Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
8-24151583-C-T c.-80C>T 5_prime_UTR_premature_start_codon_gain ADAM28 1 81740 1.22339E-5 40870 0 NA
8-24151641-C-T c.-22C>T 5_prime_UTR_premature_start_codon_gain ADAM28 2 83022 2.409E-5 41511 0 3.29674E-5
8-24151642-G-A c.-21G>A 5_prime_UTR_premature_start_codon_gain ADAM28 2 83024 2.40894E-5 41512 0 8.24198E-6
8-24151663-A-G p.Met1? start_lost ADAM28 3 83146 3.60811E-5 41573 0 9.55414E-5
8-24151672-G-A p.Gly4Ser missense ADAM28 1 83176 1.20227E-5 41588 0 1.64807E-5
8-24151685-T-A p.Val8Asp missense ADAM28 1 83192 1.20204E-5 41596 0 3.18451E-5
8-24151691-T-G p.Leu10Arg missense ADAM28 2 83210 2.40356E-5 41605 0 1.64799E-5
8-24151704-T-G p.Val14Val synonymous ADAM28 2 83186 2.40425E-5 41593 0 8.7519E-5
8-24151708-G-GTAAGTGCTATAAAAGAACTCCCTGGGGTGAAGAAGTATGAA c.46_46+1insTAAGTGCTATAAAAGAACTCCCTGGGGTGAAGAAGTATGAA splice_donor ADAM28 2 83160 2.405E-5 41580 1 NA
8-24151708-G-GTAA c.46_46+1insTAA splice_donor ADAM28 3 83160 3.6075E-5 41580 1 NA
8-24151708-G-GTAAGTGCTATAAAAGAACTCCCTGGGGTGAAGAAGTATGAAGT c.46_46+1insTAAGTGCTATAAAAGAACTCCCTGGGGTGAAGAAGTATGAAGT splice_donor ADAM28 1 83160 1.2025E-5 41580 0 NA
8-24157475-C-CT c.47-6dupT splice_region ADAM28 1 82248 1.21584E-5 41124 0 8.49185E-6
8-24157491-T-C p.Ser17Ser synonymous ADAM28 1 82710 1.20904E-5 41355 0 NA
8-24157495-A-G p.Ile19Val missense ADAM28 3 82774 3.62433E-5 41387 0 6.25E-4
8-24157500-A-G p.Lys20Lys synonymous ADAM28 1 82846 1.20706E-5 41423 0 NA
8-24157501-G-T p.Glu21* stop_gained ADAM28 4 82858 4.82754E-5 41429 0 2.0113E-4
8-24157511-G-T p.Gly24Val missense ADAM28 1 82930 1.20584E-5 41465 0 NA
8-24157512-G-A p.Gly24Gly synonymous ADAM28 8 82930 9.64669E-5 41465 0 6.25E-4
8-24157512-G-C p.Gly24Gly synonymous ADAM28 1 82932 1.20581E-5 41466 0 NA
8-24157531-G-C p.Val31Leu missense ADAM28 1 83032 1.20435E-5 41516 0 NA
8-24157544-G-A p.Arg35Lys missense ADAM28 1 83066 1.20386E-5 41533 0 3.98533E-6
8-24157545-A-G p.Arg35Arg synonymous ADAM28 1 83064 1.20389E-5 41532 0 NA
8-24157551-T-C p.His37His synonymous ADAM28 1 83062 1.20392E-5 41531 0 NA
8-24157554-A-G p.Pro38Pro synonymous ADAM28 4 83066 4.81545E-5 41533 0 6.63141E-5
8-24157554-A-C p.Pro38Pro synonymous ADAM28 1 83066 1.20386E-5 41533 0 1.65785E-5
8-24157555-CT-C p.Leu39fs frameshift ADAM28 2 83080 2.40732E-5 41540 0 NA
8-24157558-C-T p.His40Tyr missense ADAM28 1 83076 1.20372E-5 41538 0 NA
8-24157563-AAGAG-A p.Glu43fs frameshift ADAM28 1 83076 1.20372E-5 41538 0 3.18431E-5
8-24157569-G-T p.Glu43Asp missense ADAM28 8 83032 9.63484E-5 41516 0 1.27364E-4
8-24157589-A-G p.Gln50Arg missense+splice_region ADAM28 65 82962 7.83491E-4 41481 0 0.00109455
8-24157594-C-G c.150+4C>G splice_region ADAM28 1 82874 1.20665E-5 41437 0 NA
8-24166287-G-A c.*101+6G>A splice_region ADAM28 6 9490 6.32244E-4 4745 0 0.011875
8-24167420-C-A p.Thr55Asn missense ADAM28 1 82632 1.21018E-5 41316 0 NA
8-24167432-A-G p.Tyr59Cys missense ADAM28 3 82778 3.62415E-5 41389 0 NA
8-24167432-A-T p.Tyr59Phe missense ADAM28 1 82778 1.20805E-5 41389 0 8.35911E-6
8-24167439-G-A p.Met61Ile missense ADAM28 8 82814 9.6602E-5 41407 0 0.001875
8-24167453-A-C p.Lys66Thr missense ADAM28 1 82812 1.20755E-5 41406 0 NA
8-24167457-T-C p.Ile67Ile synonymous ADAM28 1 82822 1.20741E-5 41411 0 NA
8-24167458-G-A p.Ala68Thr missense ADAM28 39 82792 4.7106E-4 41396 1 0.00100705
8-24167472-G-GA p.Asn75fs frameshift ADAM28 11 82660 1.33075E-4 41330 0 5.03525E-4
8-24167472-G-GAA p.Asn75fs frameshift ADAM28 1 82672 1.2096E-5 41336 0 NA
8-24167475-A-G p.Lys73Lys synonymous ADAM28 1 82672 1.2096E-5 41336 0 9.55475E-5
8-24167481-C-A p.Asn75Lys missense+splice_region ADAM28 8 82618 9.68312E-5 41309 0 3.34795E-5
8-24167481-CAAGT-C p.Lys76fs frameshift ADAM28 11 82616 1.33146E-4 41308 0 2.55232E-4
8-24167481-C-G p.Asn75Lys missense+splice_region ADAM28 3 82618 3.63117E-5 41309 0 8.36988E-6
8-24167484-G-GAACC c.227+1_227+2insAACC splice_donor ADAM28 1 82602 1.21062E-5 41301 0 NA
8-24167484-G-T c.227+1G>T splice_donor ADAM28 1 82602 1.21062E-5 41301 0 NA
8-24167485-T-G c.227+2T>G splice_donor ADAM28 5 82580 6.05473E-5 41290 0 3.18735E-5
8-24167675-G-A c.228-1G>A splice_acceptor ADAM28 2 82628 2.42049E-5 41314 0 NA
8-24167699-C-T p.Thr84Met missense ADAM28 12 82872 1.44802E-4 41436 0 6.77685E-5
8-24167700-G-A p.Thr84Thr synonymous ADAM28 25 82876 3.01655E-4 41438 0 6.25E-4
8-24167705-C-G p.Thr86Arg missense ADAM28 2 82932 2.41161E-5 41466 0 NA
8-24167709-TTA-T p.Tyr88fs frameshift ADAM28 1 82938 1.20572E-5 41469 0 NA
8-24167710-T-C p.Tyr88His missense ADAM28 1 82948 1.20557E-5 41474 0 1.65796E-5
8-24167736-C-T p.Thr96Thr synonymous ADAM28 1 82998 1.20485E-5 41499 0 NA
8-24167748-A-T p.Gln100His missense ADAM28 5 82962 6.02686E-5 41481 0 1.59195E-4
8-24167751-T-C p.Ile101Ile synonymous ADAM28 98 82922 0.00118183 41461 1 0.00315186
8-24167753-T-C p.Met102Thr missense+splice_region ADAM28 2 82920 2.41196E-5 41460 0 3.9874E-6
8-24167761-C-T c.306+7C>T splice_region ADAM28 2 82840 2.41429E-5 41420 0 6.36983E-5
8-24167762-G-T c.306+8G>T splice_region ADAM28 5 82826 6.03675E-5 41413 0 1.19757E-5
8-24168872-AG-A c.307-1delG splice_acceptor ADAM28 2 82070 2.43694E-5 41035 0 NA
8-24168874-G-A p.Asp103Asn missense+splice_region ADAM28 2 82134 2.43505E-5 41067 0 1.6603E-5
8-24168875-A-C p.Asp103Ala missense+splice_region ADAM28 2 82156 2.43439E-5 41078 0 NA
8-24168877-G-T p.Asp104Tyr missense ADAM28 1 82202 1.21652E-5 41101 0 4.00026E-6
8-24168880-T-A p.Cys105Ser missense ADAM28 5 82252 6.07888E-5 41126 0 2.22944E-4
8-24168882-T-C p.Cys105Cys synonymous ADAM28 1 82268 1.21554E-5 41134 0 3.99699E-6
8-24168885-T-G p.Tyr106* stop_gained ADAM28 1 82326 1.21468E-5 41163 0 2.4841E-5
8-24168886-T-A p.Tyr107Asn missense ADAM28 9 82336 1.09308E-4 41168 0 5.59526E-5
8-24168907-G-A p.Glu114Lys missense ADAM28 1 82506 1.21203E-5 41253 0 NA
8-24168913-G-T p.Val116Phe missense ADAM28 2 82536 2.42319E-5 41268 0 1.65278E-5
8-24168913-G-A p.Val116Ile missense ADAM28 1 82536 1.21159E-5 41268 0 NA
8-24168916-T-G p.Ser117Ala missense ADAM28 1 82546 1.21145E-5 41273 0 8.26392E-6
8-24168921-C-T c.-468C>T 5_prime_UTR_premature_start_codon_gain ADAM28 5 82556 6.0565E-5 41278 0 9.55718E-5
8-24168922-G-A p.Ala119Thr missense ADAM28 1 82542 1.2115E-5 41271 0 6.25E-4
8-24168923-C-T p.Ala119Val missense ADAM28 1 82580 1.21095E-5 41290 0 7.97537E-6
8-24168947-T-A p.Leu127Gln missense ADAM28 1 82508 1.212E-5 41254 0 3.99498E-6
8-24168947-T-C p.Leu127Pro missense ADAM28 1 82508 1.212E-5 41254 0 NA
8-24168951-G-A c.383+1G>A splice_donor ADAM28 1 82486 1.21233E-5 41243 0 NA
8-24168955-G-T c.383+5G>T splice_region ADAM28 1 82424 1.21324E-5 41212 0 1.32339E-4
8-24168956-A-G c.383+6A>G splice_region ADAM28 1 82392 1.21371E-5 41196 0 8.27171E-6
8-24170906-A-G p.Tyr130Cys missense ADAM28 1 83120 1.20308E-5 41560 0 8.12678E-6
8-24170914-C-T p.Gln133* stop_gained ADAM28 1 83172 1.20233E-5 41586 0 NA
8-24170917-G-A p.Gly134Arg missense ADAM28 1 83166 1.20241E-5 41583 0 NA
8-24170922-T-A p.Asp135Glu missense ADAM28 1 83172 1.20233E-5 41586 0 3.18654E-5
8-24170922-T-C p.Asp135Asp synonymous ADAM28 1 83172 1.20233E-5 41586 0 1.83053E-4
8-24170933-T-G p.Phe139Cys missense ADAM28 1 83208 1.20181E-5 41604 0 4.00426E-6
8-24170937-T-G p.Ile140Met missense ADAM28 1 83218 1.20166E-5 41609 0 NA
8-24170941-C-A p.Pro142Thr missense ADAM28 2 83216 2.40338E-5 41608 0 5.03525E-4
8-24170949-C-A p.Ser144Arg missense ADAM28 1 83228 1.20152E-5 41614 0 NA
8-24170953-A-T p.Ile146Leu missense ADAM28 1 83260 1.20106E-5 41630 0 NA
8-24170956-C-A p.His147Asn missense ADAM28 141 83260 0.00169349 41630 0 0.00202816
8-24170957-A-G p.His147Arg missense ADAM28 2 83260 2.40211E-5 41630 0 1.99208E-5
8-24170959-C-T p.Arg148Trp missense ADAM28 8 83250 9.60961E-5 41625 0 6.77426E-5
8-24170960-G-T p.Arg148Leu missense ADAM28 498 83258 0.00598141 41629 11 0.0138269
8-24170960-G-A p.Arg148Gln missense ADAM28 6 83264 7.206E-5 41632 0 1.19516E-4
8-24170962-G-A p.Asp149Asn missense ADAM28 5 83260 6.00528E-5 41630 0 1.91131E-4
8-24170983-T-C p.Phe156Leu missense ADAM28 5 83306 6.00197E-5 41653 0 4.12494E-4
8-24170985-C-T p.Phe156Phe synonymous ADAM28 3 83312 3.60092E-5 41656 0 3.05225E-4
8-24170994-C-A p.Asn159Lys missense ADAM28 23 83310 2.76077E-4 41655 0 6.37349E-4
8-24170996-C-G p.Pro160Arg missense ADAM28 6 83302 7.20271E-5 41651 0 3.98035E-5
8-24171015-C-G p.Asp166Glu missense ADAM28 1 83334 1.19999E-5 41667 0 NA
8-24171018-C-A p.Ser167Arg missense ADAM28 1 83338 1.19993E-5 41669 0 3.97953E-6
8-24171021-C-A c.-318C>A 5_prime_UTR_premature_start_codon_gain ADAM28 1 83350 1.19976E-5 41675 0 1.03467E-4
8-24171030-G-A p.Met171Ile missense ADAM28 6 83340 7.19942E-5 41670 0 NA
8-24171034-G-A p.Gly173Ser missense ADAM28 18 83328 2.16014E-4 41664 0 3.18715E-5
8-24171035-G-T p.Gly173Val missense ADAM28 1 83330 1.20005E-5 41665 0 NA
8-24171036-T-C p.Gly173Gly synonymous ADAM28 3 83332 3.60006E-5 41666 0 8.24538E-6
8-24171045-G-T p.Trp176Cys missense ADAM28 7 83312 8.40215E-5 41656 0 4.1231E-5
8-24171047-C-T p.Ala177Val missense ADAM28 1 83316 1.20025E-5 41658 0 NA
8-24171051-C-T c.-288C>T 5_prime_UTR_premature_start_codon_gain ADAM28 11924 83088 0.14351 41544 889 0.172484
8-24171051-C-G p.His178Gln missense ADAM28 1 83296 1.20054E-5 41648 0 NA
8-24171051-C-A p.His178Gln missense ADAM28 1 83296 1.20054E-5 41648 0 NA
8-24171056-T-G p.Leu180Trp missense ADAM28 6 83268 7.20565E-5 41634 0 2.47484E-4
8-24171060-G-A p.Gln181Gln synonymous ADAM28 1 83254 1.20114E-5 41627 0 1.59335E-5
8-24171065-A-T p.Asn183Ile missense ADAM28 2 83236 2.40281E-5 41618 0 1.59401E-5
8-24171066-C-G p.Asn183Lys missense ADAM28 2 83226 2.4031E-5 41613 0 1.59449E-5
8-24171082-A-G p.Thr189Ala missense ADAM28 1 83074 1.20375E-5 41537 0 NA
8-24171093-A-AAAATTGAAAGACAGGAAGGTTCAG c.576_576+1insAAATTGAAAGACAGGAAGGTTCAG splice_donor ADAM28 2 82924 2.41185E-5 41462 1 NA
8-24171094-G-T c.576+1G>T splice_donor ADAM28 1 82886 1.20648E-5 41443 0 NA
8-24171097-T-C c.576+4T>C splice_region ADAM28 8 82810 9.66067E-5 41405 0 9.55536E-5
8-24177748-G-A c.577-1G>A splice_acceptor ADAM28 2 80832 2.47427E-5 40416 0 4.11157E-6
8-24177752-T-C c.-242T>C 5_prime_UTR_premature_start_codon_gain ADAM28 1 80970 1.23503E-5 40485 0 NA
8-24177760-C-T p.Asp196Asp synonymous ADAM28 1 81108 1.23292E-5 40554 0 NA
8-24177767-G-A p.Val199Ile missense ADAM28 2 81230 2.46214E-5 40615 0 8.29009E-6
8-24177770-C-A p.Gln200Lys missense ADAM28 1 81310 1.22986E-5 40655 0 NA
8-24177771-A-AG p.Glu201fs frameshift ADAM28 2 81286 2.46045E-5 40643 0 NA
8-24177775-A-C p.Glu201Asp missense ADAM28 41 81320 5.04181E-4 40660 1 0.0040282
8-24177779-G-A p.Glu203Lys missense ADAM28 1 81380 1.2288E-5 40690 0 8.28775E-6
8-24177780-A-T p.Glu203Val missense ADAM28 1 81376 1.22886E-5 40688 0 NA
8-24177787-C-A p.Tyr205* stop_gained ADAM28 1 81370 1.22895E-5 40685 0 1.65733E-5
8-24177788-A-G p.Ile206Val missense ADAM28 38 81368 4.67014E-4 40684 0 5.03525E-4
8-24177789-T-C p.Ile206Thr missense ADAM28 3 81346 3.68795E-5 40673 0 6.26566E-4
8-24177790-A-T c.-204A>T 5_prime_UTR_premature_start_codon_gain ADAM28 2 81346 2.45863E-5 40673 0 NA
8-24177792-A-C p.Glu207Ala missense ADAM28 1 81360 1.22911E-5 40680 0 8.28487E-6
8-24177805-C-A p.Val211Val synonymous ADAM28 1 81348 1.22929E-5 40674 0 NA
8-24177814-T-G p.Asn214Lys missense ADAM28 1 81248 1.2308E-5 40624 0 4.06441E-6
8-24177818-G-A p.Glu216Lys missense+splice_region ADAM28 1 81188 1.23171E-5 40594 0 3.18898E-5
8-24177827-A-G c.648+7A>G splice_region ADAM28 20 80932 2.47121E-4 40466 0 NA
8-24177828-T-C c.648+8T>C splice_region ADAM28 8 80882 9.89095E-5 40441 0 1.23143E-5
8-24178738-G-T p.Arg219Met missense ADAM28 1289 81072 0.0158994 40536 62 0.0335204
8-24178739-G-T p.Arg219Ser missense ADAM28 63 81150 7.7634E-4 40575 0 0.00191327
8-24178748-G-A p.Glu222Glu synonymous ADAM28 1 81398 1.22853E-5 40699 0 NA
8-24178751-T-G p.Asn223Lys missense ADAM28 10 81426 1.22811E-4 40713 0 0.0015121
8-24178754-A-C p.Gln224His missense ADAM28 1 81466 1.22751E-5 40733 0 NA
8-24178772-G-A p.Arg230Arg synonymous ADAM28 10 81540 1.22639E-4 40770 0 6.25E-4
8-24178789-A-T p.Asn236Ile missense ADAM28 1 81430 1.22805E-5 40715 0 NA
8-24178794-G-A p.Val238Ile missense ADAM28 1 81336 1.22947E-5 40668 0 NA
8-24178800-A-G p.Met240Val missense+splice_region ADAM28 2 81180 2.46366E-5 40590 0 NA
8-24178801-T-C p.Met240Thr missense+splice_region ADAM28 1 81152 1.23226E-5 40576 0 1.65508E-5
8-24178802-G-T p.Met240Ile missense+splice_region ADAM28 1 81156 1.23219E-5 40578 0 3.99182E-6
8-24178810-A-G c.720+8A>G splice_region ADAM28 1 80882 1.23637E-5 40441 0 NA
8-24178872-C-T c.-129C>T 5_prime_UTR_premature_start_codon_gain ADAM28 1 76148 1.31323E-5 38074 0 6.25E-4
8-24178951-T-G c.-50T>G 5_prime_UTR_premature_start_codon_gain ADAM28 1 65220 1.53327E-5 32610 0 NA
8-24181344-C-T c.721-3C>T splice_region ADAM28 4 82428 4.85272E-5 41214 0 3.27603E-5
8-24181359-C-T p.Leu245Phe missense ADAM28 7 82638 8.47068E-5 41319 0 5.03525E-4
8-24181360-T-C p.Leu245Pro missense ADAM28 2 82664 2.41943E-5 41332 0 4.00227E-6
8-24181370-T-C p.His248His synonymous ADAM28 2 82714 2.41797E-5 41357 0 3.9946E-6
8-24181373-G-A p.Val249Val synonymous ADAM28 1 82720 1.2089E-5 41360 0 NA
8-24181391-A-C p.Glu255Asp missense ADAM28 11 82754 1.32924E-4 41377 0 0.00100705
8-24181394-C-T p.Ile256Ile synonymous ADAM28 1 82740 1.20861E-5 41370 0 3.18715E-5
8-24181401-GAC-G p.Asp259fs frameshift ADAM28 2 82742 2.41715E-5 41371 0 8.28336E-6
8-24181407-G-T p.Asp261Tyr missense ADAM28 1 82736 1.20866E-5 41368 0 NA
8-24181417-A-G p.Lys264Arg missense ADAM28 1 82786 1.20793E-5 41393 0 3.98915E-6
8-24181419-A-T p.Ile265Leu missense ADAM28 4 82776 4.83232E-5 41388 0 3.18593E-5
8-24181439-C-T p.Phe271Phe synonymous ADAM28 71 82712 8.584E-4 41356 0 6.54278E-4
8-24181469-G-A p.Gly281Gly synonymous ADAM28 1 82620 1.21036E-5 41310 0 3.18837E-5
8-24181473-G-A p.Val283Ile missense ADAM28 1 82594 1.21074E-5 41297 0 3.18857E-5
8-24181476-C-T p.Leu284Phe missense ADAM28 1 82560 1.21124E-5 41280 0 NA
8-24181488-A-G p.Lys288Glu missense ADAM28 3 82482 3.63716E-5 41241 0 NA
8-24181491-C-T p.Arg289Cys missense ADAM28 11 82430 1.33447E-4 41215 0 5.80018E-5
8-24181492-G-A p.Arg289His missense ADAM28 4 82414 4.85354E-5 41207 0 9.56633E-5
8-24181496-TG-T p.Asp291fs frameshift ADAM28 1 82378 1.21392E-5 41189 0 2.4869E-5
8-24181500-A-G p.Ile292Val missense ADAM28 2 82334 2.42913E-5 41167 0 8.29531E-6
8-24181504-C-T p.Ala293Val missense ADAM28 2 82276 2.43084E-5 41138 0 9.56816E-5
8-24181513-T-C p.Ile296Thr missense ADAM28 1 82142 1.2174E-5 41071 0 NA
8-24181516-C-T p.Thr297Ile missense+splice_region ADAM28 7 82050 8.53138E-5 41025 0 3.2866E-4
8-24181517-G-A c.890+1G>A splice_donor ADAM28 3 81986 3.65916E-5 40993 0 3.18817E-5
8-24181520-T-G c.890+4T>G splice_region ADAM28 9 81954 1.09818E-4 40977 0 9.56084E-5
8-24181520-T-A c.890+4T>A splice_region ADAM28 2 81954 2.44039E-5 40977 0 NA
8-24184059-T-G c.891-8T>G splice_region ADAM28 1 82828 1.20732E-5 41414 0 1.65407E-5
8-24184060-C-G c.891-7C>G splice_region ADAM28 2 82850 2.414E-5 41425 0 NA
8-24184070-A-C p.Ala298Ala synonymous ADAM28 1 82964 1.20534E-5 41482 0 NA
8-24184074-G-A p.Glu300Lys missense ADAM28 1 82982 1.20508E-5 41491 0 3.18756E-5
8-24184076-A-T p.Glu300Asp missense ADAM28 3 82990 3.61489E-5 41495 0 4.38659E-5
8-24184080-G-A p.Ala302Thr missense ADAM28 1 83026 1.20444E-5 41513 0 NA
8-24184087-C-T p.Thr304Met missense ADAM28 5 83036 6.02148E-5 41518 0 9.56206E-5
8-24184087-C-A p.Thr304Lys missense ADAM28 5 83036 6.02148E-5 41518 0 8.25941E-6
8-24184088-G-T p.Thr304Thr synonymous ADAM28 50 83010 6.02337E-4 41505 0 0.0012747
8-24184088-G-A p.Thr304Thr synonymous ADAM28 1 83016 1.20459E-5 41508 0 6.25E-4
8-24184090-C-CT p.Val306fs frameshift ADAM28 1 83064 1.20389E-5 41532 0 NA
8-24184107-A-G p.Met311Val missense ADAM28 1 83094 1.20346E-5 41547 0 NA
8-24184113-A-G p.Thr313Ala missense ADAM28 1 83072 1.20378E-5 41536 0 NA
8-24184121-T-C p.Cys315Cys synonymous ADAM28 1 83068 1.20383E-5 41534 0 NA
8-24184128-T-TATC p.Tyr318_Ser319insHis conservative_inframe_insertion ADAM28 50 83066 6.01931E-4 41533 0 0.00130681
8-24184133-T-C p.Ser319Ser synonymous ADAM28 1 83048 1.20412E-5 41524 0 NA
8-24184134-G-T p.Val320Phe missense ADAM28 1 83032 1.20435E-5 41516 0 8.25832E-6
8-24184134-G-A p.Val320Ile missense ADAM28 3 83032 3.61306E-5 41516 0 6.37821E-5
8-24184135-T-C p.Val320Ala missense ADAM28 1 83020 1.20453E-5 41510 0 1.1956E-5
8-24184139-C-T p.Gly321Gly synonymous ADAM28 30 82982 3.61524E-4 41491 0 7.01396E-4
8-24184140-G-A p.Val322Ile missense ADAM28 53 82982 6.38693E-4 41491 0 0.00114803
8-24184149-G-GACCACAGCGATAATCTTCTTAGAGTTGCAGGGACAATGGCACATGAAA c.972+1_972+2insACCACAGCGATAATCTTCTTAGAGTTGCAGGGACAATGGCACATGAAA splice_donor ADAM28 2 82932 2.41161E-5 41466 1 NA
8-24187490-A-G c.973-8A>G splice_region ADAM28 2 83316 2.4005E-5 41658 0 NA
8-24187498-G-C p.Asp325His missense+splice_region ADAM28 2 83346 2.39964E-5 41673 0 3.99533E-6
8-24187503-C-T p.His326His synonymous ADAM28 1 83364 1.19956E-5 41682 0 NA
8-24187506-C-T p.Ser327Ser synonymous ADAM28 24 83354 2.87929E-4 41677 1 2.5507E-4
8-24187507-G-T p.Asp328Tyr missense ADAM28 1 83358 1.19964E-5 41679 0 NA
8-24187511-ATCT-A p.Leu331del conservative_inframe_deletion ADAM28 5 83358 5.99822E-5 41679 0 2.86843E-4
8-24187527-A-G p.Ala334Ala synonymous ADAM28 5 83350 5.9988E-5 41675 0 6.37471E-5
8-24187530-G-A p.Gly335Gly synonymous ADAM28 1 83348 1.19979E-5 41674 0 NA
8-24187534-A-G p.Met337Val missense ADAM28 2 83342 2.39975E-5 41671 0 8.25968E-6
8-24187535-T-C p.Met337Thr missense ADAM28 24 83338 2.87984E-4 41669 0 0.0020141
8-24187549-G-C p.Gly342Arg missense ADAM28 1 83338 1.19993E-5 41669 0 3.97874E-6
8-24187571-A-C p.His349Pro missense ADAM28 1 83356 1.19967E-5 41678 0 8.25723E-6
8-24187575-C-T p.Asp350Asp synonymous ADAM28 120 83350 0.00143971 41675 0 0.001875
8-24187576-G-A p.Asp351Asn missense ADAM28 1 83354 1.1997E-5 41677 0 NA
8-24187580-A-C p.Tyr352Ser missense ADAM28 54 83358 6.47808E-4 41679 0 0.00121081
8-24187586-G-A p.Cys354Tyr missense ADAM28 22 83362 2.63909E-4 41681 0 2.58643E-4
8-24187586-G-T p.Cys354Phe missense ADAM28 5 83362 5.99794E-5 41681 0 5.17285E-5
8-24187600-A-G p.Thr359Ala missense ADAM28 1 83344 1.19985E-5 41672 0 NA
8-24187603-A-G p.Ile360Val missense ADAM28 1 83350 1.19976E-5 41675 0 3.18593E-5
8-24187615-GA-G p.Asp364fs frameshift ADAM28 1 83340 1.1999E-5 41670 0 3.18593E-5
8-24187617-CAAA-C p.Lys365del conservative_inframe_deletion ADAM28 1 83334 1.19999E-5 41667 0 3.18796E-5
8-24187621-G-T p.Ala366Ser missense ADAM28 1 83336 1.19996E-5 41668 0 3.18674E-5
8-24187628-G-GCTTCTATATACCCACAGACTTCAGTTCCTGCA c.1103_1103+1insCTTCTATATACCCACAGACTTCAGTTCCTGCA splice_donor ADAM28 2 83324 2.40027E-5 41662 1 NA
8-24188668-A-G p.Tyr370Cys missense ADAM28 6 83030 7.2263E-5 41515 0 1.61534E-5
8-24188669-T-C p.Tyr370Tyr synonymous ADAM28 2 83050 2.40819E-5 41525 0 2.41986E-5
8-24188681-C-A p.Asp374Glu missense ADAM28 1 83116 1.20314E-5 41558 0 NA
8-24188685-A-G p.Ser376Gly missense ADAM28 1 83142 1.20276E-5 41571 0 2.26002E-4
8-24188693-C-T p.Cys378Cys synonymous ADAM28 3 83140 3.60837E-5 41570 0 8.31974E-6
8-24188695-G-T p.Ser379Ile missense ADAM28 1 83146 1.2027E-5 41573 0 3.18573E-5
8-24188698-G-A p.Arg380His missense ADAM28 2 83164 2.40489E-5 41582 0 3.18613E-5
8-24188708-T-C p.Tyr383Tyr synonymous ADAM28 1 83186 1.20213E-5 41593 0 5.03525E-4
8-24188757-T-C p.Leu400Leu synonymous ADAM28 1 83264 1.201E-5 41632 0 NA
8-24188763-A-G p.Thr402Ala missense ADAM28 1 83268 1.20094E-5 41634 0 8.25191E-6
8-24188773-T-A p.Ile405Lys missense ADAM28 1 83278 1.2008E-5 41639 0 NA
8-24188798-G-A p.Gln413Gln synonymous ADAM28 4 83294 4.80227E-5 41647 0 3.1841E-5
8-24188804-G-A p.Val415Val synonymous ADAM28 1930 83260 0.0231804 41630 119 0.0490952
8-24188805-G-A p.Glu416Lys missense ADAM28 4 83296 4.80215E-5 41648 0 3.6051E-5
8-24188808-A-T p.Met417Leu missense ADAM28 1 83288 1.20065E-5 41644 0 4.00657E-6
8-24188812-G-T p.Gly418Val missense ADAM28 1 83296 1.20054E-5 41648 0 NA
8-24188816-G-A p.Glu419Glu synonymous ADAM28 1 83282 1.20074E-5 41641 0 3.18431E-5
8-24188825-T-C p.Asp422Asp synonymous ADAM28 1 83250 1.2012E-5 41625 0 NA
8-24188827-G-T p.Cys423Phe missense ADAM28 2 83244 2.40258E-5 41622 0 8.18786E-6
8-24188832-A-C p.Thr425Pro missense ADAM28 25 83190 3.00517E-4 41595 2 5.03525E-4
8-24188841-G-A c.1281+1G>A splice_donor ADAM28 1 83154 1.20259E-5 41577 0 4.26414E-6
8-24188844-T-C c.1281+4T>C splice_region ADAM28 12824 82438 0.155559 41219 1036 0.201671
8-24188847-C-T c.1281+7C>T splice_region ADAM28 1 83028 1.20441E-5 41514 0 NA
8-24190176-T-C p.Cys429Arg missense ADAM28 1 78200 1.27877E-5 39100 0 1.67353E-5
8-24190179-A-G p.Thr430Ala missense ADAM28 1 78434 1.27496E-5 39217 0 1.67026E-5
8-24190198-C-T p.Ala436Val missense ADAM28 1 79212 1.26243E-5 39606 0 NA
8-24190202-G-A p.Lys437Lys synonymous ADAM28 10 79360 1.26008E-4 39680 0 9.56145E-5
8-24190222-C-G p.Thr444Ser missense ADAM28 4 78898 5.06984E-5 39449 0 3.31505E-5
8-24190222-C-T p.Thr444Ile missense ADAM28 1 78898 1.26746E-5 39449 0 1.65752E-5
8-24190249-G-T p.Cys453Phe missense ADAM28 8 76782 1.04191E-4 38391 0 4.18585E-5
8-24190251-G-GA p.Cys456fs frameshift ADAM28 3 76700 3.91134E-5 38350 1 NA
8-24190262-A-ATTTAAAAAGGCTGGGATG c.1371_1371+1insTTTAAAAAGGCTGGGATG splice_donor ADAM28 2 76196 2.62481E-5 38098 1 NA
8-24190262-A-G p.Gln457Gln splice_region+synonymous ADAM28 11 76194 1.44368E-4 38097 1 0.00252525
8-24190266-A-C c.1371+4A>C splice_region ADAM28 3 75932 3.9509E-5 37966 0 9.15298E-6
8-24192935-CCTTCTATTTTTGTTTTTCTACAGTTTAAAAAGG-C p.Phe458fs frameshift ADAM28 1 82588 1.21083E-5 41294 0 NA
8-24192963-A-G p.Lys459Arg missense ADAM28 1 83136 1.20285E-5 41568 0 3.18674E-5
8-24192968-G-C p.Ala461Pro missense ADAM28 2 83242 2.40263E-5 41621 0 8.66957E-6
8-24192971-G-A p.Gly462Arg missense ADAM28 1 83282 1.20074E-5 41641 0 1.20385E-5
8-24192990-C-T p.Ala468Val missense ADAM28 1 83338 1.19993E-5 41669 0 7.97391E-6
8-24193003-C-T p.Cys472Cys synonymous ADAM28 3 83356 3.59902E-5 41678 0 6.25E-4
8-24193006-C-G p.Asp473Glu missense ADAM28 1 83352 1.19973E-5 41676 0 NA
8-24193018-G-A p.Met477Ile missense ADAM28 1 83364 1.19956E-5 41682 0 3.97785E-6
8-24193021-T-C p.Cys478Cys synonymous ADAM28 1 83370 1.19947E-5 41685 0 1.59115E-5
8-24193025-G-A p.Gly480Ser missense ADAM28 1 83374 1.19941E-5 41687 0 NA
8-24193039-T-C p.Asn484Asn synonymous ADAM28 49 83378 5.87685E-4 41689 0 5.03525E-4
8-24193044-C-CTGATGATAGAT p.Phe490fs frameshift ADAM28 5 83374 5.99707E-5 41687 0 8.34126E-6
8-24193057-C-G p.Phe490Leu missense ADAM28 1 83358 1.19964E-5 41679 0 NA
8-24193065-A-G p.Asn493Ser missense ADAM28 548 83304 0.00657832 41652 15 0.0159337
8-24193071-TCCCTTG-T p.Pro496_Cys497del disruptive_inframe_deletion ADAM28 1 83330 1.20005E-5 41665 0 NA
8-24193077-G-A p.Cys497Tyr missense ADAM28 1 83318 1.20022E-5 41659 0 6.37146E-5
8-24193084-C-T p.His499His synonymous ADAM28 2 83306 2.40079E-5 41653 0 3.18573E-5
8-24193085-G-A p.Gly500Arg missense ADAM28 121 83296 0.00145265 41648 0 0.008125
8-24193115-C-T p.Pro510Ser missense ADAM28 1 83232 1.20146E-5 41616 0 3.18715E-5
8-24193116-C-CCA p.Leu512fs frameshift ADAM28 1 83230 1.20149E-5 41615 0 NA
8-24193117-C-T p.Pro510Pro synonymous ADAM28 1 83230 1.20149E-5 41615 0 6.37592E-5
8-24193124-C-T p.Gln513* stop_gained ADAM28 1 83214 1.20172E-5 41607 0 NA
8-24193126-G-A p.Gln513Gln synonymous ADAM28 1 83216 1.20169E-5 41608 0 NA
8-24193155-G-GAACTGAGGTTGCAGA c.1567+1_1567+2insAACTGAGGTTGCAGA splice_donor ADAM28 1 83038 1.20427E-5 41519 0 NA
8-24193155-G-GAAC c.1567+1_1567+2insAAC splice_donor ADAM28 1 83040 1.20424E-5 41520 0 NA
8-24193165-A-G p.Thr526Thr synonymous ADAM28 5 82934 6.02889E-5 41467 0 9.55962E-5
8-24193169-C-A p.Pro528Thr missense ADAM28 1 82902 1.20624E-5 41451 0 5.03525E-4
8-24193171-T-G p.Pro528Pro synonymous ADAM28 1 82868 1.20674E-5 41434 0 NA
8-24193187-G-A p.Ala534Thr missense ADAM28 1 82500 1.21212E-5 41250 0 NA
8-24193188-C-T p.Ala534Val missense ADAM28 521 82274 0.0063325 41137 13 0.015914
8-24193188-CG-GA p.Ala534Gly missense ADAM28 1 82290 1.21521E-5 41145 0 NA
8-24193189-G-A p.Ala534Ala synonymous ADAM28 1 82292 1.21518E-5 41146 0 3.35255E-5
8-24193193-G-A p.Glu536Lys missense ADAM28 1 82230 1.2161E-5 41115 0 9.55962E-5
8-24193200-A-G p.His538Arg missense ADAM28 2 82192 2.43333E-5 41096 0 5.85186E-5
8-24193209-G-A p.Ter541Ter stop_retained ADAM28 1 82122 1.2177E-5 41061 0 NA
8-24193552-GGTGT-G c.*360_*363delTGTG splice_region ADAM28 1 24522 4.07797E-5 12261 0 7.20825E-5
8-24193552-GGT-G c.*362_*363delTG splice_region ADAM28 42 21568 0.00194733 10784 0 0.00158581
8-24193561-GTGTGTGTGTGTGCAGGGGTGGCAGAAGTAC-G c.*356_*385delTGTGTGTGCAGGGGTGGCAGAAGTACTGTG splice_region ADAM28 3 24510 1.22399E-4 12255 0 3.19591E-5
8-24196976-C-T c.1568-3C>T splice_region ADAM28 1 82994 1.20491E-5 41497 0 NA
8-24196982-C-A p.Thr524Asn missense ADAM28 2 83014 2.40923E-5 41507 0 NA
8-24196987-G-A p.Val526Ile missense ADAM28 1 83056 1.20401E-5 41528 0 3.18451E-5
8-24196994-A-G p.Asp528Gly missense ADAM28 1 83114 1.20317E-5 41557 0 3.18492E-5
8-24197017-G-A p.Glu536Lys missense ADAM28 11 83160 1.32275E-4 41580 0 2.89341E-4
8-24197020-G-C p.Gly537Arg missense ADAM28 1 83162 1.20247E-5 41581 0 NA
8-24197025-G-A p.Gly538Gly synonymous ADAM28 1 83176 1.20227E-5 41588 0 NA
8-24197028-A-C p.Ser539Ser synonymous ADAM28 2 83170 2.40471E-5 41585 0 1.82652E-5
8-24197034-C-T p.Tyr541Tyr synonymous ADAM28 1456 83116 0.0175177 41558 71 0.0340728
8-24197035-G-T p.Gly542Trp missense ADAM28 33 83126 3.96988E-4 41563 0 0.00302115
8-24197035-G-A p.Gly542Arg missense ADAM28 1 83126 1.20299E-5 41563 0 1.8458E-5
8-24197044-C-T p.Arg545Cys missense ADAM28 9 83124 1.08272E-4 41562 0 6.36752E-4
8-24197045-G-A p.Arg545His missense ADAM28 2 83116 2.40628E-5 41558 0 NA
8-24197056-G-A p.Asp549Asn missense ADAM28 16 83030 1.92701E-4 41515 1 0.00133333
8-24197062-C-G p.Leu551Val missense ADAM28 1 82996 1.20488E-5 41498 0 8.0651E-6
8-24197080-A-G p.Asn557Asp missense+splice_region ADAM28 1 82860 1.20685E-5 41430 0 1.07596E-5
8-24197082-G-T c.1670+1G>T splice_donor ADAM28 1 82854 1.20694E-5 41427 0 NA
8-24197087-T-C c.1670+6T>C splice_region ADAM28 1 82776 1.20808E-5 41388 0 8.29215E-6
8-24199100-TTTTTC-T c.1671-10_1671-6delTTTTC splice_region ADAM28 1 83114 1.20317E-5 41557 0 8.27458E-6
8-24199103-T-G c.1671-8T>G splice_region ADAM28 1 83140 1.20279E-5 41570 0 4.01781E-6
8-24199106-C-A c.1671-5C>A splice_region ADAM28 1 83152 1.20262E-5 41576 0 8.26405E-6
8-24199114-T-C p.Asp558Asp synonymous ADAM28 7 83178 8.41569E-5 41589 0 2.55822E-4
8-24199118-A-G p.Met560Val missense ADAM28 2 83196 2.40396E-5 41598 0 NA
8-24199119-T-C p.Met560Thr missense ADAM28 1 83198 1.20195E-5 41599 0 1.64967E-5
8-24199141-A-T p.Gln567His missense ADAM28 3 83288 3.60196E-5 41644 0 6.36983E-5
8-24199149-C-T p.Ser570Leu missense ADAM28 6 83288 7.20392E-5 41644 0 4.11963E-5
8-24199150-G-A p.Ser570Ser synonymous ADAM28 38 83292 4.56226E-4 41646 2 0.00353893
8-24199160-C-T p.Pro574Ser missense ADAM28 2 83302 2.4009E-5 41651 0 3.18532E-5
8-24199162-C-A p.Pro574Pro synonymous ADAM28 1 83296 1.20054E-5 41648 0 3.18573E-5
8-24199172-C-T p.Arg578Trp missense ADAM28 6 83312 7.20184E-5 41656 0 1.40047E-4
8-24199172-C-A p.Arg578Arg synonymous ADAM28 2 83312 2.40061E-5 41656 0 8.23805E-6
8-24199173-G-A p.Arg578Gln missense ADAM28 3 83308 3.60109E-5 41654 0 6.37227E-5
8-24199176-T-C p.Ile579Thr missense ADAM28 1 83318 1.20022E-5 41659 0 3.29495E-5
8-24199182-C-T p.Thr581Ile missense ADAM28 1 83322 1.20016E-5 41661 0 1.98897E-5
8-24199205-G-C p.Asp589His missense ADAM28 1 83326 1.20011E-5 41663 0 1.19374E-5
8-24199214-G-A p.Asp592Asn missense ADAM28 1 83324 1.20013E-5 41662 0 NA
8-24199218-C-A p.Thr593Lys missense ADAM28 3870 83274 0.0464731 41637 184 0.0730402
8-24199218-C-T p.Thr593Ile missense ADAM28 1 83330 1.20005E-5 41665 0 3.98083E-6
8-24199219-A-G p.Thr593Thr synonymous ADAM28 4 83330 4.80019E-5 41665 0 6.36902E-5
8-24199241-G-C p.Ala601Pro missense ADAM28 2 83334 2.39998E-5 41667 0 3.18431E-5
8-24199254-AGT-A p.Cys606fs frameshift ADAM28 1 83342 1.19988E-5 41671 0 3.98127E-6
8-24199261-C-T p.Gly607Gly synonymous ADAM28 10 83342 1.19988E-4 41671 0 0.00100705
8-24199262-G-T p.Asp608Tyr missense ADAM28 1 83344 1.19985E-5 41672 0 3.98597E-6
8-24199264-TAAC-T p.Asn609del disruptive_inframe_deletion ADAM28 1 83340 1.1999E-5 41670 0 8.23968E-6
8-24199274-A-C c.1830+4A>C splice_region ADAM28 2 83310 2.40067E-5 41655 0 NA
8-24200611-C-T c.1831-3C>T splice_region ADAM28 13 82874 1.56865E-4 41437 0 9.55231E-5
8-24200627-C-T p.Ala615Val missense ADAM28 1 82956 1.20546E-5 41478 0 NA
8-24200636-T-G p.Val618Gly missense ADAM28 1 82982 1.20508E-5 41491 0 NA
8-24200650-G-A p.Ala623Thr missense ADAM28 2 82984 2.4101E-5 41492 0 NA
8-24200652-C-G p.Ala623Ala synonymous ADAM28 1 82990 1.20496E-5 41495 0 NA
8-24200655-CA-C p.Lys625fs frameshift ADAM28 1 82996 1.20488E-5 41498 0 NA
8-24200656-A-C p.Lys625Gln missense ADAM28 10 82988 1.20499E-4 41494 0 1.32063E-4
8-24200659-T-G p.Ser626Ala missense ADAM28 1 82992 1.20494E-5 41496 0 NA
8-24200661-A-C p.Ser626Ser synonymous ADAM28 1 83006 1.20473E-5 41503 0 NA
8-24200666-A-G p.Asn628Ser missense ADAM28 5 82988 6.02497E-5 41494 0 3.1841E-5
8-24200669-G-T p.Cys629Phe missense ADAM28 1 82986 1.20502E-5 41493 0 1.65106E-5
8-24200675-C-T p.Ser631Phe missense ADAM28 2 82974 2.41039E-5 41487 0 NA
8-24200677-A-T p.Lys632* stop_gained ADAM28 5 82970 6.02627E-5 41485 0 7.43224E-5
8-24200680-T-C p.Cys633Arg missense ADAM28 1 82950 1.20555E-5 41475 0 NA
8-24200686-G-C p.Gly635Arg missense ADAM28 1 82940 1.20569E-5 41470 0 3.98273E-6
8-24200696-T-TGTGTGACCATGAGCTCCAGTGTCAATGTGAGG c.1911+2_1911+3insGTGTGACCATGAGCTCCAGTGTCAATGTGAGG splice_region ADAM28 1 82862 1.20683E-5 41431 0 NA
8-24200696-T-TGTGTG c.1911+2_1911+3insGTGTG splice_region ADAM28 2 82862 2.41365E-5 41431 0 NA
8-24200696-T-TGTGTGACCATGAGCTCCAGTGTC c.1911+2_1911+3insGTGTGACCATGAGCTCCAGTGTC splice_region ADAM28 2 82862 2.41365E-5 41431 1 NA
8-24201014-C-T c.1912-5C>T splice_region ADAM28 10 83134 1.20288E-4 41567 0 4.13332E-5
8-24201018-G-C c.1912-1G>C splice_acceptor ADAM28 2 83144 2.40547E-5 41572 0 NA
8-24201030-T-C p.His641His synonymous ADAM28 1 83194 1.20201E-5 41597 0 3.98067E-6
8-24201031-G-T p.Glu642* stop_gained ADAM28 1 83202 1.20189E-5 41601 0 NA
8-24201045-A-G p.Gln646Gln synonymous ADAM28 2 83170 2.40471E-5 41585 0 8.25641E-6
8-24201046-T-A p.Cys647Ser missense ADAM28 2 83172 2.40466E-5 41586 0 4.77623E-5
8-24201047-G-T p.Cys647Phe missense ADAM28 1 83176 1.20227E-5 41588 0 NA
8-24201049-G-A p.Glu648Lys missense ADAM28 1 83172 1.20233E-5 41586 0 NA
8-24201060-G-T p.Trp651Cys missense ADAM28 1 83160 1.2025E-5 41580 0 3.98073E-6
8-24201062-T-A p.Ile652Asn missense ADAM28 2 83142 2.40552E-5 41571 0 8.25709E-6
8-24201069-C-T p.Pro654Pro synonymous ADAM28 11 83132 1.3232E-4 41566 0 6.25E-4
8-24201069-C-A p.Pro654Pro synonymous ADAM28 1 83132 1.20291E-5 41566 0 NA
8-24201069-C-G p.Pro654Pro synonymous ADAM28 1 83132 1.20291E-5 41566 0 1.19451E-5
8-24201070-G-A p.Asp655Asn missense ADAM28 1 83124 1.20302E-5 41562 0 6.25E-4
8-24201073-T-C p.Cys656Arg missense ADAM28 1 83114 1.20317E-5 41557 0 NA
8-24201075-C-T p.Cys656Cys synonymous ADAM28 26 83070 3.12989E-4 41535 0 0.00111486
8-24201076-G-A p.Asp657Asn missense ADAM28 1 83092 1.20349E-5 41546 0 3.98232E-6
8-24201088-G-A p.Val661Met missense ADAM28 2 83048 2.40825E-5 41524 0 1.27462E-4
8-24201097-C-T p.His664Tyr missense+splice_region ADAM28 2 82954 2.41097E-5 41477 0 6.37674E-5
8-24201097-C-CACTTCTCCATTGTGGTTGGGGTGCTGTTCCCAATGGCG p.Arg411fs frameshift ADAM28 2 82954 2.41097E-5 41477 0 NA
8-24201105-A-G c.1990+8A>G splice_region ADAM28 1 82826 1.20735E-5 41413 0 3.18532E-5
8-24201107-A-G c.1235+6A>G splice_region ADAM28 1 82804 1.20767E-5 41402 0 NA
8-24201107-A-C c.1235+6A>C splice_region ADAM28 2 82804 2.41534E-5 41402 0 NA
8-24201109-T-C c.1235+8T>C splice_region ADAM28 2 82750 2.41692E-5 41375 0 3.18593E-5
8-24207380-T-C p.Phe665Ser missense ADAM28 1 83218 1.20166E-5 41609 0 NA
8-24207385-A-G p.Ile667Val missense ADAM28 1 83230 1.20149E-5 41615 0 NA
8-24207396-G-A p.Gly419Ser missense ADAM28 1 83256 1.20111E-5 41628 0 8.23859E-6
8-24207397-G-A p.Val671Met missense ADAM28 2 83258 2.40217E-5 41629 0 NA
8-24207398-T-C p.Val671Ala missense ADAM28 23 83254 2.76263E-4 41627 0 1.51162E-4
8-24207399-G-C p.Ala420Pro missense ADAM28 2788 83162 0.0335249 41581 66 0.0470019
8-24207403-T-C p.Phe673Leu missense ADAM28 1 83264 1.201E-5 41632 0 3.97839E-6
8-24207409-A-G p.Met675Val missense ADAM28 41 83262 4.92422E-4 41631 0 5.03525E-4
8-24207412-G-A p.Ala676Thr missense ADAM28 2 83282 2.40148E-5 41641 0 6.37024E-5
8-24207413-C-T p.Ala676Val missense ADAM28 2 83274 2.40171E-5 41637 0 3.58892E-5
8-24207414-G-A p.Gly425Ser missense ADAM28 1 83264 1.201E-5 41632 0 1.433E-4
8-24207418-A-G p.Ile678Val missense ADAM28 5 83264 6.005E-5 41632 0 9.15066E-5
8-24207418-A-ATT p.Val680fs frameshift ADAM28 1 83264 1.201E-5 41632 0 NA
8-24207418-A-AT p.Val680fs frameshift ADAM28 2 83264 2.402E-5 41632 0 NA
8-24207436-A-G p.Met684Val missense ADAM28 5 83210 6.00889E-5 41605 0 8.24022E-5
8-24207437-T-C p.Met684Thr missense ADAM28 1 83202 1.20189E-5 41601 0 NA
8-24207438-G-A p.Met684Ile missense ADAM28 2945 83094 0.0354418 41547 82 0.0505514
8-24207441-A-G p.Asn434Asp missense ADAM28 1 83192 1.20204E-5 41596 0 8.23981E-6
8-24207445-C-T p.Arg687Trp missense ADAM28 18 83178 2.16403E-4 41589 0 0.00100705
8-24207461-G-C p.Arg692Thr missense ADAM28 1 83150 1.20265E-5 41575 0 NA
8-24207461-G-A p.Arg692Lys missense ADAM28 1 83150 1.20265E-5 41575 0 NA
8-24207469-C-T p.Gln695* stop_gained ADAM28 1 83108 1.20325E-5 41554 0 NA
8-24207472-A-C p.Lys696Gln missense ADAM28 563 83074 0.00677709 41537 16 0.0151004
8-24207483-G-GGATAATTATATTAATATT p.Glu448delinsGlyTerLeuTyrTerTyrTer stop_gained ADAM28 2 83000 2.40964E-5 41500 0 NA
8-24207483-G-GGATAATTATATTAAT p.Glu448delinsGlyTerLeuTyrTerTer stop_gained ADAM28 1 83000 1.20482E-5 41500 0 3.98302E-6
8-24207483-G-GGATAATTATATTA p.Arg700fs frameshift ADAM28 1 82998 1.20485E-5 41499 0 NA
8-24207483-G-A p.Glu448Lys missense+splice_region ADAM28 2 83002 2.40958E-5 41501 0 NA
8-24208737-T-C c.2100-8T>C splice_region ADAM28 1 82382 1.21386E-5 41191 0 4.73261E-6
8-24208739-T-C c.2100-6T>C splice_region ADAM28 15 82572 1.8166E-4 41286 0 2.85541E-4
8-24208741-ACAGGCCACTATCTACCACTGGCAC-A p.Arg700_Thr707delinsSer splice_acceptor ADAM28 2 82606 2.42113E-5 41303 0 7.12873E-5
8-24208741-A-G c.2100-4A>G splice_region ADAM28 1 82606 1.21057E-5 41303 0 4.52235E-6
8-24208746-C-G p.Pro701Ala missense+splice_region ADAM28 1 82732 1.20872E-5 41366 0 1.31291E-5
8-24208750-T-C p.Leu702Pro missense ADAM28 101 82792 0.00121992 41396 0 0.00143486
8-24208759-C-T p.Thr705Ile missense ADAM28 1 82900 1.20627E-5 41450 0 NA
8-24208764-A-C p.Thr707Pro missense ADAM28 2 82926 2.41179E-5 41463 0 NA
8-24208791-C-A p.Pro716Thr missense ADAM28 4 83044 4.81672E-5 41522 0 3.18756E-5
8-24208791-C-T p.Pro716Ser missense ADAM28 1 83044 1.20418E-5 41522 0 3.18756E-5
8-24208806-G-A p.Ala721Thr missense ADAM28 5 83054 6.02018E-5 41527 0 6.25E-4
8-24208812-C-T p.Gln723* stop_gained ADAM28 1 83020 1.20453E-5 41510 0 3.99151E-6
8-24208829-C-CTATA p.Val156fs frameshift ADAM28 2 82976 2.41034E-5 41488 0 3.98289E-6
8-24208829-C-T c.2178+6C>T splice_region ADAM28 1 82976 1.20517E-5 41488 0 NA
8-24208831-A-G p.Tyr154Cys missense ADAM28 3 82962 3.61611E-5 41481 0 4.12637E-5
8-24208832-T-C p.Tyr154Tyr synonymous ADAM28 2 82956 2.41092E-5 41478 0 3.58334E-5
8-24208834-T-C p.Ile155Thr missense ADAM28 3 82940 3.61707E-5 41470 0 7.42697E-5
8-24208847-G-A p.Val159Val synonymous ADAM28 40802 81332 0.501672 40666 10360 0.538405
8-24208855-T-C p.Met162Thr missense ADAM28 1 82648 1.20995E-5 41324 0 3.98352E-6
8-24208860-C-T p.Pro164Ser missense ADAM28 2 82540 2.42307E-5 41270 0 NA
8-24208869-G-A p.Val167Ile missense ADAM28 2 82290 2.43043E-5 41145 0 2.58991E-5
8-24208871-T-G p.Val167Val synonymous ADAM28 2 82218 2.43256E-5 41109 0 NA
8-24208884-TTATCCTGACTACCTATCTATCATTTCTACC-T p.Leu172_Ter174delins??? stop_lost ADAM28 11 81670 1.34688E-4 40835 0 1.20529E-5
8-24208884-T-C p.Leu172Leu synonymous ADAM28 2 81670 2.44888E-5 40835 0 8.03529E-6
8-24208890-T-G p.Ter174Glyext*? stop_lost ADAM28 1 81270 1.23047E-5 40635 0 NA
8-24209021-C-T n.471C>T splice_region ADAM28 20 50824 3.93515E-4 25412 0 NA
8-24209496-T-G c.2179-4T>G splice_region ADAM28 1 82782 1.20799E-5 41391 0 8.24946E-6
8-24209505-T-G p.Ser728Arg missense ADAM28 1 82840 1.20715E-5 41420 0 3.9847E-6
8-24209508-G-GATGA p.Lys731fs frameshift ADAM28 2 82870 2.41342E-5 41435 0 3.98384E-6
8-24209515-C-T p.Pro732Ser missense ADAM28 1 82884 1.20651E-5 41442 0 NA
8-24209546-A-G p.Asn742Ser missense ADAM28 1 82886 1.20648E-5 41443 0 NA
8-24209548-G-A p.Glu743Lys missense ADAM28 1 82900 1.20627E-5 41450 0 3.98318E-6
8-24209551-C-A p.Pro744Thr missense ADAM28 4 82874 4.8266E-5 41437 0 NA
8-24209564-T-C p.Phe748Ser missense+splice_region ADAM28 1 82820 1.20744E-5 41410 0 NA
8-24209571-T-C c.2244+6T>C splice_region ADAM28 1 82738 1.20863E-5 41369 0 NA
8-24209572-T-C c.2244+7T>C splice_region ADAM28 1 82746 1.20852E-5 41373 0 NA
8-24209573-A-G c.2244+8A>G splice_region ADAM28 1 82728 1.20878E-5 41364 0 NA
8-24211271-TAATTAACGTAGCATA-T p.His749fs frameshift ADAM28 1 78010 1.28189E-5 39005 0 4.01577E-6
8-24211278-C-T c.2245-5C>T splice_region ADAM28 75946 77230 0.983374 38615 37385 0.987284
8-24211278-C-G c.2245-5C>G splice_region ADAM28 1 78406 1.27541E-5 39203 0 NA
8-24211291-C-T p.Asp751Asp synonymous ADAM28 1 78872 1.26788E-5 39436 0 3.18654E-5
8-24211293-C-A p.Thr752Lys missense ADAM28 1 78874 1.26784E-5 39437 0 1.6488E-5
8-24211297-C-T p.Asn753Asn synonymous ADAM28 2 78854 2.53633E-5 39427 0 5.77091E-5
8-24211298-G-A p.Ala754Thr missense ADAM28 15 78758 1.90457E-4 39379 0 0.00125
8-24211307-C-T p.Pro757Ser missense ADAM28 3 78970 3.79891E-5 39485 0 1.91339E-4
8-24211311-C-A p.Thr758Asn missense ADAM28 4 78934 5.06752E-5 39467 0 8.24334E-5
8-24211313-G-GT p.Lys761fs frameshift ADAM28 1 78900 1.26743E-5 39450 0 3.99106E-6
8-24211320-A-G p.Lys761Arg missense ADAM28 1 78974 1.26624E-5 39487 0 NA
8-24211324-T-C p.Asp762Asp synonymous ADAM28 1 78918 1.26714E-5 39459 0 NA
8-24211327-T-C p.Asn763Asn synonymous ADAM28 1 78828 1.26858E-5 39414 0 3.99167E-6
8-24211331-G-A p.Val765Met missense ADAM28 77188 78444 0.983989 39222 38015 0.987477
8-24211336-T-C p.Ser766Ser synonymous ADAM28 2 78710 2.54097E-5 39355 0 3.59761E-5
8-24211908-A-G p.Pro773Pro synonymous ADAM28 1 82672 1.2096E-5 41336 0 NA
8-24211914-A-T p.Ala775Ala synonymous ADAM28 8 82694 9.67422E-5 41347 0 NA
8-24211915-T-G p.Ter776Glyext*? stop_lost ADAM28 9 82696 1.08832E-4 41348 0 9.52224E-5
8-24211982-CAGAG-C c.*188_*2459delGAGA splice_region ADAM28 1 82210 1.2164E-5 41105 0 NA
8-24212581-C-T c.*664C>T splice_region ADAM28 1 42866 2.33285E-5 21433 0 NA