Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
2-9630311-ACT-A p.Glu823fs frameshift ADAM17 5 83130 6.01468E-5 41565 0 2.81195E-5
2-9630314-C-CT p.Glu823fs frameshift ADAM17 1 83164 1.20244E-5 41582 0 8.55739E-6
2-9630334-C-T p.Arg816His missense ADAM17 1 83266 1.20097E-5 41633 0 3.18431E-5
2-9630334-C-A p.Arg816Leu missense ADAM17 1 83266 1.20097E-5 41633 0 8.31532E-6
2-9630335-G-A p.Arg816Cys missense ADAM17 1 83286 1.20068E-5 41643 0 3.18644E-5
2-9630344-G-A p.Arg813Cys missense ADAM17 4 83322 4.80065E-5 41661 0 2.48028E-5
2-9630365-C-A p.Ala806Ser missense ADAM17 1 83364 1.19956E-5 41682 0 6.3678E-5
2-9630365-C-T p.Ala806Thr missense ADAM17 1 83364 1.19956E-5 41682 0 2.47329E-5
2-9630380-T-C p.Thr801Ala missense ADAM17 1 83378 1.19936E-5 41689 0 NA
2-9630384-C-T p.Pro799Pro synonymous ADAM17 2 83384 2.39854E-5 41692 0 3.977E-6
2-9630384-C-A p.Pro799Pro synonymous ADAM17 2 83384 2.39854E-5 41692 0 3.977E-6
2-9630385-G-A p.Pro799Leu missense ADAM17 3 83388 3.59764E-5 41694 0 6.37146E-5
2-9630392-C-A p.Asp797Tyr missense ADAM17 1 83388 1.19921E-5 41694 0 3.1839E-5
2-9630393-C-T p.Thr796Thr synonymous ADAM17 15 83388 1.79882E-4 41694 0 0.003125
2-9630401-C-T p.Asp794Asn missense ADAM17 6 83394 7.19476E-5 41697 0 3.18329E-5
2-9630421-G-A p.Thr787Ile missense ADAM17 1 83398 1.19907E-5 41699 0 3.18431E-5
2-9630434-G-C p.Pro783Ala missense ADAM17 1 83392 1.19916E-5 41696 0 NA
2-9630435-G-A p.Phe782Phe synonymous ADAM17 46 83388 5.51638E-4 41694 1 0.00341089
2-9630438-G-C p.Pro781Pro synonymous ADAM17 1 83396 1.1991E-5 41698 0 3.97652E-6
2-9630438-G-A p.Pro781Pro synonymous ADAM17 1 83396 1.1991E-5 41698 0 NA
2-9630440-G-A p.Pro781Ser missense ADAM17 1 83398 1.19907E-5 41699 0 NA
2-9630454-CC-TT p.Gly776Lys missense ADAM17 5 83388 5.99607E-5 41694 0 NA
2-9630461-C-T p.Glu774Lys missense ADAM17 1 83378 1.19936E-5 41689 0 8.23968E-6
2-9630462-G-A p.Asp773Asp synonymous ADAM17 3 83384 3.59781E-5 41692 0 4.37417E-5
2-9630470-G-C p.His771Asp missense ADAM17 1 83382 1.1993E-5 41691 0 NA
2-9630481-C-T p.Ser767Asn missense ADAM17 7 83384 8.3949E-5 41692 0 6.37024E-5
2-9630488-C-T p.Asp765Asn missense ADAM17 1 83376 1.19939E-5 41688 0 8.23981E-6
2-9630497-T-A p.Ile762Phe missense ADAM17 1 83354 1.1997E-5 41677 0 5.03525E-4
2-9630501-G-A p.Asp760Asp synonymous ADAM17 13 83348 1.55973E-4 41674 0 0.00125
2-9630502-T-G p.Asp760Ala missense ADAM17 1 83348 1.19979E-5 41674 0 8.24171E-6
2-9630511-T-C p.Gln757Arg missense ADAM17 2 83346 2.39964E-5 41673 0 4.1212E-5
2-9630513-G-A p.His756His synonymous ADAM17 1 83350 1.19976E-5 41675 0 NA
2-9630527-G-C p.Pro752Ala missense ADAM17 1 83332 1.20002E-5 41666 0 NA
2-9630537-C-T p.Ala748Ala synonymous ADAM17 3 83300 3.60144E-5 41650 0 3.18735E-5
2-9630538-G-A p.Ala748Val missense ADAM17 196 83294 0.00235311 41647 3 0.00570209
2-9630541-G-A p.Ser747Leu missense ADAM17 1258 83256 0.01511 41628 10 0.0302115
2-9630554-G-C p.Pro743Ala missense ADAM17 1 83262 1.20103E-5 41631 0 3.18492E-5
2-9630557-C-T p.Ala742Thr missense ADAM17 1 83258 1.20109E-5 41629 0 1.65139E-5
2-9630561-CT-TG p.Gln740Pro missense ADAM17 1 83234 1.20143E-5 41617 0 NA
2-9630568-C-T p.Arg738His missense ADAM17 3 83150 3.60794E-5 41575 0 1.19351E-5
2-9630569-G-A p.Arg738Cys missense ADAM17 3 83134 3.60863E-5 41567 0 5.96754E-5
2-9630576-A-C p.Thr735Thr synonymous ADAM17 4 83112 4.81278E-5 41556 0 8.35475E-5
2-9630582-G-C p.Pro733Pro synonymous ADAM17 12 83038 1.44512E-4 41519 0 0.00127405
2-9630582-G-A p.Pro733Pro synonymous ADAM17 2 83038 2.40854E-5 41519 1 NA
2-9630585-C-T p.Ala732Ala synonymous ADAM17 3 82948 3.61672E-5 41474 0 6.37186E-5
2-9630586-G-A p.Ala732Val missense ADAM17 1 82928 1.20587E-5 41464 0 8.28253E-6
2-9630590-G-C p.Pro731Ala missense ADAM17 1 82866 1.20677E-5 41433 0 NA
2-9630607-C-T p.Arg725His missense ADAM17 6 82284 7.29182E-5 41142 0 6.37267E-5
2-9630608-G-A p.Arg725Cys missense ADAM17 1 82222 1.21622E-5 41111 0 5.86392E-5
2-9630612-C-G p.Ser723Ser synonymous ADAM17 2 81936 2.44093E-5 40968 0 3.98972E-6
2-9630612-C-T p.Ser723Ser synonymous ADAM17 1 81936 1.22046E-5 40968 0 NA
2-9630613-G-A p.Ser723Leu missense ADAM17 2 81804 2.44487E-5 40902 0 NA
2-9630615-T-C p.Ala722Ala synonymous ADAM17 2 81730 2.44708E-5 40865 0 NA
2-9630641-C-T p.Glu714Lys missense ADAM17 1 78766 1.26958E-5 39383 0 2.80746E-5
2-9630645-G-A p.Asn712Asn splice_region+synonymous ADAM17 1 77542 1.28962E-5 38771 0 2.83741E-5
2-9631223-T-C c.2133+7A>G splice_region ADAM17 1 83178 1.20224E-5 41589 0 1.65615E-5
2-9631231-C-G p.Ser711Thr missense+splice_region ADAM17 2 83216 2.40338E-5 41608 0 NA
2-9631236-G-A p.His709His synonymous ADAM17 2 83216 2.40338E-5 41608 0 9.08881E-5
2-9631237-TGAAACA-T p.Leu707_Phe708del disruptive_inframe_deletion ADAM17 1 83224 1.20158E-5 41612 0 3.98327E-6
2-9631242-C-G p.Leu707Leu synonymous ADAM17 1 83226 1.20155E-5 41613 0 NA
2-9631242-C-T p.Leu707Leu synonymous ADAM17 1 83226 1.20155E-5 41613 0 NA
2-9631243-A-G p.Leu707Pro missense ADAM17 1 83230 1.20149E-5 41615 0 NA
2-9631244-G-A p.Leu707Leu synonymous ADAM17 2 83230 2.40298E-5 41615 0 8.25737E-6
2-9631255-T-C p.Glu703Gly missense ADAM17 1 83242 1.20132E-5 41621 0 NA
2-9631266-A-T p.Asp699Glu missense ADAM17 4 83248 4.80492E-5 41624 0 3.30333E-5
2-9631271-A-G p.Leu698Leu synonymous ADAM17 1 83248 1.20123E-5 41624 0 8.26009E-6
2-9631287-A-G c.2083-7T>C splice_region ADAM17 1 83202 1.20189E-5 41601 0 1.19599E-5
2-9633031-C-T p.Cys693Tyr missense ADAM17 7 83238 8.40962E-5 41619 0 9.55353E-5
2-9633033-A-G p.His692His synonymous ADAM17 1 83240 1.20135E-5 41620 0 NA
2-9633036-G-A p.Val691Val synonymous ADAM17 27 83260 3.24285E-4 41630 1 0.00100705
2-9633048-G-A p.Phe687Phe synonymous ADAM17 1 83288 1.20065E-5 41644 0 NA
2-9633078-C-T p.Leu677Leu synonymous ADAM17 2 83298 2.40102E-5 41649 0 9.1381E-6
2-9633084-A-G p.Ser675Ser synonymous ADAM17 1 83294 1.20057E-5 41647 0 4.02366E-6
2-9633092-C-T p.Val673Ile missense ADAM17 555 83248 0.00666683 41624 5 0.00914595
2-9633093-G-A p.Ile672Ile synonymous ADAM17 1 83258 1.20109E-5 41629 0 1.86581E-5
2-9633099-G-A p.Asp670Asp synonymous ADAM17 1 83246 1.20126E-5 41623 0 NA
2-9633106-A-G p.Leu668Ser missense ADAM17 1 83230 1.20149E-5 41615 0 2.03611E-5
2-9633114-T-C p.Gly665Gly splice_region+synonymous ADAM17 7 83166 8.4169E-5 41583 0 2.22873E-4
2-9633123-C-T c.1994-8G>A splice_region ADAM17 1 83118 1.20311E-5 41559 0 4.18505E-6
2-9633872-C-A c.1993+4G>T splice_region ADAM17 2 83296 2.40108E-5 41648 0 8.31794E-6
2-9633884-T-C p.Asn662Ser missense ADAM17 10 83324 1.20013E-4 41662 0 9.55171E-5
2-9633888-T-A p.Ile661Phe missense ADAM17 2 83334 2.39998E-5 41667 0 8.2739E-6
2-9633899-T-C p.Asp657Gly missense ADAM17 13 83324 1.56017E-4 41662 0 1.59175E-4
2-9633904-G-T p.Phe655Leu missense ADAM17 1 83322 1.20016E-5 41661 0 NA
2-9633907-A-G p.Asp654Asp synonymous ADAM17 2 83324 2.40027E-5 41662 0 NA
2-9633909-C-T p.Asp654Asn missense ADAM17 3 83324 3.6004E-5 41662 0 6.36603E-5
2-9633938-C-T p.Arg644Gln missense ADAM17 1 83318 1.20022E-5 41659 0 3.1835E-5
2-9634778-A-G p.Phe634Phe synonymous ADAM17 1 83378 1.19936E-5 41689 0 1.19344E-5
2-9634786-C-T p.Val632Ile missense ADAM17 5 83388 5.99607E-5 41694 0 6.36699E-5
2-9634794-G-A p.Pro629Leu missense ADAM17 1 83384 1.19927E-5 41692 0 6.25E-4
2-9634803-T-TTCCTC p.Lys626fs frameshift ADAM17 1 83400 1.19904E-5 41700 0 NA
2-9634808-CAAAA-C p.Phe623fs frameshift ADAM17 1 83400 1.19904E-5 41700 0 NA
2-9634829-A-G p.Ala617Ala synonymous ADAM17 1 83398 1.19907E-5 41699 0 3.97646E-6
2-9634834-C-T p.Asp616Asn missense ADAM17 2 83398 2.39814E-5 41699 0 5.03525E-4
2-9634841-G-A p.Pro613Pro synonymous ADAM17 1 83390 1.19918E-5 41695 0 5.03525E-4
2-9634847-A-G p.Cys611Cys synonymous ADAM17 3 83390 3.59755E-5 41695 0 2.14147E-4
2-9634850-G-A p.Arg610Arg synonymous ADAM17 2 83386 2.39848E-5 41693 0 NA
2-9634852-G-A p.Arg610Cys missense ADAM17 1 83380 1.19933E-5 41690 0 3.18532E-5
2-9634856-A-G p.Ser608Ser synonymous ADAM17 48938 82988 0.5897 41494 14970 0.634375
2-9634861-G-C p.Leu607Val missense ADAM17 1 83366 1.19953E-5 41683 0 7.95323E-6
2-9637249-A-T p.Cys593Ser missense ADAM17 2 83214 2.40344E-5 41607 0 NA
2-9637279-C-T p.Glu583Lys missense ADAM17 3 83356 3.59902E-5 41678 0 1.6484E-5
2-9637280-G-A p.Cys582Cys synonymous ADAM17 3 83358 3.59893E-5 41679 0 2.47247E-5
2-9637286-A-G p.Pro580Pro synonymous ADAM17 4 83386 4.79697E-5 41693 0 2.78445E-5
2-9637297-T-C p.Lys577Glu missense ADAM17 4 83402 4.79605E-5 41701 0 2.38635E-5
2-9637303-C-G p.Asp575His missense ADAM17 2 83406 2.39791E-5 41703 0 1.59077E-5
2-9637315-C-G p.Gly571Arg missense ADAM17 1 83410 1.1989E-5 41705 0 NA
2-9637320-T-C p.Asp569Gly missense ADAM17 1 83408 1.19893E-5 41704 0 3.97678E-6
2-9637322-C-T p.Leu568Leu synonymous ADAM17 1 83406 1.19895E-5 41703 0 NA
2-9637330-C-G p.Val566Leu missense ADAM17 1 83410 1.1989E-5 41705 0 NA
2-9637331-A-G p.Thr565Thr synonymous ADAM17 1310 83392 0.0157089 41696 17 0.016875
2-9637331-A-T p.Thr565Thr synonymous ADAM17 2 83404 2.39797E-5 41702 0 8.23913E-6
2-9637342-C-T p.Glu562Lys missense ADAM17 1 83400 1.19904E-5 41700 0 7.41546E-5
2-9637358-C-T p.Pro556Pro synonymous ADAM17 1 83388 1.19921E-5 41694 0 3.18471E-5
2-9637360-G-A p.Pro556Ser missense ADAM17 1 83386 1.19924E-5 41693 0 NA
2-9637384-GCAAA-G c.1649-11_1649-8delTTTG splice_region ADAM17 1 83360 1.19962E-5 41680 0 NA
2-9642298-G-A c.1648+4C>T splice_region ADAM17 6 83304 7.20254E-5 41652 0 6.37267E-5
2-9642306-G-A p.Cys548Cys synonymous ADAM17 3 83346 3.59945E-5 41673 0 8.75287E-5
2-9642309-G-A p.Tyr547Tyr synonymous ADAM17 1 83354 1.1997E-5 41677 0 8.24933E-6
2-9642316-A-G p.Val545Ala missense ADAM17 1 83356 1.19967E-5 41678 0 5.56833E-5
2-9642317-C-A p.Val545Leu missense ADAM17 2 83354 2.3994E-5 41677 0 3.97769E-6
2-9642317-C-T p.Val545Met missense ADAM17 1 83354 1.1997E-5 41677 0 NA
2-9642318-G-A p.Gly544Gly synonymous ADAM17 3 83362 3.59876E-5 41681 0 3.18205E-5
2-9642319-C-G p.Gly544Ala missense ADAM17 1 83362 1.19959E-5 41681 0 3.18431E-5
2-9642339-C-A p.Ala537Ala synonymous ADAM17 2 83342 2.39975E-5 41671 0 NA
2-9642339-C-G p.Ala537Ala synonymous ADAM17 1 83342 1.19988E-5 41671 0 NA
2-9642339-C-T p.Ala537Ala synonymous ADAM17 1 83342 1.19988E-5 41671 0 3.18512E-5
2-9642350-ACTT-A p.Lys533del conservative_inframe_deletion ADAM17 1 83326 1.20011E-5 41663 0 8.24674E-6
2-9642357-C-T p.Gln531Gln synonymous ADAM17 1 83304 1.20042E-5 41652 0 NA
2-9642359-G-C p.Gln531Glu missense ADAM17 5 83302 6.00226E-5 41651 0 NA
2-9642403-T-TCACTG p.Asp516fs frameshift ADAM17 1 83022 1.2045E-5 41511 0 NA
2-9642408-G-GCACTGGACACCTTCCTTCAACGTGCAGTCGCT c.1545-4_1545-3insAGCGACTGCACGTTGAAGGAAGGTGTCCAGTG splice_region ADAM17 1 82976 1.20517E-5 41488 0 NA
2-9642409-GAGA-G c.1545-7_1545-5delTCT splice_region ADAM17 14 82940 1.68797E-4 41470 0 2.86734E-4
2-9645302-G-A p.Gln513* stop_gained ADAM17 1 83260 1.20106E-5 41630 0 NA
2-9645308-C-T p.Gly511Ser missense ADAM17 4 83286 4.80273E-5 41643 0 6.3678E-5
2-9645309-T-C p.Glu510Glu synonymous ADAM17 1 83292 1.2006E-5 41646 0 3.9775E-6
2-9645327-G-A p.Ser504Ser synonymous ADAM17 1 83334 1.19999E-5 41667 0 7.95374E-6
2-9645328-C-T p.Ser504Asn missense ADAM17 11 83334 1.31999E-4 41667 0 6.76068E-5
2-9645341-T-C p.Thr500Ala missense ADAM17 1 83348 1.19979E-5 41674 0 NA
2-9645344-C-T p.Asp499Asn missense ADAM17 1 83354 1.1997E-5 41677 0 8.23832E-6
2-9645345-G-A p.Asn498Asn synonymous ADAM17 2 83368 2.399E-5 41684 0 6.36902E-5
2-9645356-A-G p.Tyr495His missense ADAM17 1 83372 1.19944E-5 41686 0 3.97655E-6
2-9645368-G-A p.Pro491Ser missense ADAM17 61 83372 7.31661E-4 41686 0 0.00151057
2-9645393-C-T p.Arg482Arg synonymous ADAM17 2 83392 2.39831E-5 41696 0 3.97659E-6
2-9645396-C-T p.Ser481Ser synonymous ADAM17 1 83392 1.19916E-5 41696 0 7.95336E-6
2-9645422-G-A p.Arg473Cys missense ADAM17 2 83392 2.39831E-5 41696 0 8.23723E-6
2-9645435-C-T p.Glu468Glu synonymous ADAM17 5 83388 5.99607E-5 41694 0 3.97665E-6
2-9645437-C-T p.Glu468Lys missense ADAM17 1 83384 1.19927E-5 41692 0 NA
2-9645438-C-T p.Gln467Gln synonymous ADAM17 1 83386 1.19924E-5 41693 0 3.18431E-5
2-9645443-C-T p.Ala466Thr missense ADAM17 1 83386 1.19924E-5 41693 0 NA
2-9645463-T-C p.Tyr459Cys missense ADAM17 4 83366 4.79812E-5 41683 0 3.18471E-5
2-9645467-T-C p.Ile458Val missense ADAM17 4 83366 4.79812E-5 41683 0 2.78374E-5
2-9645497-T-C c.1345-3A>G splice_region ADAM17 1 83292 1.2006E-5 41646 0 1.64954E-5
2-9645497-T-G c.1345-3A>C splice_region ADAM17 1 83292 1.2006E-5 41646 0 8.24769E-6
2-9650120-G-A p.His444His synonymous ADAM17 4 83364 4.79823E-5 41682 0 0.00100705
2-9650125-C-T p.Asp443Asn missense ADAM17 7 83364 8.39691E-5 41682 0 1.19379E-5
2-9650135-A-G p.Ala439Ala synonymous ADAM17 9 83372 1.0795E-4 41686 0 3.97788E-4
2-9650138-T-A p.Ile438Ile synonymous ADAM17 4 83374 4.79766E-5 41687 0 3.18471E-5
2-9650143-G-C p.Pro437Ala missense ADAM17 2 83376 2.39877E-5 41688 0 3.97788E-6
2-9650150-G-A p.Val434Val synonymous ADAM17 1 83370 1.19947E-5 41685 0 1.59106E-5
2-9650153-A-G p.Tyr433Tyr synonymous ADAM17 3 83370 3.59842E-5 41685 0 3.29468E-5
2-9650168-G-A p.Asp428Asp synonymous ADAM17 2 83360 2.39923E-5 41680 0 NA
2-9650177-C-T p.Pro425Pro synonymous ADAM17 3 83364 3.59868E-5 41682 0 8.23683E-6
2-9650202-G-A p.Pro417Leu missense ADAM17 4 83378 4.79743E-5 41689 0 1.5909E-5
2-9650208-T-C p.His415Arg missense ADAM17 1 83370 1.19947E-5 41685 0 NA
2-9650213-T-A p.Ala413Ala synonymous ADAM17 1 83374 1.19941E-5 41687 0 8.23655E-6
2-9650255-A-T p.Ala399Ala synonymous ADAM17 1 83334 1.19999E-5 41667 0 NA
2-9650264-A-G c.1192-4T>C splice_region ADAM17 2 83328 2.40015E-5 41664 0 9.55292E-5
2-9650266-G-A c.1192-6C>T splice_region ADAM17 1 83316 1.20025E-5 41658 0 NA
2-9658049-C-T p.Gly391Asp missense ADAM17 1 82722 1.20887E-5 41361 0 NA
2-9658066-C-T p.Thr385Thr synonymous ADAM17 1 82934 1.20578E-5 41467 0 8.31559E-6
2-9658075-A-G p.Ser382Ser synonymous ADAM17 1 82988 1.20499E-5 41494 0 3.18573E-5
2-9658078-A-G p.Asn381Asn synonymous ADAM17 4 82994 4.81963E-5 41497 0 8.30896E-6
2-9658083-A-G p.Leu380Leu synonymous ADAM17 1 82990 1.20496E-5 41495 0 NA
2-9658085-T-C p.Tyr379Cys missense ADAM17 1 82990 1.20496E-5 41495 0 2.49236E-5
2-9658092-T-C p.Asn377Asp missense ADAM17 1 83002 1.20479E-5 41501 0 NA
2-9658100-C-T p.Gly374Glu missense ADAM17 1 82978 1.20514E-5 41489 0 3.20205E-5
2-9658101-C-T p.Gly374Arg missense ADAM17 1 82998 1.20485E-5 41499 0 8.3073E-6
2-9658103-A-T p.Val373Asp missense ADAM17 2 82996 2.40975E-5 41498 0 8.30772E-6
2-9658108-G-T p.Ser371Arg missense ADAM17 1 83000 1.20482E-5 41500 0 NA
2-9658118-GCTAAAGTCAAAAGGAAACAGAGATAAATTGCTTATTAAATACAGAATTATAATATAATCCAATCATCTTAATAATCCCAGCAGCATATTCACACAAGAAATGGAAAAACTTAC-G c.1102+1_1103-1del splice_acceptor ADAM17 7 82992 8.43455E-5 41496 1 NA
2-9658232-C-G p.Ala368Pro missense+splice_region ADAM17 1 83132 1.20291E-5 41566 0 NA
2-9658251-A-G p.His361His synonymous ADAM17 2 83180 2.40442E-5 41590 0 8.5258E-6
2-9658287-T-C p.Gly349Gly synonymous ADAM17 1 83130 1.20294E-5 41565 0 NA
2-9658317-T-C p.Thr339Thr synonymous ADAM17 1 82942 1.20566E-5 41471 0 NA
2-9658341-T-C p.Lys331Lys synonymous ADAM17 1 82570 1.21109E-5 41285 0 8.34279E-6
2-9658342-T-G p.Lys331Thr missense ADAM17 1 82522 1.2118E-5 41261 0 6.664E-5
2-9658354-T-C p.Glu327Gly missense ADAM17 2 81914 2.44159E-5 40957 0 3.60516E-5
2-9658354-T-TTTTGA p.Glu327fs frameshift ADAM17 1 81914 1.22079E-5 40957 0 NA
2-9658355-C-CTTT p.Ala326_Glu327insLys conservative_inframe_insertion ADAM17 1 81926 1.22061E-5 40963 0 NA
2-9658359-T-C p.Ile325Met missense ADAM17 1 81012 1.23439E-5 40506 0 1.06489E-5
2-9658371-A-G p.Phe321Phe synonymous ADAM17 1 80688 1.23934E-5 40344 0 NA
2-9658376-G-A p.Gln320* stop_gained ADAM17 1 79300 1.26103E-5 39650 0 NA
2-9658377-C-A c.958-1G>T splice_acceptor ADAM17 1 79524 1.25748E-5 39762 0 NA
2-9658378-T-TCTAGCAACATCTTCACATCCCAAGCATCCTTTTC c.958-3_958-2insGAAAAGGATGCTTGGGATGTGAAGATGTTGCTAG splice_region ADAM17 2 79762 2.50746E-5 39881 1 NA
2-9658378-T-TCTAGCAACATCTTCACATCCCAAGCATCCTTTTCTTCA c.958-3_958-2insTGAAGAAAAGGATGCTTGGGATGTGAAGATGTTGCTAG splice_region ADAM17 2 79764 2.5074E-5 39882 1 NA
2-9658379-T-A c.958-3A>T splice_region ADAM17 1 79576 1.25666E-5 39788 0 NA
2-9658381-G-A c.958-5C>T splice_region ADAM17 3 78592 3.81718E-5 39296 0 3.27746E-4
2-9658381-G-T c.958-5C>A splice_region ADAM17 2 78404 2.55089E-5 39202 0 2.10256E-5
2-9661338-C-A p.Leu317Phe missense ADAM17 1 83166 1.20241E-5 41583 0 NA
2-9661341-C-T p.Met316Ile missense ADAM17 1 83200 1.20192E-5 41600 0 8.24158E-6
2-9661345-T-C p.Lys315Arg missense ADAM17 1 83202 1.20189E-5 41601 0 NA
2-9661356-A-G p.Ala311Ala synonymous ADAM17 2 83250 2.4024E-5 41625 0 NA
2-9661392-G-A p.Asn299Asn synonymous ADAM17 1 83304 1.20042E-5 41652 0 NA
2-9661426-G-A p.Pro288Leu missense ADAM17 1 83206 1.20184E-5 41603 0 NA
2-9661431-C-A p.Lys286Asn missense ADAM17 1 83164 1.20244E-5 41582 0 NA
2-9661434-G-A p.Leu285Leu synonymous ADAM17 1 83154 1.20259E-5 41577 0 4.12092E-5
2-9661442-G-A p.Arg283Cys missense ADAM17 1 83094 1.20346E-5 41547 0 NA
2-9661448-A-G c.844-3T>C splice_region ADAM17 1 83036 1.2043E-5 41518 0 1.64946E-5
2-9661450-A-G c.844-5T>C splice_region ADAM17 510 83000 0.00614458 41500 3 0.00702727
2-9663384-T-C p.Ile279Met missense ADAM17 1 83090 1.20351E-5 41545 0 NA
2-9663411-T-G p.Ala270Ala synonymous ADAM17 3 83172 3.60698E-5 41586 0 8.24321E-6
2-9663414-A-G p.Asn269Asn synonymous ADAM17 2 83174 2.4046E-5 41587 0 8.24266E-6
2-9663433-C-T p.Arg263Gln missense ADAM17 1 83148 1.20267E-5 41574 0 1.64878E-5
2-9663436-T-C p.Tyr262Cys missense ADAM17 2 83154 2.40518E-5 41577 0 NA
2-9663438-G-A p.Ile261Ile synonymous ADAM17 2 83148 2.40535E-5 41574 0 6.37267E-5
2-9663444-A-G p.Asp259Asp synonymous ADAM17 4 83142 4.81105E-5 41571 0 2.78902E-5
2-9663448-A-G p.Val258Ala missense ADAM17 2 83146 2.40541E-5 41573 0 3.18593E-5
2-9663458-T-C p.Ile255Val missense ADAM17 1 83102 1.20334E-5 41551 0 NA
2-9663459-T-C p.Leu254Leu synonymous ADAM17 1 83092 1.20349E-5 41546 0 NA
2-9663471-T-C c.754-4A>G splice_region ADAM17 1 82980 1.20511E-5 41490 0 NA
2-9666232-A-G c.753+8T>C splice_region ADAM17 1 83196 1.20198E-5 41598 0 NA
2-9666248-T-C p.Asn249Asp missense ADAM17 2 83280 2.40154E-5 41640 0 8.26925E-6
2-9666288-G-C p.Phe235Leu missense ADAM17 1 83330 1.20005E-5 41665 0 NA
2-9666297-A-G p.Asp232Asp synonymous ADAM17 1 83318 1.20022E-5 41659 0 NA
2-9666321-C-A p.Thr224Thr synonymous ADAM17 1 83314 1.20028E-5 41657 0 1.19422E-5
2-9666322-G-A p.Thr224Met missense ADAM17 1 83310 1.20034E-5 41655 0 NA
2-9666324-G-A p.Asn223Asn synonymous ADAM17 1 83312 1.20031E-5 41656 0 8.23859E-6
2-9666325-T-C p.Asn223Ser missense ADAM17 3 83308 3.60109E-5 41654 0 1.64772E-5
2-9666327-C-A p.Lys222Asn missense ADAM17 1 83308 1.20036E-5 41654 0 8.23873E-6
2-9666339-T-C p.Pro218Pro synonymous ADAM17 2 83286 2.40136E-5 41643 0 1.19425E-5
2-9666341-G-T p.Pro218Thr missense ADAM17 4 83268 4.80377E-5 41634 0 1.59318E-5
2-9666342-G-A p.Asp217Asp synonymous ADAM17 1 83264 1.201E-5 41632 0 7.96445E-6
2-9666345-A-G p.Ala216Ala synonymous ADAM17 2 83262 2.40206E-5 41631 0 3.18451E-5
2-9666349-C-A p.Arg215Ile missense ADAM17 10 83260 1.20106E-4 41630 0 6.36699E-5
2-9666375-T-TTCAGGTGGTTCTCTGTCTACTAACCCTTTTGGGAGCAACTCTTC c.620-3_620-2insGAAGAGTTGCTCCCAAAAGGGTTAGTAGACAGAGAACCACCTGA splice_region ADAM17 1 83172 1.20233E-5 41586 0 NA
2-9666375-T-TTC c.620-3_620-2insGA splice_region ADAM17 1 83174 1.2023E-5 41587 0 NA
2-9666376-A-G c.620-3T>C splice_region ADAM17 1 83160 1.2025E-5 41580 0 4.00218E-6
2-9667908-G-A c.619+7C>T splice_region ADAM17 3 81796 3.66766E-5 40898 0 2.59359E-5
2-9667927-C-T p.Glu203Lys missense ADAM17 1 82418 1.21333E-5 41209 0 NA
2-9667930-T-C p.Arg202Gly missense ADAM17 2360 82410 0.0286373 41205 190 0.0630335
2-9667935-A-T p.Val200Glu missense ADAM17 2 82774 2.41622E-5 41387 0 NA
2-9667943-T-G p.Lys197Asn missense ADAM17 2 82892 2.41278E-5 41446 0 1.25565E-5
2-9667972-T-C p.Lys188Glu missense ADAM17 2 83076 2.40743E-5 41538 0 8.25328E-6
2-9667988-T-G p.Lys182Asn missense ADAM17 1 83128 1.20296E-5 41564 0 NA
2-9667996-A-T p.Ser180Thr missense ADAM17 2 83118 2.40622E-5 41559 0 NA
2-9667998-T-C p.Gln179Arg missense ADAM17 1 83134 1.20288E-5 41567 0 9.0804E-5
2-9668004-C-T p.Arg177His missense ADAM17 2 83104 2.40662E-5 41552 0 4.1295E-5
2-9668004-C-G p.Arg177Pro missense ADAM17 3 83104 3.60993E-5 41552 0 NA
2-9668036-A-G p.Val166Val synonymous ADAM17 1 82954 1.20549E-5 41477 0 NA
2-9668050-T-C p.Lys162Glu missense ADAM17 120 82836 0.00144865 41418 0 0.00299401
2-9668081-T-C p.Pro151Pro splice_region+synonymous ADAM17 1 81686 1.2242E-5 40843 0 NA
2-9668084-C-CTCTATGTTATATTCGGCCCCATCTGTGTTGATTCTGAT c.451-2_451-1insATCAGAATCAACACAGATGGGGCCGAATATAACATAGA splice_acceptor ADAM17 4 80868 4.94633E-5 40434 1 NA
2-9668086-A-G c.451-3T>C splice_region ADAM17 1 80820 1.23732E-5 40410 0 NA
2-9675978-G-C p.Ala145Ala synonymous ADAM17 145 81848 0.00177158 40924 0 0.0020141
2-9675978-G-A p.Ala145Ala synonymous ADAM17 1 81862 1.22157E-5 40931 0 1.66903E-5
2-9676005-A-G p.Val136Val synonymous ADAM17 1 82090 1.21818E-5 41045 0 8.29931E-6
2-9676022-T-C p.Ile131Val missense ADAM17 2 82070 2.43694E-5 41035 0 8.31642E-6
2-9676035-C-T p.Arg126Arg synonymous ADAM17 1 81404 1.22844E-5 40702 0 NA
2-9676047-C-A p.Glu122Asp missense ADAM17 1 80614 1.24048E-5 40307 0 NA
2-9676049-C-T p.Glu122Lys missense+splice_region ADAM17 1 80522 1.2419E-5 40261 0 NA
2-9676052-C-CAACCACGTGTCCAG c.362-2_362-1insCTGGACACGTGGTT splice_acceptor ADAM17 1 80278 1.24567E-5 40139 0 NA
2-9676052-C-CAACCACGTGTCCAGTGAAGAAGTCCTGCCATT c.362-2_362-1insAATGGCAGGACTTCTTCACTGGACACGTGGTT splice_acceptor ADAM17 2 80278 2.49134E-5 40139 1 NA
2-9676057-G-A c.362-6C>T splice_region ADAM17 1 79664 1.25527E-5 39832 0 2.92799E-4
2-9676819-A-G c.361+8T>C splice_region ADAM17 1 83370 1.19947E-5 41685 0 NA
2-9676833-C-T p.Val119Met missense ADAM17 3 83394 3.59738E-5 41697 0 3.18471E-5
2-9676834-G-A p.His118His synonymous ADAM17 1 83392 1.19916E-5 41696 0 5.03525E-4
2-9676856-C-T p.Trp111* stop_gained ADAM17 3 83394 3.59738E-5 41697 0 NA
2-9676866-T-C p.Thr108Ala missense ADAM17 1 83388 1.19921E-5 41694 0 8.23873E-6
2-9676873-G-A p.Ser105Ser synonymous ADAM17 1 83384 1.19927E-5 41692 0 8.2394E-6
2-9676878-C-T p.Glu104Lys missense ADAM17 2 83388 2.39843E-5 41694 0 3.18654E-5
2-9676879-G-A p.Asn103Asn synonymous ADAM17 9 83386 1.07932E-4 41693 0 3.97681E-5
2-9676887-C-T p.Gly101Ser missense ADAM17 1 83382 1.1993E-5 41691 0 5.56771E-5
2-9676899-C-T p.Val97Met missense ADAM17 1 83382 1.1993E-5 41691 0 NA
2-9676902-C-T p.Val96Ile missense ADAM17 1 83386 1.19924E-5 41693 0 8.25737E-6
2-9676921-A-G p.Arg89Arg synonymous ADAM17 5 83370 5.99736E-5 41685 0 3.32375E-5
2-9676930-A-G p.Ser86Ser synonymous ADAM17 1 83360 1.19962E-5 41680 0 NA
2-9676933-T-C p.Ser85Ser synonymous ADAM17 3 83366 3.59859E-5 41683 0 3.18512E-5
2-9676949-T-G p.Lys80Thr missense ADAM17 2 83344 2.39969E-5 41672 0 NA
2-9676956-G-C p.His78Asp missense+splice_region ADAM17 60 83342 7.19925E-4 41671 0 0.00305888
2-9683300-G-T p.Thr71Asn missense ADAM17 2 82254 2.43149E-5 41127 0 8.28459E-6
2-9683305-T-C p.Leu69Leu synonymous ADAM17 1 82458 1.21274E-5 41229 0 3.18471E-5
2-9683308-T-C p.Thr68Thr synonymous ADAM17 7 82510 8.48382E-5 41255 0 1.48871E-4
2-9683318-T-C p.His65Arg missense ADAM17 1 82852 1.20697E-5 41426 0 8.25587E-6
2-9683320-T-C p.Thr64Thr synonymous ADAM17 1 82932 1.20581E-5 41466 0 8.25491E-6
2-9683327-G-A p.Thr62Ile missense ADAM17 1 83000 1.20482E-5 41500 0 NA
2-9683332-T-C p.Leu60Leu synonymous ADAM17 2 83058 2.40796E-5 41529 0 2.41383E-5
2-9683332-T-A p.Leu60Leu synonymous ADAM17 1 83058 1.20398E-5 41529 0 NA
2-9683334-G-T p.Leu60Ile missense ADAM17 17 83062 2.04666E-4 41531 0 6.37105E-4
2-9683349-C-A p.Val55Leu missense ADAM17 2 83064 2.40778E-5 41532 0 3.18857E-5
2-9683350-C-T p.Ser54Ser synonymous ADAM17 1 83066 1.20386E-5 41533 0 4.12855E-5
2-9683351-G-A p.Ser54Leu missense ADAM17 1 83056 1.20401E-5 41528 0 0.00100705
2-9683364-T-C p.Ile50Val missense ADAM17 346 83056 0.00416586 41528 1 0.00394879
2-9683369-G-A p.Ser48Phe missense ADAM17 2 83050 2.40819E-5 41525 0 1.2142E-5
2-9683402-G-T p.Ser37Tyr missense ADAM17 1 82846 1.20706E-5 41423 0 1.68042E-5
2-9695630-G-A c.97+8C>T splice_region ADAM17 2 81198 2.46311E-5 40599 0 4.86065E-6
2-9695640-A-G p.Leu32Pro missense+splice_region ADAM17 1 81204 1.23147E-5 40602 0 2.85829E-5
2-9695641-G-C p.Leu32Val missense ADAM17 1 81234 1.23101E-5 40617 0 9.23958E-6
2-9695645-C-A p.Gln30His missense ADAM17 1 81250 1.23077E-5 40625 0 NA
2-9695646-T-C p.Gln30Arg missense ADAM17 4 81250 4.92308E-5 40625 0 2.73276E-5
2-9695654-G-A p.Gly27Gly synonymous ADAM17 39 81214 4.80213E-4 40607 0 0.0028858
2-9695661-C-T p.Gly25Asp missense ADAM17 2 81212 2.46269E-5 40606 0 NA
2-9695663-C-A p.Pro24Pro synonymous ADAM17 1 81244 1.23086E-5 40622 0 NA
2-9695664-G-A p.Pro24Leu missense ADAM17 2 81264 2.46111E-5 40632 0 4.38797E-6
2-9695665-G-C p.Pro24Ala missense ADAM17 1 81260 1.23062E-5 40630 0 1.23686E-4
2-9695671-C-A p.Asp22Tyr missense ADAM17 4 81312 4.91932E-5 40656 0 5.9811E-5
2-9695675-A-C p.Pro20Pro synonymous ADAM17 2 81322 2.45936E-5 40661 0 NA
2-9695675-A-G p.Pro20Pro synonymous ADAM17 2 81322 2.45936E-5 40661 0 NA
2-9695676-G-C p.Pro20Arg missense ADAM17 2 81350 2.45851E-5 40675 0 1.96078E-5
2-9695682-G-A p.Pro18Leu missense ADAM17 21 81380 2.58049E-4 40690 0 0.00151976
2-9695701-C-A p.Val12Phe missense ADAM17 1 81518 1.22672E-5 40759 0 NA
2-9695727-T-C p.Gln3Arg missense ADAM17 1 81394 1.22859E-5 40697 0 NA
2-9695730-C-G p.Arg2Thr missense ADAM17 1 81408 1.22838E-5 40704 0 2.76213E-5
2-9695741-G-A c.-7C>T 5_prime_UTR_premature_start_codon_gain ADAM17 2 81298 2.46009E-5 40649 0 3.54183E-5
2-9695752-C-A c.-18G>T 5_prime_UTR_premature_start_codon_gain ADAM17 2 81216 2.46257E-5 40608 0 1.27033E-5
2-9695861-C-A c.-127G>T 5_prime_UTR_premature_start_codon_gain ADAM17 1 70318 1.42211E-5 35159 0 NA