Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
8-39602347-A-G c.*30+2T>C splice_donor ADAM2 1 81110 1.23289E-5 40555 0 1.6699E-5
8-39602401-C-T p.Ser729Asn missense ADAM2 2 81720 2.44738E-5 40860 0 NA
8-39602412-C-A p.Glu725Asp missense+splice_region ADAM2 2 81582 2.45152E-5 40791 0 NA
8-39602416-C-A c.2175-4G>T splice_region ADAM2 9 81556 1.10354E-4 40778 0 4.4603E-4
8-39602417-A-C c.2175-5T>G splice_region ADAM2 1 81518 1.22672E-5 40759 0 NA
8-39602419-A-G c.2175-7T>C splice_region ADAM2 8 81478 9.8186E-5 40739 0 8.44766E-5
8-39603983-C-T c.2174+8G>A splice_region ADAM2 1 81254 1.23071E-5 40627 0 8.41836E-6
8-39603988-T-C c.2174+3A>G splice_region ADAM2 1 81470 1.22745E-5 40735 0 NA
8-39603989-A-G c.2174+2T>C splice_donor ADAM2 3 81542 3.67909E-5 40771 0 3.18451E-5
8-39603995-C-T p.Asp724Asn missense ADAM2 1 81780 1.22279E-5 40890 0 6.30517E-4
8-39603996-G-A p.Ser723Ser synonymous ADAM2 5 81928 6.10292E-5 40964 0 6.37633E-5
8-39604003-T-C p.Tyr721Cys missense ADAM2 2 82298 2.43019E-5 41149 0 3.31395E-5
8-39604015-C-T p.Arg717Lys missense ADAM2 9 82620 1.08932E-4 41310 0 4.67894E-5
8-39604025-T-C p.Lys714Glu missense ADAM2 11 82738 1.3295E-4 41369 0 1.27437E-4
8-39604026-C-T p.Arg713Arg synonymous ADAM2 1 82740 1.20861E-5 41370 0 NA
8-39604071-A-G p.Ile698Ile synonymous ADAM2 2 83092 2.40697E-5 41546 0 6.37308E-5
8-39604076-T-C p.Ile697Val missense ADAM2 2 83108 2.40651E-5 41554 0 1.21382E-5
8-39604084-G-T p.Pro694His missense ADAM2 2 83110 2.40645E-5 41555 0 8.10872E-6
8-39604087-A-G p.Ile693Thr missense ADAM2 1 83118 1.20311E-5 41559 0 4.04413E-6
8-39604094-A-C p.Leu691Val missense ADAM2 1 83108 1.20325E-5 41554 0 4.05439E-6
8-39604096-A-G p.Phe690Ser missense ADAM2 1 83108 1.20325E-5 41554 0 3.18613E-5
8-39604103-G-C p.Pro688Ala missense ADAM2 8 83094 9.62765E-5 41547 0 4.47084E-4
8-39604114-G-A p.Pro684Leu missense ADAM2 2 83070 2.40761E-5 41535 0 NA
8-39604116-T-A p.Lys683Asn missense ADAM2 157 83064 0.00189011 41532 0 0.00163867
8-39604130-T-C p.Ile679Val missense ADAM2 1 82990 1.20496E-5 41495 0 NA
8-39604144-C-T p.Arg674His missense ADAM2 12 82832 1.44872E-4 41416 0 1.59673E-4
8-39604144-C-G p.Arg674Pro missense ADAM2 1 82832 1.20726E-5 41416 0 NA
8-39604145-G-A p.Arg674Cys missense ADAM2 14 82792 1.69098E-4 41396 0 9.58344E-5
8-39604157-G-GA c.2015-8_2015-7insT splice_region ADAM2 3 82382 3.64157E-5 41191 0 9.70427E-4
8-39604157-GA-G c.2015-8delT splice_region ADAM2 1 82416 1.21336E-5 41208 0 1.26508E-4
8-39606824-T-A c.2014+7A>T splice_region ADAM2 1 82722 1.20887E-5 41361 0 3.18654E-5
8-39606830-C-G c.2014+1G>C splice_donor ADAM2 168 82876 0.00202712 41438 1 0.0041773
8-39606831-C-T p.Glu672Lys missense+splice_region ADAM2 1 82892 1.20639E-5 41446 0 NA
8-39606837-G-T p.Leu670Ile missense ADAM2 1 82970 1.20525E-5 41485 0 NA
8-39606842-G-A p.Ala668Val missense ADAM2 1 83048 1.20412E-5 41524 0 3.18878E-5
8-39606849-T-G p.Ile666Leu missense ADAM2 1 83116 1.20314E-5 41558 0 8.27869E-6
8-39606855-C-G p.Val664Leu missense ADAM2 1 83154 1.20259E-5 41577 0 3.98378E-6
8-39606869-C-A p.Gly659Val missense ADAM2 1 83174 1.2023E-5 41587 0 7.96419E-6
8-39606881-C-A p.Ser655Ile missense ADAM2 1 83196 1.20198E-5 41598 0 1.65055E-5
8-39606884-C-G p.Gly654Ala missense ADAM2 2 83202 2.40379E-5 41601 0 6.25E-4
8-39606885-C-CA p.Gly654fs frameshift ADAM2 1 83198 1.20195E-5 41599 0 3.98038E-6
8-39606895-T-A p.Leu650Leu synonymous ADAM2 4 83220 4.80654E-5 41610 0 1.40227E-4
8-39606900-C-T p.Asp649Asn missense ADAM2 25 83216 3.00423E-4 41608 0 2.1093E-4
8-39606913-G-A p.Cys644Cys synonymous ADAM2 7 83252 8.40821E-5 41626 0 0.00151057
8-39606919-T-C p.Pro642Pro synonymous ADAM2 5 83254 6.00572E-5 41627 0 1.89694E-4
8-39606929-T-C p.Tyr639Cys missense ADAM2 283 83230 0.00340022 41615 1 0.00905266
8-39606932-G-A p.Ser638Leu missense ADAM2 1 83228 1.20152E-5 41614 0 NA
8-39606935-G-A p.Ala637Val missense ADAM2 158 83234 0.00189826 41617 2 0.00352467
8-39606939-T-C p.Ser636Gly missense ADAM2 1 83226 1.20155E-5 41613 0 4.125E-5
8-39606942-A-G p.Cys635Arg missense ADAM2 2 83230 2.40298E-5 41615 0 1.19506E-5
8-39606951-G-A p.His632Tyr missense ADAM2 1 83208 1.20181E-5 41604 0 3.99023E-6
8-39606953-T-C p.Lys631Arg missense ADAM2 1 83206 1.20184E-5 41603 0 3.18837E-5
8-39606969-C-A p.Val626Leu missense+splice_region ADAM2 1 83166 1.20241E-5 41583 0 NA
8-39606971-T-A c.1876-2A>T splice_acceptor ADAM2 1 83152 1.20262E-5 41576 0 NA
8-39607178-C-T c.1875+8G>A splice_region ADAM2 3 82854 3.62083E-5 41427 0 3.67948E-4
8-39607192-A-G p.Asp623Asp synonymous ADAM2 1 82950 1.20555E-5 41475 0 4.00013E-6
8-39607209-T-C p.Thr618Ala missense ADAM2 1 83010 1.20467E-5 41505 0 NA
8-39607223-C-A p.Gly613Val missense ADAM2 2 82988 2.40999E-5 41494 0 8.27349E-6
8-39607259-C-G p.Cys601Ser missense ADAM2 1 82754 1.2084E-5 41377 0 8.30482E-6
8-39607264-C-G c.1798-1G>C splice_acceptor ADAM2 2 82696 2.4185E-5 41348 0 NA
8-39613246-C-A c.1797+1G>T splice_donor ADAM2 1 82512 1.21194E-5 41256 0 NA
8-39613247-C-G p.Lys599Asn missense+splice_region ADAM2 6 82556 7.26779E-5 41278 0 4.06385E-6
8-39613259-A-G p.Cys595Cys synonymous ADAM2 2 82834 2.41447E-5 41417 0 5.03525E-4
8-39613262-A-G p.Ser594Ser synonymous ADAM2 212 82880 0.00255792 41440 1 0.00579544
8-39613283-C-A p.Met587Ile missense ADAM2 72 83112 8.66301E-4 41556 0 0.00178333
8-39613286-C-A p.Lys586Asn missense ADAM2 1 83144 1.20273E-5 41572 0 NA
8-39613288-T-C p.Lys586Glu missense ADAM2 1 83148 1.20267E-5 41574 0 NA
8-39613295-G-T p.Asp583Glu missense ADAM2 1 83186 1.20213E-5 41593 0 NA
8-39613305-T-C p.Asp580Gly missense ADAM2 1 83218 1.20166E-5 41609 0 3.98645E-6
8-39613308-CTGGCAA-C p.Phe577_Ser579delinsCys disruptive_inframe_deletion ADAM2 36 83232 4.32526E-4 41616 0 2.97599E-4
8-39613308-C-T p.Ser579Asn missense ADAM2 1 83232 1.20146E-5 41616 0 NA
8-39613315-A-ATT p.Phe577fs frameshift ADAM2 9 83244 1.08116E-4 41622 0 3.80197E-4
8-39613321-C-A p.Val575Leu missense ADAM2 4 83240 4.80538E-5 41620 0 2.39481E-5
8-39613333-GATGTCCACTTATGTTGGCATAA-G p.Tyr564fs frameshift ADAM2 1 83230 1.20149E-5 41615 0 NA
8-39613339-C-T p.Gly413Arg missense+splice_region ADAM2 1 83210 1.20178E-5 41605 0 7.97811E-6
8-39613340-A-G p.Asp412Asp splice_region+synonymous ADAM2 1 83204 1.20187E-5 41602 0 NA
8-39613345-T-C p.Ile567Val missense ADAM2 1 83182 1.20218E-5 41591 0 7.97645E-6
8-39613346-G-A c.1236-6C>T splice_region ADAM2 3 83174 3.6069E-5 41587 0 2.79258E-5
8-39613382-T-G p.Leu554Phe missense ADAM2 1 82824 1.20738E-5 41412 0 NA
8-39613396-C-T p.Val550Ile missense ADAM2 2 82570 2.42219E-5 41285 0 2.48731E-5
8-39613403-A-G p.Cys547Cys synonymous ADAM2 1 82282 1.21533E-5 41141 0 4.09776E-6
8-39613406-T-C p.Ile546Met missense ADAM2 8 82114 9.74255E-5 41057 0 5.09652E-4
8-39613417-C-T p.Gly543Arg missense ADAM2 1 81624 1.22513E-5 40812 0 4.15932E-5
8-39613418-G-A p.Cys542Cys synonymous ADAM2 7 81556 8.58306E-5 40778 0 1.27567E-4
8-39613421-C-T p.Gln541Gln synonymous ADAM2 1 81516 1.22675E-5 40758 0 8.34822E-6
8-39613422-T-C p.Gln541Arg missense ADAM2 1 81446 1.22781E-5 40723 0 NA
8-39613437-T-G c.1614-7A>C splice_region ADAM2 1 80314 1.24511E-5 40157 0 9.59536E-6
8-39618689-A-G c.1613+6T>C splice_region ADAM2 1 81338 1.22944E-5 40669 0 NA
8-39618692-T-C c.1613+3A>G splice_region ADAM2 2 81486 2.45441E-5 40743 0 1.66839E-5
8-39618695-T-C p.Asp538Gly missense+splice_region ADAM2 1 81520 1.22669E-5 40760 0 8.32376E-6
8-39618696-C-T p.Asp538Asn missense+splice_region ADAM2 1 81560 1.22609E-5 40780 0 5.04032E-4
8-39618747-C-T p.Val521Ile missense ADAM2 2 82770 2.41633E-5 41385 0 2.47541E-5
8-39618749-T-C p.Asp520Gly missense ADAM2 8 82770 9.66534E-5 41385 0 6.25E-4
8-39618758-GA-G p.Ser517fs frameshift ADAM2 1 82736 1.20866E-5 41368 0 NA
8-39618768-G-A p.His514Tyr missense ADAM2 1 82694 1.20928E-5 41347 0 3.18756E-5
8-39618769-A-G p.Ser513Ser synonymous ADAM2 2 82714 2.41797E-5 41357 0 8.25559E-6
8-39618801-C-A c.1508-1G>T splice_acceptor ADAM2 2 82106 2.43588E-5 41053 0 NA
8-39624365-A-T c.1507+2T>A splice_donor ADAM2 1 82926 1.20589E-5 41463 0 NA
8-39624366-C-T c.1507+1G>A splice_donor ADAM2 1 82916 1.20604E-5 41458 0 NA
8-39624373-C-T p.Gly501Ser missense ADAM2 5 82962 6.02686E-5 41481 0 0.001657
8-39624376-AT-A p.Phe500fs frameshift ADAM2 1 82970 1.20525E-5 41485 0 NA
8-39624378-G-A p.Thr499Ile missense ADAM2 4 83034 4.8173E-5 41517 0 6.25E-4
8-39624400-C-G p.Gly492Arg missense ADAM2 1 83280 1.20077E-5 41640 0 3.99728E-6
8-39624402-C-T p.Ser491Asn missense ADAM2 1 83282 1.20074E-5 41641 0 7.98811E-6
8-39624413-T-G p.Gly487Gly synonymous ADAM2 2 83296 2.40108E-5 41648 0 NA
8-39624422-A-G p.Cys484Cys synonymous ADAM2 3 83306 3.60118E-5 41653 0 3.29582E-5
8-39624429-C-T p.Trp482* stop_gained ADAM2 10 83316 1.20025E-4 41658 0 4.11936E-5
8-39624438-A-G p.Leu479Pro missense ADAM2 68 83324 8.16091E-4 41662 0 9.39014E-4
8-39624446-C-T p.Pro476Pro synonymous ADAM2 2 83338 2.39987E-5 41669 0 1.64739E-5
8-39624447-G-A p.Pro476Leu missense ADAM2 3 83336 3.59988E-5 41668 0 5.03525E-4
8-39624452-C-T p.Gly474Gly synonymous ADAM2 1 83332 1.20002E-5 41666 0 8.23696E-6
8-39624457-T-G p.Thr473Pro missense ADAM2 4 83336 4.79985E-5 41668 0 NA
8-39624459-T-C p.Gln472Arg missense ADAM2 2 83326 2.40021E-5 41663 0 1.64737E-5
8-39624486-G-A p.Ala463Val missense ADAM2 3 83352 3.59919E-5 41676 0 1.2734E-4
8-39624517-C-T p.Asp453Asn missense ADAM2 1 83334 1.19999E-5 41667 0 8.24144E-6
8-39624518-G-T p.Cys452* stop_gained ADAM2 1 83330 1.20005E-5 41665 0 NA
8-39624525-T-C p.Glu450Gly missense ADAM2 1 83326 1.20011E-5 41663 0 NA
8-39624529-AG-A p.Phe449fs frameshift ADAM2 1 83332 1.20002E-5 41666 0 3.97763E-6
8-39624530-G-A p.Ser448Ser synonymous ADAM2 3 83326 3.60032E-5 41663 0 3.1841E-5
8-39624543-A-G p.Met444Thr missense ADAM2 1 83282 1.20074E-5 41641 0 1.65041E-5
8-39624547-T-C p.Arg443Gly missense ADAM2 1 83274 1.20085E-5 41637 0 3.98013E-6
8-39624554-T-G p.Ser440Ser synonymous ADAM2 1 83276 1.20083E-5 41638 0 NA
8-39624558-A-G p.Met439Thr missense ADAM2 4 83262 4.80411E-5 41631 0 3.1837E-5
8-39624667-C-T c.1311+5G>A splice_region ADAM2 1 83264 1.201E-5 41632 0 1.23348E-5
8-39624683-C-T p.Glu434Lys missense ADAM2 10 83272 1.20088E-4 41636 0 2.30935E-4
8-39624684-G-A p.Cys433Cys synonymous ADAM2 4 83262 4.80411E-5 41631 0 1.31939E-4
8-39624688-C-A p.Cys432Phe missense ADAM2 9 83270 1.08082E-4 41635 0 0.004375
8-39624689-A-G p.Cys432Arg missense ADAM2 2 83266 2.40194E-5 41633 0 4.12154E-5
8-39624713-C-T p.Gly424Ser missense ADAM2 12 83274 1.44103E-4 41637 0 6.36983E-5
8-39624721-A-G p.Phe421Ser missense ADAM2 1 83262 1.20103E-5 41631 0 4.08647E-6
8-39624736-A-G p.Ile416Thr missense ADAM2 1 83232 1.20146E-5 41616 0 1.22971E-5
8-39624745-C-CCCTT p.Cys413fs frameshift ADAM2 3 83204 3.6056E-5 41602 0 3.1841E-5
8-39624746-ATGTT-A p.Glu411fs frameshift ADAM2 3 83200 3.60577E-5 41600 0 3.1837E-5
8-39624746-A-G p.Cys413Arg missense ADAM2 1 83200 1.20192E-5 41600 0 2.0632E-5
8-39624747-T-C p.Thr412Thr synonymous ADAM2 1 83198 1.20195E-5 41599 0 3.1837E-5
8-39624765-A-G p.Cys406Cys synonymous ADAM2 2 83150 2.40529E-5 41575 0 6.3678E-5
8-39624778-G-A c.1213-8C>T splice_region ADAM2 1 83030 1.20438E-5 41515 0 NA
8-39626910-C-T c.1212+1G>A splice_donor ADAM2 1 83236 1.2014E-5 41618 0 NA
8-39626913-G-C p.Gln404Glu missense+splice_region ADAM2 1 83264 1.201E-5 41632 0 NA
8-39626922-C-T p.Gly401Arg missense ADAM2 120 83300 0.00144058 41650 0 0.00245239
8-39626925-A-G p.Cys400Arg missense ADAM2 1 83302 1.20045E-5 41651 0 NA
8-39626937-C-T p.Glu396Lys missense ADAM2 1 83308 1.20036E-5 41654 0 NA
8-39626938-T-C p.Gly395Gly synonymous ADAM2 1 83312 1.20031E-5 41656 0 NA
8-39626945-T-A p.Glu393Val missense ADAM2 1 83322 1.20016E-5 41661 0 NA
8-39626950-C-G p.Lys391Asn missense ADAM2 1 83322 1.20016E-5 41661 0 NA
8-39626957-T-TTACCACA p.Asn389fs frameshift ADAM2 2 83320 2.40038E-5 41660 0 NA
8-39626962-A-C p.Cys387Trp missense ADAM2 1 83328 1.20008E-5 41664 0 NA
8-39626968-T-TAGTG p.Val386fs frameshift ADAM2 80 83320 9.60154E-4 41660 2 0.00302115
8-39626968-T-C p.Ala385Ala synonymous ADAM2 7 83320 8.40134E-5 41660 0 4.12208E-5
8-39626980-G-GA p.Lys382fs frameshift ADAM2 6 83320 7.20115E-5 41660 0 5.17203E-5
8-39626981-A-G p.Phe381Ser missense ADAM2 1 83318 1.20022E-5 41659 0 1.23697E-4
8-39626983-A-G p.Phe380Phe synonymous ADAM2 3 83316 3.60075E-5 41658 0 5.56886E-5
8-39626985-A-T p.Phe380Ile missense ADAM2 22 83314 2.64061E-4 41657 0 1.31265E-4
8-39626995-G-A p.Arg376Arg synonymous ADAM2 1 83294 1.20057E-5 41647 0 1.65019E-5
8-39626996-C-T p.Arg376His missense ADAM2 1 83296 1.20054E-5 41648 0 2.47545E-5
8-39627007-G-A p.His372His synonymous ADAM2 1 83296 1.20054E-5 41648 0 NA
8-39627014-C-T p.Cys370Tyr missense ADAM2 1 83292 1.2006E-5 41646 0 NA
8-39627024-TCTG-T p.Gln366del conservative_inframe_deletion ADAM2 1 83278 1.2008E-5 41639 0 NA
8-39627042-G-A p.His361Tyr missense ADAM2 3 83246 3.60378E-5 41623 0 3.97962E-6
8-39627049-G-A p.Asp358Asp synonymous ADAM2 2 83214 2.40344E-5 41607 0 3.58269E-5
8-39627050-T-C p.Asp358Gly missense ADAM2 1 83208 1.20181E-5 41604 0 3.35807E-5
8-39627054-C-T p.Glu357Lys missense ADAM2 11 83198 1.32215E-4 41599 0 2.86661E-4
8-39627074-A-G p.Ile350Thr missense ADAM2 2 83130 2.40587E-5 41565 0 NA
8-39627075-T-A p.Ile350Phe missense ADAM2 1 83116 1.20314E-5 41558 0 3.18431E-5
8-39627079-C-G p.Val348Val synonymous ADAM2 1 83124 1.20302E-5 41562 0 NA
8-39627083-C-T p.Gly347Asp missense ADAM2 41 83094 4.93417E-4 41547 1 2.67758E-4
8-39627083-C-A p.Gly347Val missense ADAM2 1 83096 1.20343E-5 41548 0 8.90012E-6
8-39627093-G-A p.His344Tyr missense+splice_region ADAM2 6 83010 7.22804E-5 41505 0 8.83449E-5
8-39627093-G-C p.His344Asp missense+splice_region ADAM2 1 83010 1.20467E-5 41505 0 NA
8-39634554-G-T p.Pro340Thr missense ADAM2 1 82284 1.2153E-5 41142 0 3.36225E-5
8-39634563-T-G p.Ile337Leu missense ADAM2 1 82356 1.21424E-5 41178 0 3.18593E-5
8-39634572-C-T p.Ala334Thr missense ADAM2 1 82348 1.21436E-5 41174 0 4.00026E-6
8-39634583-T-C p.Gln330Arg missense ADAM2 6 82452 7.27696E-5 41226 0 9.55536E-5
8-39634585-G-A p.Cys329Cys synonymous ADAM2 1 82440 1.213E-5 41220 0 NA
8-39634603-A-G p.Tyr323Tyr synonymous ADAM2 3 82526 3.63522E-5 41263 0 3.18492E-5
8-39634604-T-A p.Tyr323Phe missense ADAM2 2 82528 2.42342E-5 41264 0 9.58267E-5
8-39634617-T-C p.Met319Val missense ADAM2 2 82592 2.42154E-5 41296 0 NA
8-39634647-C-A p.Val309Phe missense ADAM2 1 82708 1.20907E-5 41354 0 8.27773E-6
8-39634648-T-C p.Ala308Ala synonymous ADAM2 1 82704 1.20913E-5 41352 0 NA
8-39634668-T-C p.Ile302Val missense ADAM2 2 82702 2.41832E-5 41351 0 5.03525E-4
8-39634673-C-T p.Arg300Lys missense ADAM2 2 82692 2.41861E-5 41346 0 4.15107E-6
8-39634674-T-G p.Arg300Arg synonymous ADAM2 4 82686 4.83758E-5 41343 0 2.07371E-5
8-39634676-G-T p.Pro299His missense ADAM2 2 82670 2.41926E-5 41335 0 1.24709E-5
8-39634685-G-GA c.892-6_892-5insT splice_region ADAM2 50 82482 6.06193E-4 41241 3 0.00197552
8-39634685-GA-G c.892-6delT splice_region ADAM2 6 82618 7.26234E-5 41309 0 2.72847E-4
8-39644502-A-T p.Gly294Gly synonymous ADAM2 2 82278 2.43078E-5 41139 0 NA
8-39644526-C-T p.Met286Ile missense ADAM2 3 82246 3.64759E-5 41123 0 3.30371E-5
8-39644529-C-A p.Lys285Asn missense ADAM2 3 82234 3.64813E-5 41117 0 NA
8-39644541-G-T p.Thr281Thr synonymous ADAM2 7 82008 8.53575E-5 41004 0 2.55673E-4
8-39644542-G-C p.Thr281Ser missense ADAM2 29 81968 3.53797E-4 40984 0 3.8019E-4
8-39644546-C-A p.Ala280Ser missense ADAM2 1 82022 1.21919E-5 41011 0 8.30551E-6
8-39644551-A-G p.Val278Ala missense ADAM2 9 81970 1.09796E-4 40985 0 9.58283E-5
8-39644551-A-C p.Val278Gly missense ADAM2 1 81970 1.21996E-5 40985 0 NA
8-39644568-T-C p.Arg272Arg synonymous ADAM2 1 81872 1.22142E-5 40936 0 NA
8-39644572-T-C p.Tyr271Cys missense+splice_region ADAM2 1 81798 1.22252E-5 40899 0 3.73038E-5
8-39644575-CTT-C c.810-3_810-2delAA splice_acceptor ADAM2 1 81760 1.22309E-5 40880 0 NA
8-39644577-TAA-T c.810-5_810-4delTT splice_region ADAM2 1 81718 1.22372E-5 40859 0 NA
8-39644577-T-G c.810-3A>C splice_region ADAM2 1 81718 1.22372E-5 40859 0 NA
8-39644581-T-C c.810-7A>G splice_region ADAM2 1 81588 1.22567E-5 40794 0 8.42063E-6
8-39645608-G-A p.Leu269Phe missense ADAM2 1 81034 1.23405E-5 40517 0 NA
8-39645617-C-T p.Ala266Thr missense ADAM2 2 81076 2.46682E-5 40538 0 6.39264E-5
8-39645629-G-A p.Pro262Ser missense ADAM2 23 81596 2.81877E-4 40798 0 8.30777E-4
8-39645629-G-T p.Pro262Thr missense ADAM2 1 81596 1.22555E-5 40798 0 2.53584E-5
8-39645630-A-T p.Arg261Arg synonymous ADAM2 1 81642 1.22486E-5 40821 0 NA
8-39645631-C-T p.Arg261His missense ADAM2 5 81554 6.13091E-5 40777 0 1.18078E-4
8-39645632-G-A p.Arg261Cys missense ADAM2 9 81634 1.10248E-4 40817 0 1.91828E-4
8-39645637-A-G p.Val259Ala missense ADAM2 3 81752 3.66964E-5 40876 0 9.17103E-6
8-39645667-G-A p.Thr249Ile missense ADAM2 2 82320 2.42954E-5 41160 0 1.66146E-5
8-39645672-T-C p.Leu247Leu synonymous ADAM2 1 82492 1.21224E-5 41246 0 NA
8-39645676-A-G p.Leu246Ser missense ADAM2 6 82420 7.27979E-5 41210 0 1.90925E-4
8-39645677-A-G p.Leu246Leu synonymous ADAM2 3 82422 3.63981E-5 41211 0 6.39427E-5
8-39645679-T-C p.Glu245Gly missense ADAM2 2 82470 2.42512E-5 41235 0 NA
8-39645686-C-G p.Ala243Pro missense ADAM2 1 82452 1.21283E-5 41226 0 NA
8-39645692-C-T p.Gly241Arg missense ADAM2 1 82458 1.21274E-5 41229 0 8.30206E-6
8-39645700-G-A p.Ala238Val missense ADAM2 23 82410 2.79092E-4 41205 0 6.7314E-5
8-39645711-T-TATTGGTTTGAAG p.Glu234delinsAspPheLysProIle disruptive_inframe_insertion ADAM2 1 82374 1.21398E-5 41187 0 NA
8-39645713-C-T p.Glu234Lys missense ADAM2 1 82356 1.21424E-5 41178 0 1.66248E-5
8-39645714-A-C p.Asp233Glu missense ADAM2 8 82362 9.71322E-5 41181 0 0.00302725
8-39645717-T-A p.Ile232Ile synonymous ADAM2 1 82346 1.21439E-5 41173 0 NA
8-39645718-A-G p.Ile232Thr missense ADAM2 1 82328 1.21465E-5 41164 0 8.45487E-6
8-39645725-G-A p.Leu230Phe missense ADAM2 2 82230 2.4322E-5 41115 0 9.9975E-5
8-39645728-C-A p.Glu229* stop_gained ADAM2 1 81986 1.21972E-5 40993 0 NA
8-39645732-T-A p.Ser227Ser synonymous ADAM2 1 82088 1.2182E-5 41044 0 8.35282E-6
8-39645738-C-G p.Leu225Leu synonymous ADAM2 1 81966 1.22002E-5 40983 0 NA
8-39645740-G-C p.Leu225Val missense ADAM2 4 81796 4.89021E-5 40898 0 1.67847E-5
8-39645747-T-G p.Thr222Thr synonymous ADAM2 1 81482 1.22726E-5 40741 0 NA
8-39645748-G-A p.Thr222Ile missense ADAM2 2 81182 2.4636E-5 40591 0 8.44637E-5
8-39645770-T-G p.Ile215Leu missense+splice_region ADAM2 12 80252 1.49529E-4 40126 0 5.07099E-4
8-39645773-A-G c.643-3T>C splice_region ADAM2 6 80122 7.48858E-5 40061 0 6.96064E-5
8-39646181-G-T c.642+7C>A splice_region ADAM2 1 81476 1.22736E-5 40738 0 NA
8-39646182-A-C c.642+6T>G splice_region ADAM2 1 81512 1.22681E-5 40756 0 8.39306E-6
8-39646194-C-T p.Thr212Thr synonymous ADAM2 2 81552 2.45242E-5 40776 0 3.20061E-5
8-39646195-G-A p.Thr212Met missense ADAM2 15 81570 1.83891E-4 40785 0 2.88055E-4
8-39646197-C-T p.Leu211Leu synonymous ADAM2 1 81620 1.22519E-5 40810 0 NA
8-39646201-C-A p.Gly210Val missense ADAM2 2 81646 2.4496E-5 40823 0 8.54642E-6
8-39646221-T-C p.Gln203Gln synonymous ADAM2 86 81742 0.00105209 40871 0 7.9275E-4
8-39646226-C-T p.Ala202Thr missense ADAM2 205 81628 0.00251139 40814 1 0.00462072
8-39646227-G-A p.Val201Val synonymous ADAM2 5 81660 6.12295E-5 40830 0 4.17732E-5
8-39646227-G-C p.Val201Val synonymous ADAM2 1 81660 1.22459E-5 40830 0 2.56689E-5
8-39646247-C-T p.Gly195Arg missense ADAM2 1 81126 1.23265E-5 40563 0 NA
8-39646253-G-A p.His193Tyr missense ADAM2 1 80858 1.23674E-5 40429 0 9.21192E-6
8-39646261-T-A c.571-2A>T splice_acceptor ADAM2 684 79206 0.00863571 39603 7 0.0207809
8-39646264-A-G c.571-5T>C splice_region ADAM2 1 79062 1.26483E-5 39531 0 3.20739E-5
8-39666926-T-G c.570+3A>C splice_region ADAM2 2 77064 2.59525E-5 38532 0 8.90646E-6
8-39666929-C-T p.Leu190Leu splice_region+synonymous ADAM2 1 77238 1.2947E-5 38619 0 1.82792E-5
8-39666931-A-C p.Leu190Val missense+splice_region ADAM2 3 77388 3.87657E-5 38694 0 NA
8-39666941-A-C p.Val186Val synonymous ADAM2 1 77742 1.28631E-5 38871 0 NA
8-39666953-C-T p.Met182Ile missense ADAM2 4 78158 5.11784E-5 39079 0 2.68015E-5
8-39666963-T-C p.Tyr179Cys missense ADAM2 6 78030 7.68935E-5 39015 0 1.02467E-4
8-39678526-C-T p.Val170Ile missense ADAM2 2 81534 2.45296E-5 40767 0 5.21404E-5
8-39678527-G-A p.Ser169Ser synonymous ADAM2 1 81546 1.2263E-5 40773 0 3.1904E-5
8-39678539-A-G p.Phe165Phe synonymous ADAM2 19 81896 2.32002E-4 40948 0 9.37926E-5
8-39678543-G-A p.Ser164Phe missense ADAM2 1 81968 1.21999E-5 40984 0 4.09443E-6
8-39678570-T-C p.Glu155Gly missense ADAM2 3 82206 3.64937E-5 41103 0 8.32473E-6
8-39678576-T-C p.Tyr153Cys missense ADAM2 1 82210 1.2164E-5 41105 0 0.00125313
8-39678580-A-C p.Leu152Val missense ADAM2 1 82248 1.21584E-5 41124 0 NA
8-39678587-A-T p.Asp149Glu missense ADAM2 1 82292 1.21518E-5 41146 0 6.37227E-5
8-39678591-G-A p.Ala148Val missense ADAM2 11 82282 1.33687E-4 41141 0 5.04032E-4
8-39678599-A-G p.His145His synonymous ADAM2 3 82318 3.6444E-5 41159 0 8.31573E-6
8-39678610-G-A p.Gln142* stop_gained ADAM2 1 82326 1.21468E-5 41163 0 3.19183E-5
8-39678612-T-C p.Tyr141Cys missense ADAM2 5 82338 6.07253E-5 41169 0 3.99511E-6
8-39678626-A-AATTTACTG p.Glu137fs frameshift ADAM2 1 82332 1.21459E-5 41166 0 3.18573E-5
8-39678629-GCC-G p.Gly135fs frameshift ADAM2 1 82294 1.21516E-5 41147 0 3.18756E-5
8-39678632-A-ACTGT p.Gly135fs frameshift ADAM2 1 82278 1.21539E-5 41139 0 3.18613E-5
8-39678633-A-G p.Val134Ala missense ADAM2 3 82264 3.6468E-5 41132 0 1.60079E-5
8-39678642-T-C p.Glu131Gly missense ADAM2 1 82164 1.21708E-5 41082 0 NA
8-39678650-T-C p.Glu128Glu synonymous ADAM2 2 81982 2.43956E-5 40991 0 8.49849E-5
8-39678652-C-G p.Glu128Gln missense ADAM2 28 81956 3.41647E-4 40978 0 6.25E-4
8-39678661-A-G p.Tyr125His missense ADAM2 1 81804 1.22243E-5 40902 0 NA
8-39678667-C-T p.Val123Ile missense ADAM2 1 81600 1.22549E-5 40800 0 NA
8-39678670-T-C p.Asn122Asp missense ADAM2 4 81510 4.90737E-5 40755 0 8.88652E-6
8-39678685-C-T p.Val117Ile missense ADAM2 4 80790 4.95111E-5 40395 0 6.15088E-5
8-39678686-G-A p.Gly116Gly synonymous ADAM2 2 80462 2.48565E-5 40231 0 3.01853E-5
8-39678687-C-T p.Gly116Asp missense+splice_region ADAM2 1 80482 1.24251E-5 40241 0 1.01628E-5
8-39678690-C-T c.345-1G>A splice_acceptor ADAM2 3 80088 3.74588E-5 40044 0 1.51865E-5
8-39678697-T-C c.345-8A>G splice_region ADAM2 2 79520 2.51509E-5 39760 0 1.14837E-5
8-39679116-A-C p.Cys111Trp missense ADAM2 6 82864 7.24078E-5 41432 0 2.55528E-5
8-39679120-G-A p.Thr110Ile missense ADAM2 1 82926 1.20589E-5 41463 0 NA
8-39679134-C-G p.Val105Val synonymous ADAM2 1 82962 1.20537E-5 41481 0 3.18593E-5
8-39679151-C-T p.Gly100Ser missense ADAM2 1 82942 1.20566E-5 41471 0 NA
8-39679153-T-C p.Glu99Gly missense ADAM2 25 82940 3.01423E-4 41470 0 1.59236E-4
8-39679155-A-G p.Ile98Ile synonymous ADAM2 106 82930 0.00127819 41465 0 0.0026113
8-39679158-A-AT p.Tyr97fs frameshift ADAM2 1 82912 1.2061E-5 41456 0 NA
8-39679161-C-A p.Gly96Gly synonymous ADAM2 1 82898 1.2063E-5 41449 0 3.99402E-6
8-39682332-A-T c.267+6T>A splice_region ADAM2 1 81810 1.22234E-5 40905 0 NA
8-39682332-A-G c.267+6T>C splice_region ADAM2 1 81808 1.22237E-5 40904 0 0.001875
8-39682333-C-T c.267+5G>A splice_region ADAM2 4 81862 4.88627E-5 40931 0 3.18613E-5
8-39682340-G-A p.Gln89* stop_gained ADAM2 2 82014 2.43861E-5 41007 0 3.18634E-5
8-39682351-T-G p.Asp85Ala missense ADAM2 1 82180 1.21684E-5 41090 0 NA
8-39682359-T-A p.Lys82Asn missense ADAM2 10 82302 1.21504E-4 41151 0 7.52735E-5
8-39682363-A-T p.Met81Lys missense ADAM2 2 82284 2.43061E-5 41142 0 8.35492E-6
8-39682365-A-G p.Ile80Ile synonymous ADAM2 1 82288 1.21524E-5 41144 0 NA
8-39682401-A-G p.His68His synonymous ADAM2 2 81998 2.43908E-5 40999 1 NA
8-39691461-AC-A c.188+1delG splice_donor ADAM2 1 81446 1.22781E-5 40723 0 4.07385E-6
8-39691469-A-C p.Met61Arg missense ADAM2 7 81662 8.57192E-5 40831 1 2.02592E-5
8-39691469-A-T p.Met61Lys missense ADAM2 2 81662 2.44912E-5 40831 0 NA
8-39691479-C-T p.Val58Met missense ADAM2 1 81786 1.2227E-5 40893 0 NA
8-39691496-T-C p.Glu52Gly missense ADAM2 1 81782 1.22276E-5 40891 0 NA
8-39691500-T-G p.Ile51Leu missense ADAM2 2 81816 2.44451E-5 40908 0 0.0025
8-39691522-G-T c.133-4C>A splice_region ADAM2 2 81588 2.45134E-5 40794 0 NA
8-39694653-A-G c.132+2T>C splice_donor ADAM2 1 83010 1.20467E-5 41505 0 8.24171E-6
8-39694658-C-T p.Ser43Ser synonymous ADAM2 2 83030 2.40877E-5 41515 0 4.98372E-5
8-39694658-C-A p.Ser43Ser synonymous ADAM2 1 83030 1.20438E-5 41515 0 4.11052E-6
8-39694659-G-A p.Ser43Leu missense ADAM2 3 83042 3.61263E-5 41521 0 1.6603E-4
8-39694674-T-A p.Lys38Met missense ADAM2 2 83172 2.40466E-5 41586 0 2.42E-5
8-39694686-C-T p.Arg34Gln missense ADAM2 2 83214 2.40344E-5 41607 0 1.65486E-4
8-39694687-G-A p.Arg34Trp missense ADAM2 84 83210 0.00100949 41605 1 0.00181714
8-39694697-C-T p.Pro30Pro synonymous ADAM2 1 83232 1.20146E-5 41616 0 5.04541E-4
8-39694698-G-A p.Pro30Leu missense ADAM2 1 83230 1.20149E-5 41615 0 8.27636E-6
8-39694722-C-T p.Ser22Asn missense ADAM2 6 83172 7.21397E-5 41586 0 6.37714E-5
8-39694727-A-G p.Phe20Phe synonymous ADAM2 1 83174 1.2023E-5 41587 0 8.33764E-6
8-39694732-CTGCAAAATG-C c.56-10_56-2delCATTTTGCA splice_acceptor ADAM2 16 83146 1.92433E-4 41573 0 2.00284E-4
8-39694737-AAATGTGCAAAATGTTTTATTAGAAC-A c.56-31_56-7delGTTCTAATAAAACATTTTGCACATT splice_region ADAM2 21 83104 2.52695E-4 41552 0 8.80459E-4
8-39695658-A-T p.Met16Lys missense ADAM2 2 83128 2.40593E-5 41564 0 1.65025E-5
8-39695661-C-G p.Arg15Pro missense ADAM2 1 83100 1.20337E-5 41550 0 NA
8-39695662-G-A p.Arg15Trp missense ADAM2 7 83076 8.42602E-5 41538 0 2.31084E-4
8-39695663-C-T p.Leu14Leu synonymous ADAM2 1 83114 1.20317E-5 41557 0 3.97848E-6
8-39695669-G-T p.Gly12Gly synonymous ADAM2 38 83180 4.56841E-4 41590 0 5.04032E-4
8-39695671-C-T p.Gly12Ser missense ADAM2 65 83188 7.81363E-4 41594 1 0.00168822
8-39695672-G-A p.Leu11Leu synonymous ADAM2 1 83202 1.20189E-5 41601 0 NA
8-39695677-C-A p.Gly10Trp missense ADAM2 964 83192 0.0115877 41596 24 0.0266868
8-39695687-A-C p.Phe6Leu missense ADAM2 27 83226 3.24418E-4 41613 0 7.79529E-4
8-39695697-C-T p.Arg3His missense ADAM2 5 83194 6.01005E-5 41597 0 1.65019E-5
8-39695698-G-C p.Arg3Gly missense ADAM2 1 83200 1.20192E-5 41600 0 3.30044E-5
8-39695698-G-A p.Arg3Cys missense ADAM2 1 83200 1.20192E-5 41600 0 1.98883E-5
8-39695699-C-T p.Trp2* stop_gained ADAM2 1 83212 1.20175E-5 41606 0 1.19328E-5
8-39695711-A-C c.-7T>G 5_prime_UTR_premature_start_codon_gain ADAM2 1 83148 1.20267E-5 41574 0 NA
8-39695729-G-A c.-25C>T 5_prime_UTR_premature_start_codon_gain ADAM2 9 82944 1.08507E-4 41472 0 9.5584E-5
8-39695754-G-A c.-50C>T 5_prime_UTR_premature_start_codon_gain ADAM2 1 82506 1.21203E-5 41253 0 NA
8-39695770-G-A c.-66C>T 5_prime_UTR_premature_start_codon_gain ADAM2 1 81864 1.22154E-5 40932 0 3.18735E-5
8-39695788-C-T c.-84G>A 5_prime_UTR_premature_start_codon_gain ADAM2 1 80406 1.24369E-5 40203 0 6.37796E-5
8-39695792-G-A c.-88C>T 5_prime_UTR_premature_start_codon_gain ADAM2 1 79990 1.25016E-5 39995 0 NA