Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
4-175839555-A-G c.-624A>G 5_prime_UTR_premature_start_codon_gain ADAM29 1787 2928 0.610314 1464 571 0.652092
4-175839610-C-T c.-569C>T 5_prime_UTR_premature_start_codon_gain ADAM29 1 2938 3.40368E-4 1469 0 6.69088E-4
4-175841852-A-G c.-542A>G 5_prime_UTR_premature_start_codon_gain ADAM29 2 2918 6.85401E-4 1459 0 NA
4-175852129-C-T c.-450-8C>T splice_region ADAM29 7 2844 0.00246132 1422 0 0.00330154
4-175852215-C-T c.-372C>T 5_prime_UTR_premature_start_codon_gain ADAM29 2 2942 6.7981E-4 1471 0 6.36902E-5
4-175852456-T-TG n.521+3dupG splice_region ADAM29 1 2886 3.465E-4 1443 0 9.56694E-5
4-175896494-T-C c.-180-3T>C splice_region ADAM29 4 42678 9.37251E-5 21339 0 2.86588E-4
4-175896551-A-T n.558A>T splice_region ADAM29 2 68394 2.92423E-5 34197 0 3.1841E-5
4-175896559-C-T c.-118C>T 5_prime_UTR_premature_start_codon_gain ADAM29 9 70740 1.27226E-4 35370 0 3.1841E-5
4-175896682-G-T p.Lys2Asn missense ADAM29 2 82514 2.42383E-5 41257 0 NA
4-175896683-A-G p.Met3Val missense ADAM29 3 82526 3.63522E-5 41263 0 2.25591E-5
4-175896692-C-A p.Leu6Met missense ADAM29 1 82884 1.20651E-5 41442 0 NA
4-175896726-C-T p.Ser17Phe missense ADAM29 1 83148 1.20267E-5 41574 0 NA
4-175896735-T-A p.Ile20Asn missense ADAM29 2 83152 2.40523E-5 41576 0 2.67828E-5
4-175896735-T-C p.Ile20Thr missense ADAM29 1 83152 1.20262E-5 41576 0 NA
4-175896737-C-G p.Gln21Glu missense ADAM29 1 83146 1.2027E-5 41573 0 NA
4-175896743-G-A p.Glu23Lys missense ADAM29 1 83154 1.20259E-5 41577 0 1.28252E-5
4-175896748-C-T p.His24His synonymous ADAM29 1 83160 1.2025E-5 41580 0 8.4035E-6
4-175896754-A-G p.Gln26Gln synonymous ADAM29 1 83160 1.2025E-5 41580 0 8.78534E-6
4-175896757-T-C p.Tyr27Tyr synonymous ADAM29 2 83168 2.40477E-5 41584 0 NA
4-175896768-C-T p.Pro31Leu missense ADAM29 17 83148 2.04455E-4 41574 0 0.0020141
4-175896769-G-A p.Pro31Pro synonymous ADAM29 9 83148 1.08241E-4 41574 0 6.04883E-5
4-175896775-G-A p.Val33Val synonymous ADAM29 54 83144 6.49476E-4 41572 0 0.00117804
4-175896776-G-GTGA p.Val34_Ile35insMet disruptive_inframe_insertion ADAM29 1 83134 1.20288E-5 41567 0 NA
4-175896783-C-G p.Pro36Arg missense ADAM29 2 83144 2.40547E-5 41572 0 8.52108E-6
4-175896792-T-C p.Ile39Thr missense ADAM29 14 83142 1.68387E-4 41571 0 3.18471E-5
4-175896800-A-G p.Thr42Ala missense ADAM29 5 83128 6.01482E-5 41564 0 5.03525E-4
4-175896801-C-T p.Thr42Ile missense ADAM29 1 83126 1.20299E-5 41563 0 NA
4-175896806-A-G p.Arg44Gly missense+splice_region ADAM29 1 83140 1.20279E-5 41570 0 NA
4-175896809-G-C p.Gly45Arg missense ADAM29 1 83144 1.20273E-5 41572 0 NA
4-175896814-G-C p.Met46Ile missense ADAM29 1 83150 1.20265E-5 41575 0 NA
4-175896815-A-G p.Thr47Ala missense ADAM29 2 83142 2.40552E-5 41571 0 4.00134E-6
4-175896824-G-T p.Gly50Cys missense ADAM29 1 83132 1.20291E-5 41566 0 3.20431E-5
4-175896838-T-C p.Tyr54Tyr synonymous ADAM29 2 83122 2.4061E-5 41561 0 6.36902E-5
4-175896844-GC-G p.Phe58fs frameshift ADAM29 2 83116 2.40628E-5 41558 0 6.37064E-5
4-175896852-G-A p.Gly59Glu missense ADAM29 1 83136 1.20285E-5 41568 0 NA
4-175896858-A-G p.Gln61Arg missense ADAM29 1 83156 1.20256E-5 41578 0 6.37267E-5
4-175896859-GA-G p.Lys62fs frameshift ADAM29 1 83152 1.20262E-5 41576 0 8.37759E-6
4-175896869-A-T p.Ile65Phe missense ADAM29 127 83156 0.00152725 41578 1 0.00126358
4-175896871-C-T p.Ile65Ile synonymous ADAM29 847 83130 0.0101889 41565 11 0.00855496
4-175896876-T-C p.Ile67Thr missense ADAM29 1 83162 1.20247E-5 41581 0 NA
4-175896878-A-G p.Lys68Glu missense ADAM29 1 83176 1.20227E-5 41588 0 3.18593E-5
4-175896880-G-A p.Lys68Lys synonymous ADAM29 1 83172 1.20233E-5 41586 0 NA
4-175896888-A-G p.Lys71Arg missense ADAM29 1 83162 1.20247E-5 41581 0 NA
4-175896889-GC-G p.Leu72fs frameshift ADAM29 6 83150 7.21587E-5 41575 0 2.58338E-4
4-175896890-C-T p.Leu72Phe missense ADAM29 1 83142 1.20276E-5 41571 0 NA
4-175896891-T-C p.Leu72Pro missense ADAM29 1 83144 1.20273E-5 41572 0 3.18613E-5
4-175896905-C-T p.His77Tyr missense ADAM29 2 83126 2.40599E-5 41563 0 4.15089E-5
4-175896926-A-G p.Thr84Ala missense ADAM29 2 83126 2.40599E-5 41563 0 NA
4-175896932-C-G p.Gln86Glu missense ADAM29 1 83122 1.20305E-5 41561 0 NA
4-175896935-G-T p.Gly87Cys missense ADAM29 1 83116 1.20314E-5 41558 0 NA
4-175896949-G-A p.Glu91Glu synonymous ADAM29 1 83122 1.20305E-5 41561 0 7.96223E-6
4-175896964-C-T p.Val96Val synonymous ADAM29 1 83110 1.20322E-5 41555 0 NA
4-175896970-T-G p.Asn98Lys missense ADAM29 1 83110 1.20322E-5 41555 0 3.1841E-5
4-175896972-A-G p.Asn99Ser missense ADAM29 1 83106 1.20328E-5 41553 0 NA
4-175896973-C-T p.Asn99Asn synonymous ADAM29 1 83104 1.20331E-5 41552 0 3.1841E-5
4-175896986-G-T p.Gly104Cys missense ADAM29 1 83074 1.20375E-5 41537 0 3.98226E-6
4-175896988-T-C p.Gly104Gly synonymous ADAM29 2 83072 2.40755E-5 41536 0 NA
4-175896990-A-G p.Tyr105Cys missense ADAM29 1 83064 1.20389E-5 41532 0 3.98222E-6
4-175896998-G-A p.Gly108Arg missense ADAM29 5 83050 6.02047E-5 41525 0 3.30262E-5
4-175897000-G-A p.Gly108Gly synonymous ADAM29 1 83024 1.20447E-5 41512 0 3.30284E-5
4-175897008-A-G p.Glu111Gly missense ADAM29 4 82994 4.81963E-5 41497 0 3.98797E-6
4-175897010-T-C p.Ser112Pro missense ADAM29 1 82996 1.20488E-5 41498 0 NA
4-175897015-G-A p.Leu113Leu synonymous ADAM29 3 82974 3.61559E-5 41487 0 2.47713E-5
4-175897030-C-G p.Thr118Thr synonymous ADAM29 22 82882 2.65438E-4 41441 0 0.00162441
4-175897041-G-C p.Gly122Ala missense ADAM29 2 82816 2.41499E-5 41408 0 8.26323E-6
4-175897061-A-G p.Ile129Val missense ADAM29 1 82718 1.20893E-5 41359 0 1.65232E-5
4-175897087-GC-G p.Leu139fs frameshift ADAM29 1 82650 1.20992E-5 41325 0 8.259E-6
4-175897089-C-T p.Pro138Leu missense ADAM29 1 82650 1.20992E-5 41325 0 NA
4-175897096-A-G p.Ala140Ala synonymous ADAM29 8 82676 9.67633E-5 41338 0 0.00100705
4-175897104-C-T p.Thr143Ile missense ADAM29 5 82716 6.04478E-5 41358 0 5.03525E-4
4-175897107-C-T p.Thr144Met missense ADAM29 5 82720 6.04449E-5 41360 0 1.65164E-5
4-175897112-G-A p.Glu146Lys missense ADAM29 1 82730 1.20875E-5 41365 0 4.38656E-5
4-175897139-G-A p.Glu155Lys missense ADAM29 30 82704 3.62739E-4 41352 0 4.13986E-4
4-175897150-A-G p.Gln158Gln synonymous ADAM29 1 82680 1.20948E-5 41340 0 8.26296E-6
4-175897168-C-T p.Ser164Ser synonymous ADAM29 8 82688 9.67492E-5 41344 0 3.00377E-4
4-175897168-C-A p.Ser164Ser synonymous ADAM29 1 82688 1.20937E-5 41344 0 3.1837E-5
4-175897169-G-A p.Gly165Arg missense ADAM29 1 82698 1.20922E-5 41349 0 4.00368E-5
4-175897172-T-A p.Phe166Ile missense ADAM29 5 82736 6.04332E-5 41368 0 4.0001E-6
4-175897193-T-G p.Cys173Gly missense ADAM29 1 82834 1.20723E-5 41417 0 NA
4-175897196-C-G p.Arg174Gly missense ADAM29 5 82838 6.03588E-5 41419 0 1.77614E-4
4-175897196-C-T p.Arg174* stop_gained ADAM29 1 82838 1.20718E-5 41419 0 6.37105E-5
4-175897197-G-A p.Arg174Gln missense ADAM29 2 82856 2.41383E-5 41428 0 6.45422E-5
4-175897214-A-G p.Ile180Val missense ADAM29 1 82938 1.20572E-5 41469 0 NA
4-175897218-A-G p.Asp181Gly missense ADAM29 1 82976 1.20517E-5 41488 0 3.18451E-5
4-175897242-C-A p.Ser189Tyr missense ADAM29 1 83066 1.20386E-5 41533 0 8.29132E-6
4-175897245-A-T p.Tyr190Phe missense ADAM29 1 83084 1.2036E-5 41542 0 NA
4-175897246-T-C p.Tyr190Tyr synonymous ADAM29 635 83092 0.00764213 41546 15 0.0141693
4-175897251-G-T p.Gly192Val missense ADAM29 1 83112 1.2032E-5 41556 0 8.28679E-6
4-175897252-C-A p.Gly192Gly synonymous ADAM29 4 83116 4.81255E-5 41558 0 9.11486E-5
4-175897270-G-A p.Arg198Arg synonymous ADAM29 1 83170 1.20236E-5 41585 0 NA
4-175897288-C-T p.Val204Val synonymous ADAM29 6 83180 7.21327E-5 41590 0 5.03525E-4
4-175897289-G-A p.Val205Ile missense ADAM29 2 83174 2.4046E-5 41587 0 3.18634E-5
4-175897294-T-C p.Ile206Ile synonymous ADAM29 1 83186 1.20213E-5 41593 0 3.99087E-6
4-175897295-G-C p.Asp207His missense ADAM29 1 83190 1.20207E-5 41595 0 NA
4-175897304-C-G p.Leu210Val missense ADAM29 5 83218 6.00832E-5 41609 0 6.36699E-5
4-175897310-A-C p.Ile212Leu missense ADAM29 1 83226 1.20155E-5 41613 0 NA
4-175897313-C-T p.Arg213Cys missense ADAM29 3 83230 3.60447E-5 41615 0 4.15407E-5
4-175897314-G-A p.Arg213His missense ADAM29 3 83230 3.60447E-5 41615 0 1.27389E-4
4-175897327-C-T p.Asn217Asn synonymous ADAM29 17 83240 2.04229E-4 41620 0 0.0020141
4-175897328-G-A p.Asp218Asn missense ADAM29 1 83238 1.20137E-5 41619 0 1.66711E-5
4-175897342-G-A p.Leu222Leu synonymous ADAM29 1 83228 1.20152E-5 41614 0 NA
4-175897351-A-G p.Leu225Leu synonymous ADAM29 1 83232 1.20146E-5 41616 0 NA
4-175897355-G-A p.Val227Ile missense ADAM29 6 83238 7.20825E-5 41619 0 NA
4-175897390-C-A p.Val238Val synonymous ADAM29 1 83234 1.20143E-5 41617 0 5.03888E-5
4-175897405-GTTA-G p.Leu245del disruptive_inframe_deletion ADAM29 1 83236 1.2014E-5 41618 0 2.45228E-5
4-175897448-G-A p.Val258Ile missense ADAM29 2 83186 2.40425E-5 41593 0 3.18552E-5
4-175897460-G-A p.Val262Ile missense ADAM29 1 83160 1.2025E-5 41580 0 4.00683E-6
4-175897470-C-A p.Ser265Tyr missense ADAM29 1 83142 1.20276E-5 41571 0 4.02227E-6
4-175897483-T-C p.Tyr269Tyr synonymous ADAM29 1 83076 1.20372E-5 41538 0 NA
4-175897497-C-T p.Ser274Leu missense ADAM29 1 82996 1.20488E-5 41498 0 8.1469E-6
4-175897498-G-A p.Ser274Ser synonymous ADAM29 1 82998 1.20485E-5 41499 0 3.18695E-5
4-175897509-C-T p.Thr278Met missense ADAM29 7 82972 8.43658E-5 41486 0 5.03525E-4
4-175897510-G-A p.Thr278Thr synonymous ADAM29 1 82930 1.20584E-5 41465 0 0.00125
4-175897514-C-T p.Arg280Trp missense ADAM29 2 82922 2.41191E-5 41461 0 2.5545E-5
4-175897515-G-A p.Arg280Gln missense ADAM29 2 82916 2.41208E-5 41458 0 4.59505E-5
4-175897520-C-A p.Gln282Lys missense ADAM29 1 82894 1.20636E-5 41447 0 NA
4-175897525-T-G p.His283Gln missense ADAM29 1 82854 1.20694E-5 41427 0 2.56581E-5
4-175897538-C-A p.Leu288Ile missense ADAM29 3 82804 3.62301E-5 41402 0 NA
4-175897543-C-T p.Phe289Phe synonymous ADAM29 1 82794 1.20782E-5 41397 0 NA
4-175897561-A-G p.Arg295Arg synonymous ADAM29 16 82790 1.9326E-4 41395 0 2.5481E-4
4-175897563-G-A p.Gly296Glu missense ADAM29 1 82786 1.20793E-5 41393 0 NA
4-175897573-C-G p.Gly299Gly synonymous ADAM29 4 82830 4.82917E-5 41415 0 3.18512E-5
4-175897592-A-G p.Met306Val missense ADAM29 2 82922 2.41191E-5 41461 0 3.18471E-5
4-175897599-C-T p.Thr308Ile missense ADAM29 53 82918 6.39186E-4 41459 0 0.00151057
4-175897600-A-C p.Thr308Thr synonymous ADAM29 3 82924 3.61777E-5 41462 0 8.59904E-6
4-175897608-G-A p.Arg311His missense ADAM29 5 82932 6.02904E-5 41466 0 6.25E-4
4-175897609-T-C p.Arg311Arg synonymous ADAM29 1 82936 1.20575E-5 41468 0 NA
4-175897626-C-A p.Thr317Asn missense ADAM29 2 82986 2.41005E-5 41493 0 NA
4-175897627-T-C p.Thr317Thr synonymous ADAM29 1 82996 1.20488E-5 41498 0 8.52268E-6
4-175897628-T-C p.Phe318Leu missense ADAM29 1 83000 1.20482E-5 41500 0 4.02424E-6
4-175897631-A-T p.Met319Leu missense ADAM29 1 82988 1.20499E-5 41494 0 NA
4-175897637-A-G p.Lys321Glu missense ADAM29 1 82968 1.20528E-5 41484 0 NA
4-175897656-C-T p.Ser327Leu missense ADAM29 1 82948 1.20557E-5 41474 0 4.03125E-6
4-175897661-G-T p.Ala329Ser missense ADAM29 3 82928 3.6176E-5 41464 0 1.703E-5
4-175897667-G-A p.Ala331Thr missense ADAM29 3 82914 3.61821E-5 41457 0 3.40925E-5
4-175897670-C-T p.His332Tyr missense ADAM29 3 82904 3.61864E-5 41452 0 4.05637E-6
4-175897673-C-T p.His333Tyr missense ADAM29 2 82902 2.41249E-5 41451 0 8.53679E-6
4-175897699-C-T p.Asn341Asn synonymous ADAM29 27 82800 3.26087E-4 41400 0 1.63424E-4
4-175897702-T-C p.His342His synonymous ADAM29 1 82788 1.2079E-5 41394 0 7.54337E-5
4-175897719-G-A p.Arg348His missense ADAM29 10 82694 1.20928E-4 41347 0 1.59246E-4
4-175897723-T-C p.Cys349Cys synonymous ADAM29 2 82670 2.41926E-5 41335 0 6.25E-4
4-175897728-A-G p.Gln351Arg missense ADAM29 2 82672 2.4192E-5 41336 0 3.1841E-5
4-175897739-A-G p.Ile355Val missense ADAM29 1 82662 1.20975E-5 41331 0 8.59771E-6
4-175897759-A-C p.Pro361Pro synonymous ADAM29 1 82638 1.2101E-5 41319 0 NA
4-175897772-T-A p.Phe366Ile missense ADAM29 2 82740 2.41721E-5 41370 0 8.49502E-6
4-175897777-C-T p.Ser367Ser synonymous ADAM29 2 82766 2.41645E-5 41383 0 2.54267E-5
4-175897782-G-T p.Cys369Phe missense ADAM29 6 82842 7.2427E-5 41421 0 2.53233E-5
4-175897785-G-A p.Ser370Asn missense ADAM29 1 82900 1.20627E-5 41450 0 4.00285E-6
4-175897791-G-A p.Gly372Asp missense ADAM29 2 82960 2.4108E-5 41480 0 8.38701E-6
4-175897791-G-C p.Gly372Ala missense ADAM29 1 82960 1.2054E-5 41480 0 3.99789E-6
4-175897792-T-C p.Gly372Gly synonymous ADAM29 1 82976 1.20517E-5 41488 0 NA
4-175897793-G-A p.Asp373Asn missense ADAM29 1 82984 1.20505E-5 41492 0 NA
4-175897799-T-G p.Trp375Gly missense ADAM29 1 83042 1.20421E-5 41521 0 3.18451E-5
4-175897801-G-A p.Trp375* stop_gained ADAM29 1 83060 1.20395E-5 41530 0 2.5E-5
4-175897810-T-C p.Thr378Thr synonymous ADAM29 2 83112 2.40639E-5 41556 0 3.98597E-6
4-175897814-G-A p.Glu380Lys missense ADAM29 7 83134 8.42014E-5 41567 0 1.59398E-5
4-175897815-A-G p.Glu380Gly missense ADAM29 2 83144 2.40547E-5 41572 0 1.19561E-5
4-175897825-G-A p.Lys383Lys synonymous ADAM29 3 83188 3.60629E-5 41594 0 8.2905E-6
4-175897832-C-T p.Leu386Phe missense ADAM29 1 83196 1.20198E-5 41598 0 6.25E-4
4-175897842-T-A p.Val389Glu missense ADAM29 2 83224 2.40315E-5 41612 0 NA
4-175897845-A-G p.His390Arg missense ADAM29 1 83230 1.20149E-5 41615 0 3.1837E-5
4-175897846-C-A p.His390Gln missense ADAM29 2 83228 2.40304E-5 41614 0 3.31274E-5
4-175897849-A-C p.Thr391Thr synonymous ADAM29 1 83222 1.20161E-5 41611 0 3.1841E-5
4-175897854-A-G p.Asp393Gly missense ADAM29 1 83232 1.20146E-5 41616 0 NA
4-175897864-T-G p.Asn396Lys missense ADAM29 1 83234 1.20143E-5 41617 0 NA
4-175897866-T-C p.Val397Ala missense ADAM29 1 83234 1.20143E-5 41617 0 NA
4-175897871-C-T p.Arg399Cys missense ADAM29 1 83220 1.20163E-5 41610 0 8.28075E-6
4-175897872-G-A p.Arg399His missense ADAM29 2 83222 2.40321E-5 41611 0 6.36699E-5
4-175897879-G-A p.Gly401Gly synonymous ADAM29 9 83208 1.08163E-4 41604 0 9.55171E-5
4-175897883-G-A p.Gly403Ser missense ADAM29 1 83202 1.20189E-5 41601 0 3.18471E-5
4-175897892-GA-G p.Glu407fs frameshift ADAM29 1 83136 1.20285E-5 41568 0 NA
4-175897894-A-C p.Glu406Asp missense ADAM29 1 83138 1.20282E-5 41569 0 NA
4-175897895-G-T p.Glu407* stop_gained ADAM29 1 83130 1.20294E-5 41565 0 NA
4-175897907-T-A p.Cys411Ser missense ADAM29 5 83028 6.02206E-5 41514 0 2.47868E-5
4-175897916-G-A p.Gly414Arg missense ADAM29 1 82956 1.20546E-5 41478 0 NA
4-175897927-G-A p.Lys417Lys synonymous ADAM29 14 82866 1.68947E-4 41433 0 8.76571E-5
4-175897929-A-G p.His418Arg missense ADAM29 1 82856 1.20691E-5 41428 0 9.55536E-5
4-175897935-CA-C p.Asp422fs frameshift ADAM29 1 82810 1.20758E-5 41405 0 NA
4-175897939-A-C p.Lys421Asn missense ADAM29 10 82796 1.20779E-4 41398 0 2.22944E-4
4-175897939-A-AATCAC p.Asp422fs frameshift ADAM29 1 82794 1.20782E-5 41397 0 NA
4-175897940-G-C p.Asp422His missense ADAM29 1 82768 1.2082E-5 41384 0 NA
4-175897950-G-C p.Cys425Ser missense ADAM29 1 82734 1.20869E-5 41367 0 1.19547E-5
4-175897956-C-G p.Ser427* stop_gained ADAM29 10 82736 1.20866E-4 41368 0 6.7735E-5
4-175897967-C-CT p.Thr432fs frameshift ADAM29 1 82744 1.20855E-5 41372 0 NA
4-175897968-T-C p.Leu431Pro missense ADAM29 2 82744 2.41709E-5 41372 0 NA
4-175897984-T-C p.Thr436Thr synonymous ADAM29 1 82766 1.20823E-5 41383 0 3.98289E-6
4-175897989-C-T p.Ala438Val missense ADAM29 7 82798 8.45431E-5 41399 0 4.28484E-4
4-175897990-T-G p.Ala438Ala synonymous ADAM29 2 82826 2.4147E-5 41413 0 6.36862E-5
4-175897993-T-C p.Phe439Phe synonymous ADAM29 2 82846 2.41412E-5 41423 0 1.59289E-5
4-175898002-T-C p.Cys442Cys synonymous ADAM29 18 82908 2.17108E-4 41454 0 9.55353E-5
4-175898014-C-A p.Cys446* stop_gained ADAM29 1 82964 1.20534E-5 41482 0 NA
4-175898017-G-A p.Lys447Lys synonymous ADAM29 2 82984 2.4101E-5 41492 0 2.38865E-5
4-175898020-C-T p.Phe448Phe synonymous ADAM29 2 83004 2.40952E-5 41502 0 8.24076E-6
4-175898026-A-C p.Pro450Pro synonymous ADAM29 1 83024 1.20447E-5 41512 0 NA
4-175898026-A-G p.Pro450Pro synonymous ADAM29 1 83024 1.20447E-5 41512 0 2.47247E-5
4-175898045-AAGG-A p.Glu458del disruptive_inframe_deletion ADAM29 1 83048 1.20412E-5 41524 0 8.24185E-6
4-175898060-T-C p.Cys462Arg missense ADAM29 2 83054 2.40807E-5 41527 0 NA
4-175898078-T-G p.Cys468Gly missense ADAM29 4 83010 4.8187E-5 41505 0 NA
4-175898092-C-G p.Ser472Ser synonymous ADAM29 1 82960 1.2054E-5 41480 0 NA
4-175898095-T-C p.His473His synonymous ADAM29 6 82938 7.23432E-5 41469 0 1.19525E-5
4-175898101-C-T p.Cys475Cys synonymous ADAM29 1 82896 1.20633E-5 41448 0 6.37308E-5
4-175898108-G-A p.Asp478Asn missense ADAM29 2 82890 2.41284E-5 41445 0 NA
4-175898116-T-C p.Tyr480Tyr synonymous ADAM29 1 82892 1.20639E-5 41446 0 NA
4-175898124-A-T p.Asp483Val missense ADAM29 1 82812 1.20755E-5 41406 0 NA
4-175898134-C-G p.Pro486Pro synonymous ADAM29 2 82774 2.41622E-5 41387 0 1.19525E-5
4-175898146-G-A p.Arg490Arg synonymous ADAM29 1 82706 1.2091E-5 41353 0 NA
4-175898149-C-A p.Gly491Gly synonymous ADAM29 2 82688 2.41873E-5 41344 0 NA
4-175898152-C-T p.Tyr492Tyr synonymous ADAM29 2 82688 2.41873E-5 41344 0 NA
4-175898158-T-C p.Tyr494Tyr synonymous ADAM29 1 82676 1.20954E-5 41338 0 3.29755E-5
4-175898178-G-A p.Arg501His missense ADAM29 6 82608 7.26322E-5 41304 0 6.59979E-5
4-175898179-C-T p.Arg501Arg synonymous ADAM29 1 82630 1.21021E-5 41315 0 NA
4-175898188-G-A p.Gln504Gln synonymous ADAM29 1 82614 1.21045E-5 41307 0 1.99327E-5
4-175898189-T-C p.Cys505Arg missense ADAM29 2 82616 2.42084E-5 41308 0 1.65063E-5
4-175898199-T-G p.Ile508Ser missense ADAM29 2 82578 2.42195E-5 41289 0 NA
4-175898203-T-C p.Phe509Phe synonymous ADAM29 5 82544 6.05738E-5 41272 0 1.81641E-4
4-175898204-G-A p.Gly510Ser missense ADAM29 1 82534 1.21162E-5 41267 0 3.18695E-5
4-175898212-C-T p.Gly512Gly synonymous ADAM29 1 82494 1.21221E-5 41247 0 1.65248E-5
4-175898216-A-G p.Asn514Asp missense ADAM29 9 82526 1.09057E-4 41263 0 1.59205E-4
4-175898225-A-G p.Ser517Gly missense ADAM29 1 82526 1.21174E-5 41263 0 NA
4-175898245-A-T p.Glu523Asp missense ADAM29 1 82552 1.21136E-5 41276 0 NA
4-175898254-C-A p.Thr526Thr synonymous ADAM29 3 82544 3.63443E-5 41272 0 2.15652E-4
4-175898258-G-A p.Gly528Ser missense ADAM29 8 82548 9.69133E-5 41274 0 3.59356E-5
4-175898264-C-T p.Arg530Cys missense ADAM29 1 82540 1.21153E-5 41270 0 9.5511E-5
4-175898265-G-A p.Arg530His missense ADAM29 7 82558 8.47889E-5 41279 0 4.13066E-5
4-175898270-G-T p.Gly532Cys missense ADAM29 2 82568 2.42225E-5 41284 0 NA
4-175898284-C-T p.Ile536Ile synonymous ADAM29 1 82588 1.21083E-5 41294 0 3.99163E-5
4-175898295-C-T p.Thr540Ile missense ADAM29 1 82678 1.20951E-5 41339 0 3.98921E-6
4-175898307-G-A p.Cys544Tyr missense ADAM29 1 82758 1.20834E-5 41379 0 NA
4-175898308-T-C p.Cys544Cys synonymous ADAM29 1 82772 1.20814E-5 41386 0 6.3674E-5
4-175898329-T-G p.Cys551Trp missense ADAM29 1 82862 1.20683E-5 41431 0 NA
4-175898330-G-A p.Gly552Arg missense ADAM29 1 82872 1.20668E-5 41436 0 NA
4-175898343-G-T p.Cys556Phe missense ADAM29 1 82876 1.20662E-5 41438 0 NA
4-175898345-G-A p.Glu557Lys missense ADAM29 6 82878 7.23956E-5 41439 0 5.03525E-4
4-175898356-A-G p.Thr560Thr synonymous ADAM29 1 82932 1.20581E-5 41466 0 NA
4-175898378-C-T p.His568Tyr missense ADAM29 1 82966 1.20531E-5 41483 0 NA
4-175898392-T-C p.His572His synonymous ADAM29 2 83010 2.40935E-5 41505 0 NA
4-175898399-C-A p.Arg575Ser missense ADAM29 1 83032 1.20435E-5 41516 0 NA
4-175898399-C-T p.Arg575Cys missense ADAM29 1 83032 1.20435E-5 41516 0 5.03525E-4
4-175898408-G-C p.Asp578His missense ADAM29 2 83092 2.40697E-5 41546 0 NA
4-175898410-C-T p.Asp578Asp synonymous ADAM29 14 83078 1.68516E-4 41539 0 9.55779E-5
4-175898412-T-C p.Ile579Thr missense ADAM29 1 83082 1.20363E-5 41541 0 7.96775E-6
4-175898418-G-A p.Cys581Tyr missense ADAM29 1 83114 1.20317E-5 41557 0 3.98454E-6
4-175898435-C-A p.His587Asn missense ADAM29 4 83156 4.81024E-5 41578 0 NA
4-175898453-C-G p.Pro593Ala missense ADAM29 2 83176 2.40454E-5 41588 0 2.47361E-5
4-175898476-T-G p.Asp600Glu missense ADAM29 1 83174 1.2023E-5 41587 0 NA
4-175898482-A-C p.Thr602Thr synonymous ADAM29 3 83158 3.60759E-5 41579 0 3.18512E-5
4-175898493-TAG-T p.Asp607fs frameshift ADAM29 3 83084 3.6108E-5 41542 0 1.64891E-5
4-175898497-T-TTA p.His608fs frameshift ADAM29 2 83020 2.40906E-5 41510 0 1.64908E-5
4-175898498-C-CACTTT p.Ile609fs frameshift ADAM29 2 83028 2.40883E-5 41514 0 8.2447E-6
4-175898514-GGCAC-G p.Arg613fs frameshift ADAM29 1 82914 1.20607E-5 41457 0 NA
4-175898526-A-C p.His617Pro missense ADAM29 1 82792 1.20785E-5 41396 0 NA
4-175898534-A-G p.Ile620Val missense ADAM29 4 82718 4.83571E-5 41359 0 9.55597E-5
4-175898546-A-G p.Asn624Asp missense ADAM29 1 82624 1.2103E-5 41312 0 7.97563E-6
4-175898553-C-CTGAAATATTGATAGGGAAAAGGGAATAGGGAGTGT p.Pro627fs frameshift ADAM29 1 82582 1.21092E-5 41291 0 NA
4-175898554-A-C p.Ser626Ser synonymous ADAM29 6 82584 7.26533E-5 41292 0 3.29968E-5
4-175898555-C-T p.Pro627Ser missense ADAM29 679 82566 0.00822372 41283 48 0.0225314
4-175898557-T-C p.Pro627Pro synonymous ADAM29 1 82550 1.21139E-5 41275 0 NA
4-175898566-T-A p.Cys630* stop_gained ADAM29 22 82564 2.6646E-4 41282 0 5.7771E-5
4-175898569-C-A p.Asn631Lys missense ADAM29 2 82576 2.42201E-5 41288 0 8.25587E-6
4-175898579-A-C p.Ile635Leu missense ADAM29 5 82598 6.05342E-5 41299 0 2.7935E-5
4-175898583-GC-G p.Cys636fs frameshift ADAM29 1 82614 1.21045E-5 41307 0 1.65134E-5
4-175898583-G-GAGATATTA p.Cys636fs frameshift ADAM29 1 82618 1.21039E-5 41309 0 NA
4-175898585-A-AGATATT p.Asn637delinsArgTyrTyr disruptive_inframe_insertion ADAM29 1 82622 1.21033E-5 41311 0 1.65218E-5
4-175898590-T-C p.Asn638Asn synonymous ADAM29 1 82664 1.20972E-5 41332 0 8.25846E-6
4-175898595-A-T p.His640Leu missense ADAM29 1 82682 1.20945E-5 41341 0 8.26187E-6
4-175898598-A-T p.His641Leu missense ADAM29 7 82692 8.46515E-5 41346 0 1.65186E-5
4-175898610-A-G p.Asn645Ser missense ADAM29 1 82722 1.20887E-5 41361 0 8.26296E-6
4-175898613-A-T p.Tyr646Phe missense ADAM29 4 82694 4.83711E-5 41347 0 2.79116E-5
4-175898623-C-T p.Asp649Asp synonymous ADAM29 3 82678 3.62853E-5 41339 0 0.00100705
4-175898631-A-G p.Asn652Ser missense ADAM29 2 82668 2.41932E-5 41334 0 3.98928E-6
4-175898632-C-A p.Asn652Lys missense ADAM29 1 82660 1.20978E-5 41330 0 3.18573E-5
4-175898634-G-A p.Cys653Tyr missense ADAM29 1 82648 1.20995E-5 41324 0 NA
4-175898640-T-A p.Ile655Lys missense ADAM29 1 82668 1.20966E-5 41334 0 3.98972E-6
4-175898642-A-C p.Lys656Gln missense ADAM29 1 82652 1.20989E-5 41326 0 NA
4-175898650-T-C p.Tyr658Tyr synonymous ADAM29 2 82630 2.42043E-5 41315 0 3.1839E-5
4-175898655-G-A p.Gly660Asp missense ADAM29 1 82592 1.21077E-5 41296 0 3.18512E-5
4-175898662-T-C p.Val662Val synonymous ADAM29 1 82534 1.21162E-5 41267 0 NA
4-175898673-C-CA p.Pro667fs frameshift ADAM29 1 82428 1.21318E-5 41214 0 NA
4-175898674-A-T p.Pro666Pro synonymous ADAM29 1 82424 1.21324E-5 41212 0 1.20152E-5
4-175898696-A-T p.Lys674* stop_gained ADAM29 1 82238 1.21598E-5 41119 0 8.3797E-6
4-175898708-T-C p.Tyr678His missense ADAM29 4 82220 4.865E-5 41110 0 1.68152E-5
4-175898709-A-C p.Tyr678Ser missense ADAM29 1 82224 1.21619E-5 41112 0 8.40845E-6
4-175898710-T-C p.Tyr678Tyr synonymous ADAM29 137 82220 0.00166626 41110 1 0.00397988
4-175898718-T-C p.Ile681Thr missense ADAM29 1 82290 1.21521E-5 41145 0 2.52981E-5
4-175898726-CTTA-C p.Ile685del conservative_inframe_deletion ADAM29 2 82362 2.4283E-5 41181 0 NA
4-175898726-C-T p.Leu684Phe missense ADAM29 4 82362 4.85661E-5 41181 0 3.19061E-5
4-175898731-T-G p.Ile685Met missense ADAM29 2 82428 2.42636E-5 41214 0 3.37365E-5
4-175898734-T-C p.Val686Val synonymous ADAM29 1 82460 1.21271E-5 41230 0 NA
4-175898735-T-G p.Leu687Val missense ADAM29 2 82466 2.42524E-5 41233 0 NA
4-175898743-TTTA-T p.Leu691del disruptive_inframe_deletion ADAM29 1629 82506 0.019744 41253 25 0.147327
4-175898761-T-C p.Tyr695Tyr synonymous ADAM29 2 82720 2.41779E-5 41360 0 NA
4-175898763-G-A p.Arg696Gln missense ADAM29 1 82728 1.20878E-5 41364 0 8.40492E-6
4-175898770-T-TA p.Ser701fs frameshift ADAM29 2 82796 2.41558E-5 41398 0 5.03525E-4
4-175898770-TA-T p.Ser701fs frameshift ADAM29 2 82796 2.41558E-5 41398 0 8.39349E-6
4-175898783-C-T p.Pro703Ser missense ADAM29 2 82946 2.41121E-5 41473 0 NA
4-175898793-A-C p.Lys706Thr missense ADAM29 2 82992 2.40987E-5 41496 0 NA
4-175898801-G-C p.Asp709His missense ADAM29 1 83008 1.2047E-5 41504 0 8.28089E-6
4-175898811-C-T p.Thr712Ile missense ADAM29 14 83028 1.68618E-4 41514 0 2.54696E-4
4-175898828-G-A p.Glu718Lys missense ADAM29 3 83000 3.61446E-5 41500 0 8.24538E-6
4-175898831-GA-G p.Ile721fs frameshift ADAM29 1 82982 1.20508E-5 41491 0 NA
4-175898837-A-T p.Ile721Phe missense ADAM29 1 82966 1.20531E-5 41483 0 3.1839E-5
4-175898838-T-A p.Ile721Asn missense ADAM29 1 82948 1.20557E-5 41474 0 1.99111E-5
4-175898843-C-T p.Arg723Cys missense ADAM29 2 82946 2.41121E-5 41473 0 1.2738E-4
4-175898844-G-A p.Arg723His missense ADAM29 10 82944 1.20563E-4 41472 0 5.03525E-4
4-175898847-G-A p.Arg724Gln missense ADAM29 8 82958 9.64343E-5 41479 0 6.37242E-5
4-175898856-A-G p.Glu727Gly missense ADAM29 5 82936 6.02874E-5 41468 0 1.59281E-5
4-175898858-T-A p.Leu728Ile missense ADAM29 2 82926 2.41179E-5 41463 0 NA
4-175898860-A-G p.Leu728Leu synonymous ADAM29 1 82920 1.20598E-5 41460 0 NA
4-175898861-C-T p.Pro729Ser missense ADAM29 1 82918 1.20601E-5 41459 0 NA
4-175898865-C-G p.Pro730Arg missense ADAM29 1 82940 1.20569E-5 41470 0 NA
4-175898869-G-C p.Gln731His missense ADAM29 1 82900 1.20627E-5 41450 0 NA
4-175898870-A-C p.Ser732Arg missense ADAM29 3 82890 3.61925E-5 41445 0 NA
4-175898876-C-A p.Pro734Thr missense ADAM29 4 82876 4.82649E-5 41438 0 9.55475E-5
4-175898877-C-T p.Pro734Leu missense ADAM29 1 82882 1.20653E-5 41441 0 NA
4-175898878-TTGGGTGATGCCTTCCCAGAGTCAACCTCCTGTGA-T p.Trp735fs frameshift ADAM29 102 82874 0.00123078 41437 1 0.0032789
4-175898879-T-C p.Trp735Arg missense ADAM29 10 82870 1.20671E-4 41435 0 0.0140987
4-175898880-GGGTGATGCCTTCCCAGAGTCAACCTCCTGTGACGCCTTCCCAGAGTCATCCTCA-G p.Pro747_Thr764del disruptive_inframe_deletion ADAM29 1 82876 1.20662E-5 41438 0 2.49605E-5
4-175898882-G-A p.Val736Met missense ADAM29 9 82884 1.08585E-4 41442 0 4.16119E-5
4-175898882-G-T p.Val736Leu missense ADAM29 1 82884 1.20651E-5 41442 0 NA
4-175898883-T-C p.Val736Ala missense ADAM29 21 82890 2.53348E-4 41445 0 1.99098E-4
4-175898888-C-T p.Pro738Ser missense ADAM29 8 82900 9.65018E-5 41450 0 5.97238E-5
4-175898907-C-A p.Pro744His missense ADAM29 1 82916 1.20604E-5 41458 0 NA
4-175898913-C-T p.Thr746Met missense ADAM29 35 82900 4.22195E-4 41450 0 0.00438322
4-175898914-G-A p.Thr746Thr synonymous ADAM29 193 82832 0.00233002 41416 4 0.0120846
4-175898914-GCCTTCCCAGAGTCATCCTCA-G p.Pro747fs frameshift ADAM29 179 82900 0.00215923 41450 1 0.00334751
4-175898917-T-C p.Pro747Pro synonymous ADAM29 2 82924 2.41185E-5 41462 0 0.00855992
4-175898929-TCCTCAGGTGATGCCTTCCCAGAGTCAACCTCCTGTGACACCCTCCCAGAGTCAA-T p.Gln753_Pro770del disruptive_inframe_deletion ADAM29 15 82930 1.80875E-4 41465 0 0.00293766
4-175898929-T-A p.His751Gln missense ADAM29 1 82878 1.20659E-5 41439 0 0.0140987
4-175898934-A-G p.Gln753Arg missense ADAM29 41 82710 4.95708E-4 41355 3 0.0171198
4-175898934-A-AGGTGATGCCTTCCCAGAGTCAACCTCCTGTGACACCCTCCCAGAGTCAACCTCG p.Ser775_Gln776insGlnSerGlnProProValThrProSerGlnSerGlnProArgValMetProSer disruptive_inframe_insertion ADAM29 3 82952 3.61655E-5 41476 0 NA
4-175898934-AGGTGATGCCTTCCCAGAGTCAACCTCCTGTGACACCCTCCCAGAGTCAACCTCG-A p.Gln758_Ser775del disruptive_inframe_deletion ADAM29 2 82952 2.41103E-5 41476 0 NA
4-175898940-T-C p.Met755Thr missense ADAM29 5 82934 6.02889E-5 41467 0 0.00187617
4-175898942-C-G p.Pro756Ala missense ADAM29 1 82944 1.20563E-5 41472 0 NA
4-175898942-C-T p.Pro756Ser missense ADAM29 1 82944 1.20563E-5 41472 0 NA
4-175898946-C-T p.Ser757Phe missense ADAM29 25 82942 3.01415E-4 41471 0 0.00151057
4-175898947-C-T p.Ser757Ser synonymous ADAM29 21 82680 2.53991E-4 41340 2 0.00352467
4-175898952-G-A p.Ser759Asn missense ADAM29 1 82964 1.20534E-5 41482 0 3.9821E-6
4-175898967-C-T p.Thr764Ile missense ADAM29 25 82736 3.02166E-4 41368 3 0.00114424
4-175898968-A-G p.Thr764Thr synonymous ADAM29 29 82734 3.50521E-4 41367 3 0.00302115
4-175898968-A-ACCCTCCCAGAGTCAACCTCGGGTGATGCCTTCCCAGAGTCAACCTCCTGTGACG p.Ser775_Gln776insGlnSerGlnProProValThrProSerGlnSerGlnProArgValMetProSer disruptive_inframe_insertion ADAM29 1 82984 1.20505E-5 41492 0 NA
4-175898971-C-T p.Pro765Pro synonymous ADAM29 11 82722 1.32976E-4 41361 2 0.00352467
4-175898971-CTCCCAGAGTCAACCTCGGGTGATGCCT-C p.Gln767_Ser775del disruptive_inframe_deletion ADAM29 9 83004 1.08429E-4 41502 0 7.04879E-5
4-175898975-CAGAGTCAACCTCGGGTGATGCCTTCTCAGAGTCAACCTCCTGTGATGCCTTCCCAGAGTCATCCTCAGTTGACGCCTTCCCAGAGTCAACCTCCTGTGACACCCTCCCAGAGGCAACCTCAGTTGATGCCTTCCCAGAGTCAACCTCCTGTGACGCCCTCCT-C p.Ser768_Ter821delins??? stop_lost ADAM29 42 82972 5.06195E-4 41486 1 1.23439E-4
4-175898976-A-G p.Gln767Arg missense ADAM29 1 83028 1.20441E-5 41514 0 7.96337E-6
4-175898980-T-C p.Ser768Ser synonymous ADAM29 2 82994 2.40981E-5 41497 0 7.02099E-5
4-175898983-A-T p.Gln769His missense ADAM29 13 82758 1.57085E-4 41379 2 0.0040282
4-175898987-C-T p.Arg771Trp missense ADAM29 6 83040 7.22543E-5 41520 0 9.57488E-5
4-175898988-G-A p.Arg771Gln missense ADAM29 18 82722 2.17596E-4 41361 3 0.00453172
4-175898990-G-T p.Val772Leu missense ADAM29 35 82764 4.22889E-4 41382 3 0.00453172
4-175898994-T-C p.Met773Thr missense ADAM29 46 82826 5.55381E-4 41413 4 0.00654582
4-175898994-T-TGCCTTCTCAGAGTCAACCTCCTGTGATGCCTTCCCAGAGTCATCCTCAGTTGAC p.Ser793_Gln794insGlnSerGlnProProValMetProSerGlnSerHisProGlnLeuThrProSer disruptive_inframe_insertion ADAM29 1 83058 1.20398E-5 41529 0 4.66784E-6
4-175899001-T-TCAGAGTCAACCTCCTGTGATGCCTTCCCAGAGTCATCCTCAGTTGACGCCTTCC p.Met782_Val799dup disruptive_inframe_insertion ADAM29 10334 82362 0.12547 41181 1106 0.119232
4-175899001-T-C p.Ser775Ser synonymous ADAM29 184 82846 0.00222099 41423 6 0.0558912
4-175899001-T-TCAGAGTCAACCTCCTGTGACGCCTTCCCAGAGTCATCCTCAGTTGACGCCTTCC p.Val781_Met782insThrProSerGlnSerHisProGlnLeuThrProSerGlnSerGlnProProVal disruptive_inframe_insertion ADAM29 1 83080 1.20366E-5 41540 0 1.09087E-4
4-175899001-T-TCAGAGTCAACCTCCTGTGATGCCTTCCCAGAGTCATCCTCAGTTGATGCCTTCC p.Met773_Leu790dup disruptive_inframe_insertion ADAM29 2 83088 2.40709E-5 41544 0 NA
4-175899005-A-T p.Ser777Cys missense ADAM29 2 83098 2.4068E-5 41549 0 8.26132E-6
4-175899021-T-C p.Met782Thr missense ADAM29 3452 82916 0.0416325 41458 381 0.0905574
4-175899022-G-A p.Met782Ile missense ADAM29 2 83102 2.40668E-5 41551 0 1.31807E-4
4-175899023-C-G p.Pro783Ala missense ADAM29 4 83096 4.81371E-5 41548 0 2.47419E-5
4-175899025-T-C p.Pro783Pro synonymous ADAM29 2 83108 2.40651E-5 41554 0 1.31952E-4
4-175899027-C-T p.Ser784Phe missense ADAM29 3 83122 3.60915E-5 41561 0 6.38407E-5
4-175899028-C-A p.Ser784Ser synonymous ADAM29 80 83120 9.62464E-4 41560 1 0.00159408
4-175899032-A-C p.Ser786Arg missense ADAM29 1 83102 1.20334E-5 41551 0 NA
4-175899037-T-TCCTCAGTTGACGCCTTCCCAGAGTCAACCTCCTGTGATGCCTTCCCAGAGTCAA p.Val799_Thr800insMetProSerGlnSerGlnProGlnLeuThrProSerGlnSerGlnProProVal disruptive_inframe_insertion ADAM29 1 83090 1.20351E-5 41545 0 3.98096E-6
4-175899042-A-C p.Gln789Pro missense ADAM29 1 83120 1.20308E-5 41560 0 NA
4-175899048-C-T p.Thr791Met missense ADAM29 1 83112 1.2032E-5 41556 0 5.03525E-4
4-175899048-CGCCTTCCCAGAGTCAACCTCCTGTGACACCCTCCCAGAGGCAACCTCAGTTGAT-C p.Pro801_Thr818del disruptive_inframe_deletion ADAM29 10 83108 1.20325E-4 41554 0 2.58649E-4
4-175899048-C-CGCCTTCCCAGAGTCAACCTCCTGTGACACCCTCCCAGAGGCAACCTCAGTTGAT p.Thr818_Pro819insProSerGlnArgGlnProGlnLeuMetProSerGlnSerGlnProProValThr disruptive_inframe_insertion ADAM29 1 83112 1.2032E-5 41556 0 3.23311E-5
4-175899048-C-CGCCTTCCCAGAGTCAACCTCCTGTGATGCCTTCCCAGAGTCATCCTCAGTTGAT p.Val799_Thr800insMetProSerGlnSerHisProGlnLeuMetProSerGlnSerGlnProProVal disruptive_inframe_insertion ADAM29 1 83112 1.2032E-5 41556 0 NA
4-175899049-G-A p.Thr791Thr synonymous ADAM29 2 83116 2.40628E-5 41558 0 1.07301E-4
4-175899051-C-A p.Pro792His missense ADAM29 1 83124 1.20302E-5 41562 0 NA
4-175899071-GTGACACCCTCCCAGAGGCAACCTCAGT-G p.Thr800_Leu808del disruptive_inframe_deletion ADAM29 12 82994 1.44589E-4 41497 0 0.00426692
4-175899075-C-T p.Thr800Ile missense ADAM29 181 82282 0.00219975 41141 0 0.08518
4-175899075-CA-TG p.Thr800Met missense ADAM29 1 83132 1.20291E-5 41566 0 NA
4-175899076-A-G p.Thr800Thr synonymous ADAM29 132 82164 0.00160654 41082 0 0.0860145
4-175899076-ACCCTCCCAGAGGCAACCTCAGTTGATGCCTTCCCAGAGTCAACCTCCTGTGACG-A p.Gln803_Ser820del conservative_inframe_deletion ADAM29 5 83140 6.01395E-5 41570 0 6.26581E-4
4-175899079-C-T p.Pro801Pro synonymous ADAM29 140 82202 0.00170312 41101 0 0.0840984
4-175899083-C-T p.Gln803* stop_gained ADAM29 5 83128 6.01482E-5 41564 0 0.00100705
4-175899083-CAGAGGCAACCTCAGTTGATGCCTTCCCAGAGTCAACCTCCTGTGACGCCCTCCT-C p.Arg804_Ter821delins??? stop_lost ADAM29 1 83130 1.20294E-5 41565 0 9.97904E-5
4-175899088-G-T p.Arg804Ser missense ADAM29 41 82142 4.99136E-4 41071 0 0.0796565
4-175899088-GCAACCTCAGTTGATGCCTTCCCAGAGTCAACCTCCTGTGACGCCCTCCTAGAGC-G p.Ter821del stop_lost ADAM29 11 83096 1.32377E-4 41548 0 7.08177E-4
4-175899088-G-GCAACCTCAGTTGATGCCTTCCCAGGGTCAACCTCCTGTGACGCCCTCCTAGAGC p.Gln812_Ser813insGlyGlnProProValThrProSerTerSerGlnProGlnLeuMetProSerGln stop_gained ADAM29 15 82874 1.80998E-4 41437 2 0.00251965
4-175899088-G-C p.Arg804Ser missense ADAM29 4 83096 4.81371E-5 41548 0 6.27499E-5
4-175899088-G-GCAACCTCAGTTGATGCCTTCCCAGAGTCAACCTCCTGTGACGCCCTCCCAGAGC p.Ser820_Ter821insGlnSerGlnProGlnLeuMetProSerGlnSerGlnProProValThrProSer conservative_inframe_insertion ADAM29 1 83100 1.20337E-5 41550 0 5.03931E-5
4-175899091-A-T p.Gln805His missense ADAM29 25 82240 3.03988E-4 41120 0 0.0789259
4-175899095-C-T p.Gln807* stop_gained ADAM29 1 83116 1.20314E-5 41558 0 3.20328E-5
4-175899102-T-C p.Met809Thr missense ADAM29 9 82720 1.08801E-4 41360 0 0.0511081
4-175899110-CA-C p.Gln812fs frameshift ADAM29 2 83106 2.40657E-5 41553 0 NA
4-175899112-GAGTCAACCTCCTGTGACGCCCTCCTAGAGCCAACCTCAGTTGATGCCTTCCCA-G p.Ser813fs frameshift ADAM29 2 83100 2.40674E-5 41550 0 NA
4-175899112-G-C p.Gln812His missense ADAM29 1 83100 1.20337E-5 41550 0 4.20514E-5
4-175899113-A-G p.Ser813Gly missense ADAM29 149 83078 0.0017935 41539 1 0.00490385
4-175899118-A-T p.Gln814His missense ADAM29 21 83070 2.52799E-4 41535 0 0.00246428
4-175899129-C-T p.Thr818Met missense ADAM29 1 83092 1.20349E-5 41546 0 8.7353E-6
4-175899130-G-A p.Thr818Thr synonymous ADAM29 6 83064 7.22335E-5 41532 0 5.03525E-4
4-175899130-GCCCTCCTAGAGCCAACCTCAGTTGATGCCTTCCCAGAGTCAACCTCCTGTGACGCCCTCCCAGAGCCAACCTCGGGTGACA-G p.Ter821del stop_lost ADAM29 1 83070 1.2038E-5 41535 0 3.45973E-5
4-175899131-C-T p.Pro819Ser missense ADAM29 1 83084 1.2036E-5 41542 0 1.19697E-5
4-175899135-C-T p.Ser820Phe missense ADAM29 1 83098 1.2034E-5 41549 0 1.19763E-5
4-175899137-T-C p.Ter821Glnext*? stop_lost ADAM29 4 83026 4.81777E-5 41513 0 0.00654582
4-175899255-G-C c.*116G>C splice_region ADAM29 2 81724 2.44726E-5 40862 0 NA