Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
5-156822544-G-C c.*1939C>G splice_region ADAM19 1 77924 1.2833E-5 38962 0 NA
5-156822574-T-A p.Ter639Tyrext*? stop_lost ADAM19 38 78298 4.85325E-4 39149 0 5.87328E-4
5-156822576-A-G p.Ter639Glnext*? stop_lost ADAM19 2 78314 2.55382E-5 39157 0 NA
5-156822607-CTTGG-C p.Thr627fs frameshift ADAM19 3 78352 3.82887E-5 39176 0 NA
5-156822608-T-G p.Lys628Thr missense ADAM19 8 78352 1.02103E-4 39176 0 8.77899E-5
5-156822608-T-TCTTAATACAAATA p.Lys628fs frameshift ADAM19 4 78338 5.10608E-5 39169 0 7.31582E-6
5-156822610-G-A p.Thr627Thr synonymous ADAM19 9 78338 1.14887E-4 39169 0 8.15661E-5
5-156822611-G-A p.Thr627Ile missense ADAM19 3 78332 3.82985E-5 39166 0 NA
5-156822616-G-A p.Ile625Ile synonymous ADAM19 3 78332 3.82985E-5 39166 0 7.31989E-6
5-156822618-T-C p.Ile625Val missense ADAM19 3 78340 3.82946E-5 39170 0 6.36821E-5
5-156822619-T-A p.Gly624Gly synonymous ADAM19 1 78346 1.27639E-5 39173 0 NA
5-156822628-T-C p.Ile621Met missense ADAM19 2 78324 2.5535E-5 39162 0 NA
5-156822654-A-G p.Phe613Leu missense ADAM19 941 78228 0.0120289 39114 12 0.0111437
5-156822655-G-A p.Ala612Ala synonymous ADAM19 2 78260 2.55558E-5 39130 0 NA
5-156822656-G-A p.Ala612Val missense ADAM19 2 78258 2.55565E-5 39129 0 NA
5-156822665-A-T p.Phe609Tyr missense ADAM19 4 78212 5.1143E-5 39106 0 4.45018E-5
5-156822680-C-T p.Cys604Tyr missense ADAM19 1 78076 1.2808E-5 39038 0 1.50611E-5
5-156822683-A-G p.Val603Ala missense ADAM19 1 78040 1.28139E-5 39020 0 3.1841E-5
5-156904690-T-C p.Ter489Ter stop_retained ADAM19 38 79546 4.77711E-4 39773 0 0.00162776
5-156904711-C-T p.Gly482Gly synonymous ADAM19 1 79534 1.25732E-5 39767 0 7.29831E-6
5-156904715-G-GT p.Thr481fs frameshift ADAM19 1 79536 1.25729E-5 39768 0 NA
5-156904717-T-C p.Lys480Lys synonymous ADAM19 2 79536 2.51458E-5 39768 0 NA
5-156904719-T-C p.Lys480Glu missense ADAM19 1 79530 1.25739E-5 39765 0 NA
5-156904740-C-A p.Val473Leu missense ADAM19 2 79512 2.51534E-5 39756 0 NA
5-156904742-C-G p.Arg472Thr missense+splice_region ADAM19 1 79514 1.25764E-5 39757 0 NA
5-156907960-G-C p.Ile918Met missense ADAM19 1 83258 1.20109E-5 41629 0 NA
5-156907967-G-A p.Ser916Leu missense ADAM19 1 83268 1.20094E-5 41634 0 3.18776E-5
5-156907973-A-G p.Ile914Thr missense ADAM19 1 83264 1.201E-5 41632 0 8.24307E-6
5-156907976-A-G p.Met913Thr missense ADAM19 4 83270 4.80365E-5 41635 0 1.27453E-4
5-156907984-A-T p.Ala910Ala synonymous ADAM19 2 83262 2.40206E-5 41631 0 8.24429E-6
5-156908003-T-A p.Glu904Val missense ADAM19 1 83156 1.20256E-5 41578 0 2.38605E-5
5-156908008-A-C p.Phe902Leu missense+splice_region ADAM19 1 83140 1.20279E-5 41570 0 1.19308E-5
5-156908639-C-T p.Ala955Thr missense ADAM19 1 79564 1.25685E-5 39782 0 6.25E-4
5-156908640-G-A p.Pro954Pro synonymous ADAM19 1 79586 1.2565E-5 39793 0 2.65604E-5
5-156908653-C-T p.Cys950Tyr missense ADAM19 4291 79894 0.0537087 39947 111 0.0504426
5-156908655-T-C p.Ser949Ser synonymous ADAM19 13 80148 1.622E-4 40074 0 6.57626E-5
5-156908664-T-C p.Ala946Ala synonymous ADAM19 1 80308 1.24521E-5 40154 0 5.26427E-5
5-156908666-C-T p.Ala946Thr missense ADAM19 4 80340 4.97884E-5 40170 0 0.00125
5-156908670-T-C p.Pro944Pro synonymous ADAM19 1 80402 1.24375E-5 40201 0 3.1835E-5
5-156908680-T-C p.Glu941Gly missense ADAM19 3 80458 3.72865E-5 40229 0 NA
5-156908692-G-C p.Thr937Ser missense ADAM19 1 80544 1.24156E-5 40272 0 6.53663E-6
5-156908698-A-T p.Val935Asp missense ADAM19 11 80528 1.36598E-4 40264 0 6.25E-4
5-156908701-A-G p.Val934Ala missense ADAM19 3 80546 3.72458E-5 40273 0 4.9682E-5
5-156908706-A-G p.Leu932Leu synonymous ADAM19 37 80580 4.59171E-4 40290 0 5.93765E-4
5-156908710-A-G p.Met931Thr missense ADAM19 1 80670 1.23962E-5 40335 0 NA
5-156908718-C-T p.Lys928Lys synonymous ADAM19 1 80740 1.23854E-5 40370 0 3.1837E-5
5-156908721-T-C p.Thr927Thr synonymous ADAM19 1 80788 1.23781E-5 40394 0 1.30273E-5
5-156908732-C-T p.Val924Ile missense ADAM19 14 80870 1.73117E-4 40435 0 1.96098E-4
5-156908734-C-A p.Arg923Ile missense ADAM19 1 80900 1.23609E-5 40450 0 6.49452E-6
5-156908737-C-T p.Cys922Tyr missense ADAM19 8 80936 9.88435E-5 40468 0 6.48458E-6
5-156908742-G-A p.Gly920Gly synonymous ADAM19 1 80946 1.23539E-5 40473 0 NA
5-156908747-C-G p.Gly919Arg missense ADAM19 2 80946 2.47078E-5 40473 0 NA
5-156908755-C-T p.Gly916Glu missense ADAM19 2 80912 2.47182E-5 40456 0 3.81534E-5
5-156908757-T-A p.Arg915Ser missense ADAM19 1 80922 1.23576E-5 40461 0 1.26478E-5
5-156908764-C-T p.Gly913Asp missense ADAM19 1 80972 1.23499E-5 40486 0 NA
5-156908783-C-T p.Ala907Thr missense ADAM19 3 80992 3.70407E-5 40496 0 NA
5-156908786-C-T p.Glu906Lys missense ADAM19 3 81012 3.70316E-5 40506 0 1.15923E-5
5-156908788-C-T p.Arg905Gln missense ADAM19 1 81010 1.23442E-5 40505 0 NA
5-156908798-C-A c.2703+1G>T splice_donor ADAM19 1 81098 1.23308E-5 40549 0 NA
5-156908807-C-A p.Ala899Ser missense ADAM19 1 81060 1.23365E-5 40530 0 NA
5-156908816-C-T p.Ala896Thr missense ADAM19 1 81176 1.23189E-5 40588 0 6.25782E-4
5-156908823-C-T p.Arg893Arg synonymous ADAM19 1 81302 1.22998E-5 40651 0 5.23752E-6
5-156908824-C-T p.Arg893Gln missense ADAM19 6 81316 7.37862E-5 40658 0 0.00304569
5-156908825-G-A p.Arg893Trp missense ADAM19 24 81350 2.95022E-4 40675 0 0.00152284
5-156908827-G-A p.Ser892Phe missense ADAM19 2 81430 2.4561E-5 40715 0 NA
5-156908843-C-T p.Ala887Thr missense ADAM19 2 81412 2.45664E-5 40706 0 NA
5-156908853-C-T p.Arg883Arg synonymous ADAM19 3 81438 3.68378E-5 40719 0 3.18451E-5
5-156908855-G-A p.Arg883Trp missense ADAM19 17 81472 2.08661E-4 40736 0 0.00303644
5-156908862-G-T p.Ser880Ser synonymous ADAM19 1 81504 1.22693E-5 40752 0 NA
5-156908867-C-T p.Ala879Thr missense ADAM19 1 81462 1.22757E-5 40731 0 NA
5-156908876-G-T p.Pro876Thr missense ADAM19 1 81542 1.22636E-5 40771 0 NA
5-156908877-C-A p.Arg875Ser missense ADAM19 2 81546 2.4526E-5 40773 0 6.26566E-4
5-156908894-G-A p.Arg870Cys missense ADAM19 3 81606 3.6762E-5 40803 0 6.36943E-5
5-156908904-T-C p.Pro866Pro synonymous ADAM19 3 81630 3.67512E-5 40815 0 2.16559E-5
5-156908913-C-T p.Pro863Pro synonymous ADAM19 1 81652 1.22471E-5 40826 0 6.36902E-5
5-156908931-C-A p.Pro857Pro synonymous ADAM19 1 81552 1.22621E-5 40776 0 NA
5-156908932-G-A p.Pro857Leu missense ADAM19 10 81538 1.22642E-4 40769 0 5.73175E-4
5-156908935-C-T p.Arg856Gln missense ADAM19 3 81512 3.68044E-5 40756 0 5.05561E-4
5-156908942-T-C p.Arg854Gly missense ADAM19 1 81508 1.22687E-5 40754 0 5.05051E-4
5-156908954-G-A c.2551-3C>T splice_region ADAM19 2 81486 2.45441E-5 40743 0 3.18512E-5
5-156908954-G-C c.2551-3C>G splice_region ADAM19 1 81486 1.2272E-5 40743 0 NA
5-156908955-G-T c.2551-4C>A splice_region ADAM19 1 81474 1.22739E-5 40737 0 NA
5-156915266-C-T c.2550+7G>A splice_region ADAM19 4 81942 4.8815E-5 40971 0 1.59226E-4
5-156915270-T-TA c.2550+2_2550+3insT splice_donor ADAM19 1 81986 1.21972E-5 40993 0 4.00808E-6
5-156915277-G-A p.Ser849Phe missense ADAM19 1 82096 1.21809E-5 41048 0 NA
5-156915281-C-T p.Val848Ile missense ADAM19 78 82294 9.47821E-4 41147 0 5.7948E-4
5-156915282-G-A p.Ile847Ile synonymous ADAM19 2 82342 2.42889E-5 41171 0 1.07548E-4
5-156915296-C-T p.Ala843Thr missense ADAM19 4 82684 4.8377E-5 41342 0 0.00100705
5-156915297-G-A p.Pro842Pro synonymous ADAM19 886 82762 0.0107054 41381 24 0.0200446
5-156915310-C-T p.Arg838Gln missense ADAM19 1 82976 1.20517E-5 41488 0 NA
5-156915311-G-A p.Arg838Trp missense ADAM19 21 83026 2.52933E-4 41513 0 2.72358E-4
5-156915323-G-C p.Pro834Ala missense ADAM19 431 83108 0.00518602 41554 2 0.00503525
5-156915323-G-A p.Pro834Ser missense ADAM19 2 83112 2.40639E-5 41556 0 1.59324E-5
5-156915333-C-A p.Ser830Ser synonymous ADAM19 2 83174 2.4046E-5 41587 0 3.98162E-6
5-156915333-C-T p.Ser830Ser synonymous ADAM19 1 83174 1.2023E-5 41587 0 3.18573E-5
5-156915339-C-T p.Thr828Thr synonymous ADAM19 1 83234 1.20143E-5 41617 0 4.37877E-5
5-156915340-G-A p.Thr828Met missense ADAM19 5 83234 6.00716E-5 41617 0 1.57144E-4
5-156915342-CCT-C p.Arg827fs frameshift ADAM19 1 83248 1.20123E-5 41624 0 NA
5-156915354-A-T p.Ser823Ser synonymous ADAM19 1 83238 1.20137E-5 41619 0 1.19448E-5
5-156915357-C-T p.Gly822Gly synonymous ADAM19 2 83232 2.40292E-5 41616 0 7.96578E-5
5-156915358-C-T p.Gly822Glu missense ADAM19 1 83232 1.20146E-5 41616 0 NA
5-156915359-C-T p.Gly822Arg missense ADAM19 1 83224 1.20158E-5 41612 0 6.77269E-5
5-156915360-G-A p.Pro821Pro synonymous ADAM19 11 83222 1.32177E-4 41611 0 0.00352467
5-156915362-G-A p.Pro821Ser missense ADAM19 2 83222 2.40321E-5 41611 0 3.98419E-6
5-156915365-C-A p.Gly820Trp missense ADAM19 1 83224 1.20158E-5 41612 0 NA
5-156915376-C-T p.Arg816Lys missense ADAM19 3 83188 3.60629E-5 41594 0 NA
5-156915389-T-G p.Ser812Arg missense ADAM19 2 83088 2.40709E-5 41544 0 NA
5-156915399-T-C p.Pro808Pro synonymous ADAM19 14 83054 1.68565E-4 41527 0 5.41505E-4
5-156915400-G-C p.Pro808Arg missense ADAM19 3 83036 3.61289E-5 41518 0 NA
5-156915410-C-T p.Ala805Thr missense ADAM19 658 82948 0.00793268 41474 10 0.0185763
5-156915413-G-A p.Pro804Ser missense ADAM19 1 82942 1.20566E-5 41471 0 8.35757E-6
5-156915415-G-A p.Pro803Leu missense ADAM19 2 82932 2.41161E-5 41466 0 NA
5-156915417-G-T p.Ser802Ser synonymous ADAM19 1 82906 1.20619E-5 41453 0 3.34717E-5
5-156915418-G-C p.Ser802Cys missense ADAM19 1 82858 1.20688E-5 41429 0 1.6765E-5
5-156915425-C-G p.Gly800Arg missense ADAM19 3 82740 3.62582E-5 41370 0 NA
5-156915427-C-T p.Arg799His missense ADAM19 13 82686 1.57221E-4 41343 0 2.1866E-4
5-156915428-G-A p.Arg799Cys missense ADAM19 1 82648 1.20995E-5 41324 0 3.18552E-5
5-156915440-G-C p.Pro795Ala missense ADAM19 1 82152 1.21726E-5 41076 0 1.69612E-5
5-156915443-G-A p.Pro794Ser missense ADAM19 1 81992 1.21963E-5 40996 0 NA
5-156915445-G-C p.Pro793Arg missense ADAM19 1 81840 1.2219E-5 40920 0 NA
5-156915448-C-T p.Arg792Gln missense ADAM19 1 81484 1.22723E-5 40742 0 3.18837E-5
5-156915449-G-T p.Arg792Arg synonymous ADAM19 1 81534 1.22648E-5 40767 0 0.00100908
5-156915461-G-T p.Gln788Lys missense ADAM19 1 81202 1.2315E-5 40601 0 NA
5-156915472-C-T p.Arg784Gln missense ADAM19 1 80642 1.24005E-5 40321 0 2.06419E-5
5-156915473-G-A p.Arg784Trp missense ADAM19 1 80516 1.24199E-5 40258 0 8.77362E-5
5-156915479-T-C p.Ile782Val missense ADAM19 1 80248 1.24614E-5 40124 0 8.85316E-6
5-156915479-T-G p.Ile782Leu missense ADAM19 1 80248 1.24614E-5 40124 0 3.54126E-5
5-156915483-C-T p.Pro780Pro synonymous ADAM19 4 80004 4.99975E-5 40002 0 4.60336E-5
5-156915483-C-A p.Pro780Pro synonymous ADAM19 3 80002 3.74991E-5 40001 0 8.90662E-6
5-156915484-G-A p.Pro780Leu missense ADAM19 5 79876 6.2597E-5 39938 0 1.25681E-5
5-156915487-G-A p.Thr779Ile missense ADAM19 4 79704 5.01857E-5 39852 0 7.15428E-5
5-156915498-C-T c.2326-1G>A splice_acceptor ADAM19 3 78810 3.80662E-5 39405 0 6.37471E-5
5-156915503-C-T c.2326-6G>A splice_region ADAM19 2 78300 2.55428E-5 39150 0 4.53638E-6
5-156915505-C-T c.2326-8G>A splice_region ADAM19 1 78128 1.27995E-5 39064 0 NA
5-156916104-T-C c.2325+6A>G splice_region ADAM19 29 83290 3.48181E-4 41645 0 8.27973E-4
5-156916109-CCTT-C p.Lys775del conservative_inframe_deletion ADAM19 2 83328 2.40015E-5 41664 0 2.51277E-5
5-156916115-G-A p.Arg774* stop_gained ADAM19 1 83344 1.19985E-5 41672 0 3.97861E-6
5-156916129-G-A p.Thr769Met missense ADAM19 7 83374 8.3959E-5 41687 1 8.35316E-5
5-156916152-G-A p.Ala761Ala synonymous ADAM19 2 83376 2.39877E-5 41688 0 NA
5-156916154-C-T p.Ala761Thr missense ADAM19 1 83374 1.19941E-5 41687 0 NA
5-156916166-C-T p.Gly757Arg missense ADAM19 1 83370 1.19947E-5 41685 0 3.58024E-5
5-156916167-G-C p.Ser756Arg missense ADAM19 1 83364 1.19956E-5 41682 0 NA
5-156916167-G-A p.Ser756Ser synonymous ADAM19 7 83364 8.39691E-5 41682 0 7.4955E-5
5-156916182-C-T p.Arg751Arg synonymous ADAM19 5 83330 6.00024E-5 41665 0 6.25E-4
5-156916192-C-A p.Cys748Phe missense+splice_region ADAM19 10 83284 1.20071E-4 41642 0 5.14951E-5
5-156916196-T-A c.2241-2A>T splice_acceptor ADAM19 2 83258 2.40217E-5 41629 0 8.60378E-6
5-156916198-G-A c.2241-4C>T splice_region ADAM19 1 83238 1.20137E-5 41619 0 NA
5-156916202-C-T c.2241-8G>A splice_region ADAM19 6 83164 7.21466E-5 41582 0 1.11688E-4
5-156916202-C-A c.2241-8G>T splice_region ADAM19 1 83164 1.20244E-5 41582 0 8.71202E-6
5-156916202-C-G c.2241-8G>C splice_region ADAM19 1 83164 1.20244E-5 41582 0 NA
5-156917340-A-C p.Ser740Ala missense ADAM19 15312 83234 0.183963 41617 1456 0.221047
5-156917353-G-A p.Pro735Pro synonymous ADAM19 1 83410 1.1989E-5 41705 0 1.59055E-5
5-156917356-C-T p.Lys734Lys synonymous ADAM19 47 83410 5.63482E-4 41705 0 4.44774E-4
5-156917372-T-TGA p.Lys729fs frameshift ADAM19 1 83412 1.19887E-5 41706 0 NA
5-156917374-G-C p.Asn728Lys missense ADAM19 1 83412 1.19887E-5 41706 0 NA
5-156917387-C-T p.Cys724Tyr missense ADAM19 3 83384 3.59781E-5 41692 0 6.37227E-5
5-156917393-T-C p.Tyr722Cys missense ADAM19 1 83386 1.19924E-5 41693 0 NA
5-156917406-T-C p.Met718Val missense ADAM19 1 83372 1.19944E-5 41686 0 NA
5-156917409-G-A p.Leu717Phe missense ADAM19 2 83368 2.399E-5 41684 0 4.11855E-5
5-156917412-C-T p.Val716Ile missense ADAM19 4 83368 4.798E-5 41684 0 NA
5-156917413-C-T p.Ala715Ala synonymous ADAM19 1 83366 1.19953E-5 41683 0 1.64747E-5
5-156917451-C-G p.Val703Leu missense ADAM19 1 83348 1.19979E-5 41674 0 NA
5-156917460-C-T p.Val700Met missense+splice_region ADAM19 1 83310 1.20034E-5 41655 0 3.1837E-5
5-156917462-C-A p.Ser699Ile missense+splice_region ADAM19 1 83286 1.20068E-5 41643 0 NA
5-156917465-TC-T c.2096-4delG splice_region ADAM19 5 83264 6.005E-5 41632 0 9.55657E-5
5-156918631-G-A p.Pro696Leu missense ADAM19 1 81336 1.22947E-5 40668 0 NA
5-156918631-G-C p.Pro696Arg missense ADAM19 2 81336 2.45894E-5 40668 0 6.12783E-6
5-156918632-G-T p.Pro696Thr missense ADAM19 1 81378 1.22883E-5 40689 0 NA
5-156918635-T-G p.Met695Leu missense ADAM19 1 81536 1.22645E-5 40768 0 2.65224E-5
5-156918638-G-A p.Pro694Ser missense ADAM19 199 81568 0.00243968 40784 0 0.0069986
5-156918650-T-C p.Ile690Val missense ADAM19 2 82126 2.43528E-5 41063 0 NA
5-156918660-G-A p.His686His synonymous ADAM19 3 82286 3.64582E-5 41143 0 1.16496E-4
5-156918666-C-G p.Pro684Pro synonymous ADAM19 2 82446 2.42583E-5 41223 0 9.51004E-6
5-156918674-T-G p.Asn682His missense ADAM19 1 82564 1.21118E-5 41282 0 NA
5-156918685-G-A p.Pro678Leu missense ADAM19 2 82618 2.42078E-5 41309 0 5.05561E-4
5-156918694-C-T p.Gly675Asp missense ADAM19 3 82524 3.63531E-5 41262 0 3.23401E-5
5-156918696-C-T p.Pro674Pro synonymous ADAM19 7 82552 8.4795E-5 41276 0 1.28414E-4
5-156918697-G-A p.Pro674Leu missense ADAM19 52 82472 6.30517E-4 41236 0 7.82926E-4
5-156918702-G-A p.Cys672Cys synonymous ADAM19 3 82538 3.63469E-5 41269 0 4.42075E-6
5-156918705-G-T p.His671Gln missense ADAM19 1 82546 1.21145E-5 41273 0 NA
5-156918729-GACCTGGAGCAAAGAAAGGGCAGAGGCATCAGCACCCCAGAGAGCATCAGCCACCCACAGGGCCTGCCCTCATGACGTCCCCATGACACAGAGAAGCCAGAACCCAGCACGC-G p.Val663fs frameshift ADAM19 1 82640 1.21007E-5 41320 0 NA
5-156918737-G-A c.1987-6C>T splice_region ADAM19 2 82664 2.41943E-5 41332 0 NA
5-156918839-G-A c.1986+4C>T splice_region ADAM19 2 83298 2.40102E-5 41649 0 5.77434E-5
5-156918840-C-T c.1986+3G>A splice_region ADAM19 12 83296 1.44065E-4 41648 0 8.15317E-4
5-156918846-A-G p.His661His synonymous ADAM19 2 83328 2.40015E-5 41664 0 1.64921E-5
5-156918850-C-T p.Gly660Asp missense ADAM19 8908 83206 0.10706 41603 535 0.132931
5-156918862-T-A p.Lys656Met missense ADAM19 2 83348 2.39958E-5 41674 0 NA
5-156918867-A-G p.Cys654Cys synonymous ADAM19 1 83346 1.19982E-5 41673 0 3.18492E-5
5-156918871-C-G p.Gly653Ala missense ADAM19 1 83346 1.19982E-5 41673 0 3.18431E-5
5-156918885-G-A p.Phe648Phe synonymous ADAM19 17 83350 2.03959E-4 41675 0 1.91058E-4
5-156918891-G-T p.Thr646Thr synonymous ADAM19 1 83344 1.19985E-5 41672 0 NA
5-156918911-C-A p.Glu640* stop_gained ADAM19 1 83336 1.19996E-5 41668 0 NA
5-156918927-G-A c.1909-7C>T splice_region ADAM19 1 83248 1.20123E-5 41624 0 6.25E-4
5-156919977-T-A c.1908+4A>T splice_region ADAM19 2 83210 2.40356E-5 41605 0 NA
5-156919985-T-C p.Asn635Ser missense ADAM19 1 83274 1.20085E-5 41637 0 NA
5-156919999-G-A p.Thr630Thr synonymous ADAM19 4 83314 4.80111E-5 41657 0 3.977E-6
5-156920038-C-T p.Glu617Glu synonymous ADAM19 1 83322 1.20016E-5 41661 0 3.29489E-5
5-156920047-A-G p.Pro614Pro synonymous ADAM19 2 83322 2.40033E-5 41661 0 6.37308E-5
5-156920052-C-T p.Gly613Ser missense ADAM19 1 83314 1.20028E-5 41657 0 NA
5-156920055-G-A p.Arg612* stop_gained ADAM19 3 83306 3.60118E-5 41653 0 3.18573E-5
5-156920056-G-A p.Tyr611Tyr synonymous ADAM19 3 83310 3.60101E-5 41655 0 7.9526E-6
5-156920061-C-T p.Val610Ile missense ADAM19 1 83304 1.20042E-5 41652 0 2.47117E-5
5-156920073-G-A p.Arg606Trp missense ADAM19 2 83310 2.40067E-5 41655 0 1.64747E-5
5-156920122-C-T p.Ala589Ala synonymous ADAM19 1 83306 1.20039E-5 41653 0 3.29576E-5
5-156920123-G-A p.Ala589Val missense ADAM19 1 83308 1.20036E-5 41654 0 2.4719E-5
5-156920125-G-A p.Asn588Asn synonymous ADAM19 1 83298 1.20051E-5 41649 0 3.29609E-5
5-156920126-T-G p.Asn588Thr missense ADAM19 1 83300 1.20048E-5 41650 0 3.18532E-5
5-156920136-G-A p.Leu585Leu synonymous ADAM19 2 83302 2.4009E-5 41651 0 3.29712E-5
5-156920141-C-T p.Arg583Gln missense ADAM19 1 83296 1.20054E-5 41648 0 3.18634E-5
5-156920157-G-C p.Gln578Glu missense ADAM19 1 83250 1.2012E-5 41625 0 NA
5-156920174-C-T p.Cys572Tyr missense ADAM19 1 83132 1.20291E-5 41566 0 3.98073E-6
5-156920179-C-T p.Ala570Ala synonymous ADAM19 10 83066 1.20386E-4 41533 0 5.03525E-4
5-156920180-G-A p.Ala570Val missense ADAM19 1 83052 1.20406E-5 41526 0 3.18532E-5
5-156920180-G-C p.Ala570Gly missense ADAM19 1 83052 1.20406E-5 41526 0 1.65818E-5
5-156920189-G-A c.1704-4C>T splice_region ADAM19 1 82926 1.20589E-5 41463 0 3.98632E-6
5-156920190-G-A c.1704-5C>T splice_region ADAM19 7 82894 8.44452E-5 41447 0 6.36862E-5
5-156921698-A-C p.Met567Arg missense ADAM19 4 83328 4.80031E-5 41664 0 9.55657E-5
5-156921706-C-T p.Lys564Lys synonymous ADAM19 3 83370 3.59842E-5 41685 0 1.27405E-4
5-156921719-C-T p.Gly560Asp missense ADAM19 1 83390 1.19918E-5 41695 0 NA
5-156921729-C-T p.Asp557Asn missense ADAM19 1 83396 1.1991E-5 41698 0 NA
5-156921748-G-A p.Thr550Thr synonymous ADAM19 2 83410 2.39779E-5 41705 0 3.97665E-6
5-156921760-C-A p.Val546Val synonymous ADAM19 5 83398 5.99535E-5 41699 0 7.15791E-5
5-156921770-T-A p.Lys543Met missense ADAM19 1 83390 1.19918E-5 41695 0 3.97681E-6
5-156921775-G-A p.Phe541Phe synonymous ADAM19 1 83378 1.19936E-5 41689 0 3.97687E-6
5-156921797-C-T p.Arg534Gln missense ADAM19 1 83344 1.19985E-5 41672 0 3.18695E-5
5-156921803-C-CCGGGTCCCCACAG c.1595-1_1595insCTGTGGGGACCCG splice_acceptor ADAM19 1 83322 1.20016E-5 41661 0 NA
5-156921808-G-A c.1595-5C>T splice_region ADAM19 1 83292 1.2006E-5 41646 0 3.98007E-6
5-156923902-C-T p.Gly532Arg missense+splice_region ADAM19 2 81294 2.46021E-5 40647 0 5.5057E-5
5-156923902-C-A p.Gly532* stop_gained ADAM19 1 81294 1.2301E-5 40647 0 NA
5-156923915-C-T p.Gln527Gln synonymous ADAM19 1 81588 1.22567E-5 40794 0 NA
5-156923933-G-A p.Tyr521Tyr synonymous ADAM19 1 81902 1.22097E-5 40951 0 NA
5-156923942-G-A p.Cys518Cys synonymous ADAM19 1 82046 1.21883E-5 41023 0 4.40083E-6
5-156923951-G-A p.Asn515Asn synonymous ADAM19 3 82244 3.64768E-5 41122 0 2.60695E-4
5-156923967-T-C p.Gln510Arg missense ADAM19 2 82380 2.42777E-5 41190 0 NA
5-156923971-C-G p.Gly509Arg missense ADAM19 1 82404 1.21353E-5 41202 0 NA
5-156923971-C-T p.Gly509Ser missense ADAM19 2 82404 2.42707E-5 41202 0 6.17907E-5
5-156923972-G-A p.Gly508Gly synonymous ADAM19 18 82412 2.18415E-4 41206 1 2.024E-4
5-156923974-C-T p.Gly508Ser missense ADAM19 136 82418 0.00165013 41209 0 0.00140217
5-156923999-G-A p.Tyr499Tyr synonymous ADAM19 1 82540 1.21153E-5 41270 0 4.282E-6
5-156924007-T-C p.Asn497Asp missense ADAM19 2 82580 2.42189E-5 41290 0 8.85379E-6
5-156924020-G-A p.Pro492Pro synonymous ADAM19 2 82590 2.4216E-5 41295 0 NA
5-156924032-C-T p.Thr488Thr synonymous ADAM19 1 82566 1.21115E-5 41283 0 4.49802E-6
5-156924033-G-A p.Thr488Met missense ADAM19 2 82564 2.42236E-5 41282 0 2.71071E-5
5-156924045-G-A p.Pro484Leu missense ADAM19 1 82520 1.21183E-5 41260 0 3.46596E-5
5-156924053-A-G p.Cys481Cys synonymous ADAM19 3 82448 3.63866E-5 41224 0 3.18634E-5
5-156924056-C-T p.Gln480Gln synonymous ADAM19 1 82414 1.21339E-5 41207 0 NA
5-156924061-T-C p.Arg479Gly missense ADAM19 1 82364 1.21412E-5 41182 0 NA
5-156924071-G-A p.Arg475Arg synonymous ADAM19 2 82050 2.43754E-5 41025 0 0.00125
5-156924072-C-T p.Arg475His missense ADAM19 1 82028 1.2191E-5 41014 0 NA
5-156924081-G-T p.Thr472Asn missense ADAM19 1 81808 1.22237E-5 40904 0 9.00982E-6
5-156924092-C-T p.Leu468Leu synonymous ADAM19 2 81490 2.45429E-5 40745 0 6.37024E-5
5-156924093-A-G p.Leu468Ser missense ADAM19 1 81540 1.22639E-5 40770 0 NA
5-156926574-C-T c.1398+7G>A splice_region ADAM19 2 81558 2.45224E-5 40779 0 4.6292E-5
5-156926587-C-G p.Gln464His missense ADAM19 3 81652 3.67413E-5 40826 0 9.99037E-5
5-156926588-T-C p.Gln464Arg missense ADAM19 3 81642 3.67458E-5 40821 0 1.81383E-5
5-156926605-G-A p.His458His synonymous ADAM19 332 81778 0.00405977 40889 0 0.00847078
5-156926605-G-C p.His458Gln missense ADAM19 1 81784 1.22273E-5 40892 0 8.97989E-6
5-156926606-T-C p.His458Arg missense ADAM19 66 81780 8.07043E-4 40890 0 0.00198184
5-156926607-G-A p.His458Tyr missense ADAM19 1 81796 1.22255E-5 40898 0 8.98925E-6
5-156926617-C-T p.Ala454Ala synonymous ADAM19 2 81772 2.44582E-5 40886 0 1.59775E-4
5-156926618-G-A p.Ala454Val missense ADAM19 142 81754 0.00173692 40877 1 0.00604839
5-156926618-G-GC p.Ala454fs frameshift ADAM19 1 81754 1.22318E-5 40877 0 NA
5-156926619-C-T p.Ala454Thr missense ADAM19 1 81758 1.22312E-5 40879 0 NA
5-156926623-C-T p.Pro452Pro synonymous ADAM19 3 81760 3.66928E-5 40880 0 3.1953E-5
5-156926624-G-A p.Pro452Leu missense ADAM19 59 81722 7.2196E-4 40861 0 0.0010101
5-156926631-G-A p.Leu450Leu synonymous ADAM19 1 81724 1.22363E-5 40862 0 NA
5-156926643-A-T p.Ser446Thr missense ADAM19 2 81696 2.4481E-5 40848 0 9.98742E-6
5-156926667-A-C p.Cys438Gly missense ADAM19 1 81396 1.22856E-5 40698 0 8.46024E-5
5-156929816-C-T p.Glu435Lys missense ADAM19 857 83382 0.010278 41691 5 0.0128409
5-156929837-C-T p.Glu428Lys missense ADAM19 1 83406 1.19895E-5 41703 0 NA
5-156929851-T-C p.Tyr423Cys missense ADAM19 1 83408 1.19893E-5 41704 0 NA
5-156929854-C-A p.Gly422Val missense ADAM19 1 83414 1.19884E-5 41707 0 NA
5-156929855-C-T p.Gly422Arg missense ADAM19 1 83412 1.19887E-5 41706 0 8.23737E-6
5-156929868-C-A p.Arg417Arg synonymous ADAM19 1 83418 1.19878E-5 41709 0 NA
5-156929880-C-T p.Leu413Leu synonymous ADAM19 1 83422 1.19872E-5 41711 0 NA
5-156929883-C-G p.Met412Ile missense ADAM19 1 83420 1.19875E-5 41710 0 NA
5-156929890-G-A p.Thr410Ile missense ADAM19 1 83418 1.19878E-5 41709 0 NA
5-156929917-C-G p.Gly401Ala missense ADAM19 1 83402 1.19901E-5 41701 0 NA
5-156929928-C-G p.Gln397His missense ADAM19 3 83380 3.59799E-5 41690 0 NA
5-156929933-G-A p.Leu396Leu synonymous ADAM19 1 83382 1.1993E-5 41691 0 NA
5-156929939-T-C p.Arg394Gly missense ADAM19 1 83384 1.19927E-5 41692 0 NA
5-156929965-T-C p.Asn385Ser missense ADAM19 2 83340 2.39981E-5 41670 0 3.97928E-6
5-156929985-G-T p.His378Gln missense ADAM19 1 83248 1.20123E-5 41624 0 3.18552E-5
5-156929994-A-G c.1131-6T>C splice_region ADAM19 20 83196 2.40396E-4 41598 0 1.51419E-4
5-156932678-C-T p.Gly377Arg missense+splice_region ADAM19 1 82270 1.21551E-5 41135 0 4.2187E-5
5-156932685-A-C p.Ala374Ala synonymous ADAM19 1 82424 1.21324E-5 41212 0 4.00202E-6
5-156932692-A-G p.Met372Thr missense ADAM19 1 82564 1.21118E-5 41282 0 NA
5-156932712-C-T p.Ala365Ala synonymous ADAM19 3 82784 3.62389E-5 41392 0 2.50033E-5
5-156932713-G-T p.Ala365Glu missense ADAM19 1 82764 1.20825E-5 41382 0 NA
5-156932721-C-T p.Ser362Ser synonymous ADAM19 5 82830 6.03646E-5 41415 0 4.99176E-5
5-156932722-G-A p.Ser362Leu missense ADAM19 1 82824 1.20738E-5 41412 0 4.99276E-5
5-156932753-C-T p.Gly352Ser missense ADAM19 1 82904 1.20621E-5 41452 0 3.98178E-6
5-156932772-G-A p.His345His synonymous ADAM19 132 82874 0.00159278 41437 3 0.00226115
5-156932793-G-A p.Gly338Gly synonymous ADAM19 4 82914 4.82428E-5 41457 0 6.71209E-5
5-156932800-G-A p.Ala336Val missense ADAM19 4 82886 4.82591E-5 41443 0 4.3838E-5
5-156932808-G-A p.Ser333Ser synonymous ADAM19 4 82752 4.83372E-5 41376 0 3.18492E-5
5-156932813-G-A p.His332Tyr missense ADAM19 1 82656 1.20983E-5 41328 0 NA
5-156932820-C-T c.991-4G>A splice_region ADAM19 1 82502 1.21209E-5 41251 0 NA
5-156934068-T-C p.Asn329Ser missense ADAM19 2 81572 2.45182E-5 40786 0 3.18451E-5
5-156934108-G-C p.Leu316Val missense ADAM19 2 81744 2.44666E-5 40872 0 3.19007E-5
5-156934111-G-A p.Pro315Ser missense ADAM19 16 81714 1.95805E-4 40857 0 1.51495E-4
5-156934111-G-T p.Pro315Thr missense ADAM19 1 81714 1.22378E-5 40857 0 NA
5-156934121-G-A p.Ile311Ile synonymous ADAM19 8 81656 9.7972E-5 40828 0 4.78396E-5
5-156934132-C-T p.Gly308Ser missense ADAM19 4 81436 4.91183E-5 40718 0 6.37389E-5
5-156934133-G-A p.His307His synonymous ADAM19 2 81536 2.4529E-5 40768 0 5.03525E-4
5-156934144-T-C p.Met304Val missense ADAM19 2 81286 2.46045E-5 40643 0 8.2916E-6
5-156934150-T-C c.906-2A>G splice_acceptor ADAM19 1 81132 1.23256E-5 40566 0 NA
5-156934155-G-T c.906-7C>A splice_region ADAM19 417 80896 0.00515477 40448 4 0.0108661
5-156936317-T-C p.Gln299Gln synonymous ADAM19 4 83260 4.80423E-5 41630 0 3.18431E-5
5-156936322-C-T p.Ala298Thr missense ADAM19 1 83260 1.20106E-5 41630 0 3.18431E-5
5-156936330-T-C p.His295Arg missense ADAM19 2 83298 2.40102E-5 41649 0 NA
5-156936349-G-A p.Leu289Leu synonymous ADAM19 1 83338 1.19993E-5 41669 0 NA
5-156936355-G-A p.Arg287Cys missense ADAM19 1 83324 1.20013E-5 41662 0 7.98875E-6
5-156936356-C-T p.Arg286Arg synonymous ADAM19 3 83338 3.5998E-5 41669 0 7.46021E-5
5-156936358-T-G p.Arg286Arg synonymous ADAM19 2 83358 2.39929E-5 41679 0 NA
5-156936364-T-C p.Ser284Gly missense ADAM19 32306 83020 0.389135 41510 6619 0.430444
5-156936379-G-A p.Leu279Phe missense ADAM19 1 83360 1.19962E-5 41680 0 NA
5-156936393-T-G p.Asn274Thr missense ADAM19 2 83336 2.39992E-5 41668 0 8.64633E-6
5-156936398-T-A p.Ser272Ser synonymous ADAM19 5 83328 6.00038E-5 41664 0 5.03525E-4
5-156936416-C-T p.Glu270Lys missense ADAM19 3 83302 3.60135E-5 41651 0 7.9975E-6
5-156936418-C-T p.Gly266Arg missense ADAM19 5 83298 6.00254E-5 41649 0 0.00100806
5-156936420-T-C p.His265Arg missense ADAM19 4 83292 4.80238E-5 41646 0 5.04032E-4
5-156936430-C-A p.Val262Leu missense ADAM19 1 83276 1.20083E-5 41638 0 3.1835E-5
5-156936437-G-A p.Leu263Phe missense ADAM19 1 83260 1.20106E-5 41630 0 NA
5-156936437-G-C p.Leu263Val missense ADAM19 4 83260 4.80423E-5 41630 1 NA
5-156936442-C-T p.Val258Met missense ADAM19 2 83218 2.40333E-5 41609 0 NA
5-156936443-G-A p.Arg261Cys missense ADAM19 29 83214 3.48499E-4 41607 0 0.00122792
5-156936468-C-T p.Arg249Gln missense ADAM19 1 82712 1.20901E-5 41356 0 2.51427E-5
5-156936469-G-A p.Arg249* stop_gained ADAM19 2 82722 2.41774E-5 41361 0 2.55519E-5
5-156936483-G-A c.739-8C>T splice_region ADAM19 1 82526 1.21174E-5 41263 0 NA
5-156940433-T-G p.Pro249Pro splice_region+synonymous ADAM19 1 83030 1.20438E-5 41515 0 NA
5-156940439-C-T c.738+3G>A splice_region ADAM19 3 83116 3.60941E-5 41558 0 NA
5-156940453-A-G p.Tyr243His missense ADAM19 2 83300 2.40096E-5 41650 0 NA
5-156940455-T-C p.Asn242Ser missense ADAM19 2 83304 2.40085E-5 41652 0 8.23696E-6
5-156940458-G-A p.Ala241Val missense ADAM19 16 83324 1.92021E-4 41662 0 1.59076E-4
5-156940460-G-A c.-82C>T 5_prime_UTR_premature_start_codon_gain ADAM19 1 83342 1.19988E-5 41671 0 3.18634E-5
5-156940464-T-C p.Glu239Gly missense ADAM19 1 83372 1.19944E-5 41686 0 NA
5-156940479-T-C p.Lys234Arg missense ADAM19 1 83398 1.19907E-5 41699 0 2.38588E-5
5-156940487-G-A c.-109C>T 5_prime_UTR_premature_start_codon_gain ADAM19 9 83410 1.07901E-4 41705 0 6.25E-4
5-156940495-C-T p.Asp229Asn missense ADAM19 1 83416 1.19881E-5 41708 0 NA
5-156940497-C-A p.Arg228Leu missense ADAM19 1 83416 1.19881E-5 41708 0 NA
5-156940520-G-A c.667-7C>T splice_region ADAM19 17 83374 2.039E-4 41687 0 3.50408E-4
5-156945825-C-T c.666+6G>A splice_region ADAM19 2 83164 2.40489E-5 41582 0 8.23723E-6
5-156945826-C-G c.666+5G>C splice_region ADAM19 1 83164 1.20244E-5 41582 0 NA
5-156945827-T-G c.666+4A>C splice_region ADAM19 1 83174 1.2023E-5 41587 0 NA
5-156945828-TAC-T c.666+1_666+2delGT splice_donor ADAM19 1 83158 1.20253E-5 41579 0 NA
5-156945833-C-G p.Glu222Gln missense+splice_region ADAM19 10 83190 1.20207E-4 41595 0 4.4586E-4
5-156945843-A-G p.Ala218Ala synonymous ADAM19 1 83228 1.20152E-5 41614 0 NA
5-156945847-A-C p.Val217Gly missense ADAM19 2 83218 2.40333E-5 41609 0 NA
5-156945849-G-A c.-154C>T 5_prime_UTR_premature_start_codon_gain ADAM19 412 83174 0.00495347 41587 4 0.0060525
5-156945872-T-C p.Met209Val missense ADAM19 13 83132 1.56378E-4 41566 0 0.00100705
5-156945874-G-A p.Ser208Phe missense ADAM19 6 83134 7.21726E-5 41567 0 3.18269E-5
5-156945899-A-G c.601-3T>C splice_region ADAM19 5 82954 6.02744E-5 41477 0 2.14872E-4
5-156945900-A-G c.601-4T>C splice_region ADAM19 3 82958 3.61629E-5 41479 0 3.1841E-5
5-156946841-A-T c.600+6T>A splice_region ADAM19 3 82992 3.61481E-5 41496 0 NA
5-156946848-C-T p.Arg200Lys missense+splice_region ADAM19 1 83040 1.20424E-5 41520 0 3.18431E-5
5-156946851-C-T p.Arg199His missense ADAM19 16 83056 1.92641E-4 41528 0 3.17307E-4
5-156946851-C-A p.Arg199Leu missense ADAM19 1 83056 1.20401E-5 41528 0 8.0331E-6
5-156946852-G-A p.Arg199Cys missense ADAM19 7 83078 8.42582E-5 41539 0 1.50855E-4
5-156946858-G-T p.Arg197Arg synonymous ADAM19 1 83126 1.20299E-5 41563 0 NA
5-156946871-T-C p.Gln192Gln synonymous ADAM19 2 83212 2.4035E-5 41606 0 NA
5-156946875-G-A p.Thr191Ile missense ADAM19 1 83212 1.20175E-5 41606 0 3.30447E-5
5-156946892-G-A c.-247C>T 5_prime_UTR_premature_start_codon_gain ADAM19 2 83224 2.40315E-5 41612 0 NA
5-156946894-C-G p.Asp185His missense ADAM19 5 83222 6.00803E-5 41611 0 3.97896E-6
5-156946896-C-G p.Arg184Thr missense ADAM19 4 83242 4.80527E-5 41621 0 3.46136E-4
5-156946906-G-A p.Pro181Ser missense ADAM19 1 83238 1.20137E-5 41619 0 8.23927E-6
5-156946907-C-T p.Lys180Lys synonymous ADAM19 4 83236 4.80561E-5 41618 0 3.97795E-6
5-156946908-T-C p.Lys180Arg missense ADAM19 2 83242 2.40263E-5 41621 0 NA
5-156946911-G-C p.Ser179Cys missense ADAM19 1 83250 1.2012E-5 41625 0 0.00100705
5-156946911-G-A p.Ser179Phe missense ADAM19 1 83250 1.2012E-5 41625 0 NA
5-156946918-C-T p.Glu177Lys missense ADAM19 7 83248 8.40861E-5 41624 0 3.29506E-5
5-156946919-G-A c.-274C>T 5_prime_UTR_premature_start_codon_gain ADAM19 4 83250 4.8048E-5 41625 0 1.15325E-4
5-156946919-G-C p.Phe176Leu missense ADAM19 1 83250 1.2012E-5 41625 0 3.18228E-5
5-156946923-C-T p.Gly175Glu missense ADAM19 1 83260 1.20106E-5 41630 0 8.23737E-6
5-156946927-A-C p.Cys174Gly missense ADAM19 1 83246 1.20126E-5 41623 0 NA
5-156946934-C-T p.Pro171Pro synonymous ADAM19 6 83234 7.20859E-5 41617 0 3.18776E-5
5-156946935-G-A p.Pro171Leu missense ADAM19 7 83234 8.41002E-5 41617 0 0.0020141
5-156946938-G-C p.Pro170Arg missense ADAM19 1 83244 1.20129E-5 41622 0 8.23737E-6
5-156946938-G-A p.Pro170Leu missense ADAM19 2 83244 2.40258E-5 41622 0 3.18796E-5
5-156946939-G-A p.Pro170Ser missense ADAM19 1 83244 1.20129E-5 41622 0 3.18735E-5
5-156946940-C-T p.Pro169Pro synonymous ADAM19 485 83234 0.00582695 41617 6 0.0122511
5-156946941-G-A p.Pro169Leu missense ADAM19 3 83248 3.60369E-5 41624 0 3.58009E-5
5-156946942-G-A p.Pro169Ser missense ADAM19 1 83246 1.20126E-5 41623 0 8.23737E-6
5-156946957-A-T p.Ser164Thr missense ADAM19 1 83256 1.20111E-5 41628 0 NA
5-156946999-C-T p.Glu150Lys missense ADAM19 23 83226 2.76356E-4 41613 0 6.25E-4
5-156947000-G-A c.-355C>T 5_prime_UTR_premature_start_codon_gain ADAM19 2 83230 2.40298E-5 41615 0 3.30028E-5
5-156947005-C-T p.Val148Ile missense ADAM19 3 83228 3.60456E-5 41614 0 5.03525E-4
5-156947006-G-A c.-361C>T 5_prime_UTR_premature_start_codon_gain ADAM19 6 83222 7.20963E-5 41611 0 9.0849E-5
5-156947012-G-C c.-367C>G 5_prime_UTR_premature_start_codon_gain ADAM19 3 83216 3.60508E-5 41608 0 NA
5-156947033-C-T p.Leu138Leu synonymous ADAM19 2 83180 2.40442E-5 41590 0 NA
5-156957822-C-A p.Gly134* stop_gained ADAM19 1 83288 1.20065E-5 41644 0 NA
5-156957825-G-A p.Arg133* stop_gained ADAM19 1 83312 1.20031E-5 41656 0 1.59109E-5
5-156957831-T-C p.Thr131Ala missense ADAM19 2 83328 2.40015E-5 41664 0 1.89544E-4
5-156957839-G-C p.Thr128Arg missense ADAM19 1 83336 1.19996E-5 41668 0 NA
5-156957839-G-A p.Thr128Met missense ADAM19 5 83336 5.99981E-5 41668 0 6.25E-4
5-156957844-G-A p.Ser126Ser synonymous ADAM19 1 83352 1.19973E-5 41676 0 3.9769E-6
5-156957858-T-C p.Thr122Ala missense ADAM19 5 83350 5.9988E-5 41675 0 3.97671E-6
5-156957868-C-T p.Thr118Thr synonymous ADAM19 4 83346 4.79927E-5 41673 0 6.36862E-5
5-156957869-G-A p.Thr118Met missense ADAM19 1 83350 1.19976E-5 41675 0 1.19299E-5
5-156957893-T-TCCAATTTCCGTGTGGTGGTTTGAGGGTTACCACTTGAAGTATA c.331-3_331-2insTATACTTCAAGTGGTAACCCTCAAACCACCACACGGAAATTGG splice_region ADAM19 1 83312 1.20031E-5 41656 0 NA
5-156964931-C-T p.Arg107Gln missense ADAM19 5 83398 5.99535E-5 41699 0 3.18512E-5
5-156964932-G-A p.Arg107Trp missense ADAM19 8 83398 9.59256E-5 41699 0 8.23764E-6
5-156964940-G-C p.Thr104Ser missense ADAM19 2 83410 2.39779E-5 41705 0 NA
5-156964942-T-A p.Gln103His missense ADAM19 2 83412 2.39774E-5 41706 0 NA
5-156964944-G-C p.Gln103Glu missense ADAM19 973 83386 0.0116686 41693 29 0.0246638
5-156964954-A-C p.Ser99Arg missense ADAM19 1 83414 1.19884E-5 41707 0 NA
5-156964970-G-C p.Thr94Ser missense ADAM19 2 83410 2.39779E-5 41705 0 NA
5-156964981-G-C p.Ser90Ser synonymous ADAM19 2 83406 2.39791E-5 41703 0 NA
5-156964986-G-A p.Pro89Ser missense ADAM19 1 83394 1.19913E-5 41697 0 NA
5-156964990-A-G p.Phe87Phe synonymous ADAM19 1 83382 1.1993E-5 41691 0 NA
5-156964991-A-G p.Phe87Ser missense ADAM19 1 83384 1.19927E-5 41692 0 NA
5-156964998-G-C p.Gln85Glu missense+splice_region ADAM19 1 83364 1.19956E-5 41682 0 3.97991E-6
5-156964999-C-CTCATTCTTCTCCAGGTCCAGGATCAGTTCTCGCCCCTCAGCCATTA c.252-1_252insTAATGGCTGAGGGGCGAGAACTGATCCTGGACCTGGAGAAGAATGA splice_acceptor ADAM19 2 83362 2.39917E-5 41681 1 NA
5-156964999-C-CTCATT c.252-1_252insAATGA splice_acceptor ADAM19 2 83362 2.39917E-5 41681 1 NA
5-156991389-C-G p.Glu81Asp missense ADAM19 1 83364 1.19956E-5 41682 0 NA
5-156991411-C-T p.Arg74Gln missense ADAM19 2 83378 2.39871E-5 41689 0 1.19291E-5
5-156991412-G-T p.Arg74Arg synonymous ADAM19 2 83370 2.39894E-5 41685 0 3.18431E-5
5-156991412-G-A p.Arg74* stop_gained ADAM19 2 83370 2.39894E-5 41685 0 5.76597E-5
5-156991421-C-T p.Ala71Thr missense ADAM19 1 83380 1.19933E-5 41690 0 NA
5-156991430-T-C p.Arg68Gly missense ADAM19 2 83366 2.39906E-5 41683 0 8.2371E-6
5-156991445-G-A p.Leu63Phe missense ADAM19 311 83332 0.00373206 41666 0 0.005
5-156997910-C-T p.Arg58Lys missense ADAM19 1 83332 1.20002E-5 41666 0 NA
5-156997914-C-T p.Val57Met missense ADAM19 2 83340 2.39981E-5 41670 0 1.81371E-4
5-156997915-G-C p.Pro56Pro synonymous ADAM19 1 83346 1.19982E-5 41673 0 NA
5-156997928-G-C p.Thr52Ser missense ADAM19 1 83342 1.19988E-5 41671 0 3.97747E-6
5-156997933-C-T p.Trp50* stop_gained ADAM19 1 83346 1.19982E-5 41673 0 NA
5-156997947-T-A p.Ile46Phe missense ADAM19 2 83346 2.39964E-5 41673 0 NA
5-156997960-C-T p.Leu41Leu synonymous ADAM19 1 83328 1.20008E-5 41664 0 NA
5-156997962-G-C p.Leu41Val missense ADAM19 1 83322 1.20016E-5 41661 0 NA
5-156997989-C-T c.95-1G>A splice_acceptor ADAM19 3 83292 3.60179E-5 41646 0 NA
5-156997992-C-A c.95-4G>T splice_region ADAM19 1 83262 1.20103E-5 41631 0 8.26187E-6
5-156999286-G-A c.95-3C>T splice_region ADAM19 1 52310 1.91168E-5 26155 0 7.31187E-6
5-157002624-C-T p.Glu27Glu synonymous ADAM19 5 66814 7.48346E-5 33407 0 5.06928E-4
5-157002628-C-A p.Arg26Leu missense ADAM19 142 65950 0.00215315 32975 2 0.00568182
5-157002630-C-T p.Ala25Ala synonymous ADAM19 1 65212 1.53346E-5 32606 0 3.19081E-5
5-157002634-G-T p.Ala24Glu missense ADAM19 2 64344 3.10829E-5 32172 0 NA
5-157002637-C-T p.Arg23Gln missense ADAM19 1 64230 1.5569E-5 32115 0 NA
5-157002641-G-A p.Pro22Ser missense ADAM19 2 63024 3.17339E-5 31512 0 NA
5-157002644-G-C p.Arg21Gly missense ADAM19 1 62860 1.59084E-5 31430 0 NA
5-157002669-C-A p.Leu12Phe missense ADAM19 23 56908 4.04161E-4 28454 0 0.00135257
5-157002671-A-G c.-768T>C 5_prime_UTR_premature_start_codon_gain ADAM19 1 56478 1.7706E-5 28239 0 6.06649E-5
5-157002672-G-A p.Cys11Cys synonymous ADAM19 1 56154 1.78082E-5 28077 0 9.25241E-5
5-157002678-C-T p.Arg9Arg synonymous ADAM19 3 54426 5.51207E-5 27213 0 0.0018797
5-157002680-G-C p.Arg9Gly missense ADAM19 3 53564 5.60078E-5 26782 0 NA
5-157002695-C-T p.Gly4Ser missense ADAM19 3306 49392 0.0669339 24696 136 0.135036
5-157002738-C-T c.-34G>A 5_prime_UTR_premature_start_codon_gain ADAM19 1 41488 2.41034E-5 20744 0 NA
5-157002760-C-A c.-56G>T 5_prime_UTR_premature_start_codon_gain ADAM19 1 36736 2.72213E-5 18368 0 NA