 40495 2 0.00344168
10-135089031-C-A p.Arg36Leu missense ADAM8 1 80990 1.23472E-5 40495 0 NA
10-135089032-G-A p.Arg36Cys missense ADAM8 1 80980 1.23487E-5 40490 0 1.9129E-4
10-135089034-C-T p.Trp35* stop_gained ADAM8 25 80976 3.08733E-4 40488 0 0.00423729
10-135089034-CA-TG p.Trp35Gln missense ADAM8 2 80976 2.46987E-5 40488 0 NA
10-135089035-A-G p.Trp35Arg missense ADAM8 71269 80090 0.889861 40045 31762 0.907398
10-135089036-C-A p.Pro34Pro synonymous ADAM8 2 80968 2.47011E-5 40484 0 NA
10-135089036-C-T p.Pro34Pro synonymous ADAM8 1 80968 1.23506E-5 40484 0 2.28519E-5
10-135089037-G-A p.Pro34Leu missense ADAM8 15 80970 1.85254E-4 40485 0 1.94685E-4
10-135089045-G-A p.Val31Val synonymous ADAM8 15 80936 1.85332E-4 40468 0 0.00125
10-135089045-G-T p.Val31Val synonymous ADAM8 1 80940 1.23548E-5 40470 0 3.18654E-5
10-135089057-C-T p.Glu27Glu synonymous ADAM8 1 80794 1.23772E-5 40397 0 9.55901E-5
10-135089060-C-T p.Met26Ile missense ADAM8 2 80752 2.47672E-5 40376 0 9.56084E-5
10-135089066-G-A p.Ala24Ala synonymous ADAM8 107 80650 0.00132672 40325 3 0.0017228
10-135089077-G-A p.Arg21Trp missense ADAM8 1953 80236 0.0243407 40118 12 0.0243659
10-135089090-C-T p.Ala16Ala splice_region+synonymous ADAM8 3 80036 3.74831E-5 40018 0 1.30344E-4
10-135089091-G-A p.Ala16Val missense+splice_region ADAM8 2 79982 2.50056E-5 39991 0 6.64011E-5
10-135089209-C-T n.289+1G>A splice_donor ADAM8 1 55562 1.79979E-5 27781 0 NA
10-135090273-C-T c.46+3G>A splice_region ADAM8 1 50252 1.98997E-5 25126 0 NA
10-135090283-C-G p.Met13Ile missense ADAM8 2 50940 3.92619E-5 25470 0 7.99233E-6
10-135090287-A-G p.Met12Thr missense ADAM8 1 51024 1.95986E-5 25512 0 NA
10-135090294-C-G p.Gly10Arg missense ADAM8 2 50982 3.92295E-5 25491 0 1.7059E-4
10-135090301-C-T p.Trp7* stop_gained ADAM8 5 51052 9.79394E-5 25526 0 1.91559E-4
10-135090319-C-T p.Met1? start_lost ADAM8 1 50146 1.99418E-5 25073 0 NA
10-135090367-C-T c.-46G>A 5_prime_UTR_premature_start_codon_gain ADAM8 1 44684 2.23794E-5 22342 0 3.19754E-5