Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-155023405-T-G n.357+7T>G splice_region ADAM15 1 72832 1.37302E-5 36416 0 NA
1-155023824-C-T c.-39C>T 5_prime_UTR_premature_start_codon_gain ADAM15 1 44996 2.22242E-5 22498 0 6.43542E-5
1-155023867-G-C p.Arg2Pro missense ADAM15 6 53866 1.11388E-4 26933 0 7.74233E-5
1-155023867-G-A p.Arg2Gln missense ADAM15 1 53866 1.85646E-5 26933 0 NA
1-155023887-C-T p.Leu9Leu synonymous ADAM15 1 56572 1.76766E-5 28286 0 NA
1-155023895-C-G p.Leu11Leu synonymous ADAM15 2 57228 3.49479E-5 28614 0 NA
1-155023896-C-T p.Leu12Leu synonymous ADAM15 1 57422 1.74149E-5 28711 0 NA
1-155023913-T-A p.Pro17Pro synonymous ADAM15 2 58588 3.41367E-5 29294 0 3.18208E-5
1-155023917-C-T p.Pro19Ser missense ADAM15 9 58548 1.5372E-4 29274 0 6.31313E-4
1-155023924-G-T p.Trp21Leu missense ADAM15 1 58324 1.71456E-5 29162 0 3.19489E-5
1-155023928-G-T p.Pro22Pro synonymous ADAM15 1 57778 1.73076E-5 28889 0 5.1282E-4
1-155023934-A-G p.Pro24Pro synonymous ADAM15 1 57342 1.74392E-5 28671 0 5.70613E-6
1-155023943-T-TGGCACTGAGGAGCAGCAGGCA c.79+3_79+4insGCACTGAGGAGCAGCAGGCAG splice_region ADAM15 1 56644 1.76541E-5 28322 0 NA
1-155023948-C-A c.79+7C>A splice_region ADAM15 1 55762 1.79334E-5 27881 0 NA
1-155024986-C-A n.151-7C>A splice_region ADAM15 1 66936 1.49396E-5 33468 0 1.27551E-4
1-155024993-T-G n.151T>G splice_region ADAM15 5 69958 7.14715E-5 34979 0 7.03185E-5
1-155024994-ATTC-A c.80-7_80-5delCTT splice_region ADAM15 4 70362 5.68489E-5 35181 0 1.12086E-4
1-155025002-TTAAG-T p.Val27fs frameshift ADAM15 2 73072 2.73703E-5 36536 0 NA
1-155025015-T-G p.Cys30Gly missense ADAM15 2 76086 2.6286E-5 38043 0 7.37463E-5
1-155025019-A-G p.Asn31Ser missense ADAM15 2 76678 2.60831E-5 38339 0 NA
1-155025036-G-A c.108+1G>A splice_donor ADAM15 1 78810 1.26887E-5 39405 0 NA
1-155025038-A-G c.108+3A>G splice_region ADAM15 1 79050 1.26502E-5 39525 0 NA
1-155025116-G-A c.80-1G>A splice_acceptor ADAM15 2 81262 2.46117E-5 40631 0 5.2142E-6
1-155025125-T-TG p.Val32fs frameshift ADAM15 2 81314 2.4596E-5 40657 0 3.12032E-5
1-155025129-G-GT p.Val32fs frameshift ADAM15 1 81278 1.23035E-5 40639 0 NA
1-155025143-G-T p.Ala36Ser missense ADAM15 1 81470 1.22745E-5 40735 0 8.78341E-6
1-155025178-G-A p.Arg47Lys missense ADAM15 1 82174 1.21693E-5 41087 0 NA
1-155025182-G-A p.Ala39Thr missense ADAM15 1 82188 1.21672E-5 41094 0 4.07232E-6
1-155025186-C-T p.Arg50* stop_gained ADAM15 8 82222 9.72976E-5 41111 0 3.01312E-4
1-155025187-G-A p.Arg50Gln missense ADAM15 1 82258 1.21569E-5 41129 0 3.1902E-5
1-155025197-T-G p.Leu44Val missense ADAM15 1 82352 1.2143E-5 41176 0 4.04498E-6
1-155025202-G-GC p.Gln47fs frameshift ADAM15 1 82326 1.21468E-5 41163 0 NA
1-155025208-G-C p.Gln47His missense ADAM15 3 82272 3.64644E-5 41136 0 3.18959E-5
1-155025209-G-A p.Val48Ile missense ADAM15 1 82232 1.21607E-5 41116 0 8.08453E-6
1-155025220-C-T p.Thr61Met missense ADAM15 2 82106 2.43588E-5 41053 0 6.38081E-5
1-155025237-T-C p.Leu57Pro missense ADAM15 1 81754 1.22318E-5 40877 0 8.14823E-6
1-155025247-G-T p.Cys70Phe missense ADAM15 2 81422 2.45634E-5 40711 0 NA
1-155025252-A-T p.Gln62Leu missense+splice_region ADAM15 1 81256 1.23068E-5 40628 0 NA
1-155025908-C-G p.Pro68Ala missense ADAM15 2 83218 2.40333E-5 41609 0 3.18857E-5
1-155025918-T-C p.Ile71Thr missense ADAM15 1 83228 1.20152E-5 41614 0 4.11902E-5
1-155025934-C-T p.Asp76Asp synonymous ADAM15 1 83278 1.2008E-5 41639 0 3.29511E-5
1-155025943-T-G p.Ser79Arg missense ADAM15 3 83280 3.60231E-5 41640 0 1.19302E-5
1-155025944-C-T p.His80Tyr missense ADAM15 4 83280 4.80307E-5 41640 0 1.97707E-4
1-155025945-A-T p.His80Leu missense ADAM15 153 83268 0.00183744 41634 2 0.00267755
1-155025968-A-AGGGAGTTGGTCCCAGGCCGCCCAACCCTGGTGT c.263_263+1insGGAGTTGGTCCCAGGCCGCCCAACCCTGGTGTG splice_donor ADAM15 1 83246 1.20126E-5 41623 0 NA
1-155026402-C-T p.Arg94Cys missense ADAM15 2 82736 2.41733E-5 41368 0 6.37146E-5
1-155026404-C-T c.277+5C>T splice_region ADAM15 1 82792 1.20785E-5 41396 0 NA
1-155026416-G-GT p.Trp99fs frameshift ADAM15 1 82880 1.20656E-5 41440 0 NA
1-155026428-C-G p.Pro102Pro synonymous ADAM15 1 82924 1.20592E-5 41462 0 NA
1-155026438-C-T p.Arg106Trp missense ADAM15 40 82952 4.82207E-4 41476 0 2.38631E-4
1-155026439-G-A p.Arg106Gln missense ADAM15 1 82938 1.20572E-5 41469 0 2.47231E-5
1-155026448-G-C p.Ser109Thr missense ADAM15 1 82952 1.20552E-5 41476 0 NA
1-155026449-T-A p.Ser109Arg missense ADAM15 6 82940 7.23414E-5 41470 0 3.57944E-5
1-155026451-A-C p.Glu110Ala missense ADAM15 1 82942 1.20566E-5 41471 0 3.18573E-5
1-155026454-G-A p.Gly111Glu missense ADAM15 3 82910 3.61838E-5 41455 0 1.40114E-4
1-155026459-A-G p.Thr113Ala missense ADAM15 4 82888 4.82579E-5 41444 0 6.37227E-5
1-155026463-T-G p.Leu114Trp missense+splice_region ADAM15 1 82876 1.20662E-5 41438 0 NA
1-155026552-C-T n.427-7C>T splice_region ADAM15 5 82602 6.05312E-5 41301 0 3.18878E-5
1-155026553-G-A n.427-6G>A splice_region ADAM15 5 82636 6.05063E-5 41318 0 6.37918E-5
1-155026559-C-T n.427C>T splice_region ADAM15 21 82684 2.53979E-4 41342 0 6.25E-4
1-155026653-C-T p.Arg124Trp missense ADAM15 1 83026 1.20444E-5 41513 0 7.99399E-6
1-155026654-G-A p.Arg124Gln missense ADAM15 14 83048 1.68577E-4 41524 0 0.00151057
1-155026656-G-A p.Gly125Arg missense ADAM15 2 83064 2.40778E-5 41532 0 8.01558E-6
1-155026657-G-A p.Gly125Glu missense ADAM15 1 83054 1.20404E-5 41527 0 NA
1-155026688-C-T p.Thr135Thr synonymous ADAM15 7 83156 8.41791E-5 41578 0 1.9171E-4
1-155026700-CAGGTATACTGGGCGGATTTAATGACAGTAGAGAAAGTAAGGAGACCCAGGCATGGAGCTGAAATGTTCTCTGACTTTCTTTTTTCTT-C c.419+1_420-1delGTATACTGGGCGGATTTAATGACAGTAGAGAAAGTAAGGAGACCCAGGCATGGAGCTGAAATGTTCTCTGACTTTCTTTTTTCTTAG splice_acceptor ADAM15 12 83184 1.44259E-4 41592 5 NA
1-155026818-A-G p.Ser150Gly missense ADAM15 5 83262 6.00514E-5 41631 0 4.16084E-5
1-155026824-A-T p.Thr152Ser missense ADAM15 2 83266 2.40194E-5 41633 0 4.04527E-6
1-155026834-A-G p.Gln155Arg missense ADAM15 7 83280 8.40538E-5 41640 0 1.40366E-4
1-155026843-G-T p.Gly158Val missense ADAM15 1 83258 1.20109E-5 41629 0 NA
1-155026854-G-C p.Gly162Arg missense ADAM15 66 83256 7.92736E-4 41628 0 0.00172385
1-155026862-C-T p.Pro164Pro synonymous ADAM15 22 83236 2.64309E-4 41618 0 0.00251762
1-155026863-A-G p.Ile165Val missense ADAM15 1 83224 1.20158E-5 41612 0 NA
1-155026866-A-C p.Ile166Leu missense ADAM15 2 83216 2.40338E-5 41608 0 NA
1-155026870-C-T p.Ser167Leu missense ADAM15 1 83218 1.20166E-5 41609 0 1.65555E-5
1-155026871-G-T p.Ser167Ser synonymous ADAM15 9714 82930 0.117135 41465 602 0.110894
1-155026871-GC-TT p.SerArg167* stop_gained ADAM15 1 83192 1.20204E-5 41596 0 NA
1-155026872-C-A p.Arg168Arg synonymous ADAM15 12 83198 1.44234E-4 41599 0 5.03525E-4
1-155026873-G-A p.Arg168Gln missense ADAM15 2 83182 2.40437E-5 41591 0 7.96584E-5
1-155026885-T-C p.Leu172Pro missense ADAM15 6 83156 7.21535E-5 41578 0 4.14236E-5
1-155026897-G-A p.Gly176Asp missense ADAM15 1 83206 1.20184E-5 41603 0 3.18613E-5
1-155026898-C-T p.Gly176Gly synonymous ADAM15 2 83220 2.40327E-5 41610 0 1.1945E-4
1-155026905-T-G p.Cys179Gly missense ADAM15 1 83200 1.20192E-5 41600 0 3.99553E-6
1-155026913-G-A p.Leu181Leu synonymous ADAM15 1 83196 1.20198E-5 41598 0 NA
1-155026915-G-A p.Ser182Asn missense ADAM15 9 83174 1.08207E-4 41587 0 1.98883E-4
1-155026916-C-G p.Ser182Arg missense ADAM15 2 83180 2.40442E-5 41590 0 7.98231E-6
1-155026916-C-A p.Ser182Arg missense ADAM15 1 83180 1.20221E-5 41590 0 NA
1-155026921-G-A p.Arg184Gln missense ADAM15 4 83150 4.81058E-5 41575 0 2.27902E-4
1-155026931-A-G p.Val187Val synonymous ADAM15 4 83048 4.81649E-5 41524 0 NA
1-155026942-A-C p.Lys191Thr missense ADAM15 66597 77624 0.857943 38812 28583 0.888597
1-155026942-A-T p.Lys191Met missense ADAM15 2 82962 2.41074E-5 41481 0 3.31543E-5
1-155026943-G-A p.Lys191Lys synonymous ADAM15 3 82922 3.61786E-5 41461 0 3.18878E-5
1-155026947-C-G p.Pro193Ala missense ADAM15 28 82888 3.37805E-4 41444 0 0.00125
1-155026952-G-A p.Glu194Glu synonymous ADAM15 5 82808 6.03806E-5 41404 0 3.433E-5
1-155026955-C-T p.His195His synonymous ADAM15 1 82726 1.20881E-5 41363 0 8.61802E-6
1-155026958-C-G p.Pro196Pro synonymous ADAM15 1 82710 1.20904E-5 41355 0 4.25188E-6
1-155026958-C-T p.Pro196Pro synonymous ADAM15 2 82710 2.41809E-5 41355 0 3.18918E-5
1-155026959-CT-C p.Leu197fs frameshift ADAM15 8 82702 9.67328E-5 41351 0 4.25217E-6
1-155026962-G-A p.Gly198Arg missense ADAM15 1 82620 1.21036E-5 41310 0 NA
1-155026968-C-T p.Arg200Cys missense ADAM15 1 82370 1.21403E-5 41185 0 2.65332E-5
1-155026977-C-T p.Arg203Cys missense ADAM15 1 82128 1.21761E-5 41064 0 1.37533E-5
1-155026978-G-A p.Arg203His missense ADAM15 1 81954 1.2202E-5 40977 0 2.30343E-5
1-155026980-C-T p.Arg204Trp missense+splice_region ADAM15 16 81858 1.9546E-4 40929 0 1.609E-4
1-155026981-G-A p.Arg204Gln missense+splice_region ADAM15 1 81814 1.22228E-5 40907 0 3.59408E-5
1-155026981-G-C p.Arg204Pro missense+splice_region ADAM15 1 81814 1.22228E-5 40907 0 NA
1-155028255-G-C n.646-8G>C splice_region ADAM15 1 83080 1.20366E-5 41540 0 NA
1-155028270-G-A p.Arg206Gln missense ADAM15 1 83206 1.20184E-5 41603 0 6.37064E-5
1-155028296-G-A p.Val215Met missense ADAM15 1 83280 1.20077E-5 41640 0 NA
1-155028299-G-A p.Glu216Lys missense ADAM15 8 83282 9.60592E-5 41641 0 0.00125
1-155028301-G-A p.Glu216Glu synonymous ADAM15 1 83290 1.20062E-5 41645 0 NA
1-155028322-C-T p.His223His synonymous ADAM15 4 83308 4.80146E-5 41654 0 1.64728E-5
1-155028324-C-T p.Ser224Leu missense ADAM15 3 83296 3.60161E-5 41648 0 6.37105E-5
1-155028325-G-A p.Ser224Ser synonymous ADAM15 3 83292 3.60179E-5 41646 0 1.27437E-4
1-155028326-GAGGTGAGCCTGCTGGCCCCTGCACATCCTCCTCCCCCTGCACTGCCCTGCCGCCTTTCATGTCACCTCTCTTGGCCTAC-G p.Glu225fs frameshift ADAM15 7 83302 8.40316E-5 41651 1 NA
1-155028328-G-A p.Glu225Glu splice_region+synonymous ADAM15 1 83296 1.20054E-5 41648 0 NA
1-155028330-T-C c.675+2T>C splice_donor ADAM15 6 83262 7.20617E-5 41631 0 NA
1-155028334-C-A c.675+6C>A splice_region ADAM15 2 83262 2.40206E-5 41631 0 3.97633E-6
1-155028405-C-T c.676-3C>T splice_region ADAM15 1 83232 1.20146E-5 41616 0 7.41302E-5
1-155028418-A-C p.Tyr229Ser missense ADAM15 2 83246 2.40252E-5 41623 0 4.11841E-5
1-155028420-C-T p.Arg230Trp missense ADAM15 3 83246 3.60378E-5 41623 0 3.97684E-5
1-155028429-C-T p.Gln233* stop_gained ADAM15 6 83252 7.20703E-5 41626 0 8.23778E-6
1-155028445-G-A p.Arg238His missense ADAM15 1 83226 1.20155E-5 41613 0 6.25E-4
1-155028446-C-T p.Arg238Arg synonymous ADAM15 3 83226 3.60464E-5 41613 0 8.2394E-6
1-155028450-C-A p.Leu240Met missense ADAM15 204 83196 0.00245204 41598 2 0.00564524
1-155028467-G-A p.Leu245Leu synonymous ADAM15 1 83184 1.20215E-5 41592 0 NA
1-155028473-C-A p.Asp247Glu missense ADAM15 1 83186 1.20213E-5 41593 0 NA
1-155028476-AGTGAGTGCTGGACAGGGCAACCCCCACCCCAGGCCCCTGACCATGGCAACCCCTCTTCTGAGCCCCAGCTGTCTTTCAG-A c.744+1_745-1delGTGAGTGCTGGACAGGGCAACCCCCACCCCAGGCCCCTGACCATGGCAACCCCTCTTCTGAGCCCCAGCTGTCTTTCAG splice_acceptor ADAM15 10 83174 1.2023E-4 41587 3 NA
1-155028555-GT-G p.Phe249fs frameshift ADAM15 2 83212 2.4035E-5 41606 0 6.37105E-5
1-155028562-C-T p.Arg251Trp missense ADAM15 5 83202 6.00947E-5 41601 0 1.91168E-4
1-155028570-G-A p.Leu253Leu synonymous ADAM15 1 83220 1.20163E-5 41610 0 NA
1-155028574-G-A p.Val255Ile missense ADAM15 2 83220 2.40327E-5 41610 0 NA
1-155028577-C-T p.Arg256* stop_gained ADAM15 6 83206 7.21102E-5 41603 0 6.60284E-5
1-155028586-C-T p.Leu259Leu synonymous ADAM15 4 83220 4.80654E-5 41610 0 6.60284E-5
1-155028590-T-C p.Val260Ala missense ADAM15 1 83218 1.20166E-5 41609 0 NA
1-155028603-C-T p.Ala264Ala synonymous ADAM15 1 83184 1.20215E-5 41592 0 8.253E-6
1-155028613-C-G p.Arg268Gly missense ADAM15 1 83104 1.20331E-5 41552 0 1.65066E-5
1-155028614-G-A p.Arg268His missense ADAM15 8 83074 9.62997E-5 41537 0 5.57529E-5
1-155028622-G-A p.Val271Met missense ADAM15 1 82978 1.20514E-5 41489 0 6.37349E-5
1-155028624-G-A p.Val271Val synonymous ADAM15 10 82968 1.20528E-4 41484 0 5.03525E-4
1-155028625-G-A p.Glu272Lys missense ADAM15 1 82960 1.2054E-5 41480 0 NA
1-155028646-G-T p.Val279Phe missense ADAM15 1 82612 1.21048E-5 41306 0 NA
1-155028647-T-A p.Val279Asp missense ADAM15 1 82582 1.21092E-5 41291 0 NA
1-155028654-C-T p.Leu281Leu synonymous ADAM15 1 82450 1.21286E-5 41225 0 1.6509E-5
1-155028660-C-T p.Asn283Asn synonymous ADAM15 1 82366 1.21409E-5 41183 0 3.98149E-6
1-155028668-A-T p.His286Leu missense ADAM15 4 82136 4.86997E-5 41068 0 2.47619E-5
1-155028673-C-T p.Arg288Cys missense ADAM15 8 82050 9.75015E-5 41025 0 0.00100705
1-155028678-G-C p.Arg289Ser missense ADAM15 2 82062 2.43718E-5 41031 0 1.65071E-5
1-155028682-C-T p.His291Tyr missense ADAM15 1 82102 1.218E-5 41051 0 NA
1-155028692-C-T p.Pro294Leu missense ADAM15 69 82176 8.39661E-4 41088 0 0.00188006
1-155028694-C-T p.Arg295* stop_gained ADAM15 4 82192 4.86665E-5 41096 0 1.19493E-5
1-155028695-G-A p.Arg295Gln missense ADAM15 4 82254 4.86299E-5 41127 0 1.65134E-5
1-155028713-C-T p.Ala301Val missense ADAM15 2 82700 2.41838E-5 41350 0 1.65328E-5
1-155028720-G-A p.Leu303Leu synonymous ADAM15 3 82822 3.62223E-5 41411 0 8.2739E-6
1-155028726-G-A c.914+1G>A splice_donor ADAM15 3 82930 3.61751E-5 41465 0 1.99415E-5
1-155028874-C-A p.Phe309Leu missense ADAM15 1 83232 1.20146E-5 41616 0 3.97747E-6
1-155028886-G-A p.Thr313Thr synonymous ADAM15 1 83224 1.20158E-5 41612 0 1.65041E-5
1-155028893-A-G p.Met316Val missense ADAM15 2 83208 2.40361E-5 41604 0 6.37471E-5
1-155028893-A-T p.Met316Leu missense ADAM15 10 83208 1.20181E-4 41604 0 6.37471E-5
1-155028895-G-A p.Met316Ile missense ADAM15 5 83214 6.0086E-5 41607 0 3.18613E-5
1-155028908-T-C p.Ser321Pro missense ADAM15 1 83232 1.20146E-5 41616 0 1.65082E-5
1-155028946-G-A p.Met333Ile missense+splice_region ADAM15 1 83080 1.20366E-5 41540 0 NA
1-155028947-G-GACCACTCCACCAGCATCCTGGGAGTCGCCTCCTCCATAGCCCA c.999+1_999+2insACCACTCCACCAGCATCCTGGGAGTCGCCTCCTCCATAGCCCA splice_donor ADAM15 2 83076 2.40743E-5 41538 1 NA
1-155028947-G-A c.999+1G>A splice_donor ADAM15 1 83078 1.20369E-5 41539 0 NA
1-155029422-A-G c.1000-7A>G splice_region ADAM15 4 82288 4.86098E-5 41144 0 3.18939E-5
1-155029425-A-G c.1000-4A>G splice_region ADAM15 3 82360 3.64254E-5 41180 0 3.1904E-5
1-155029431-C-T p.Asp334Asp splice_region+synonymous ADAM15 2 82468 2.42518E-5 41234 0 NA
1-155029439-C-T p.Thr337Ile missense ADAM15 1 82636 1.21013E-5 41318 0 NA
1-155029456-G-A p.Ala343Thr missense ADAM15 1 82798 1.20776E-5 41399 0 3.19E-5
1-155029458-C-T p.Ala343Ala synonymous ADAM15 2 82860 2.41371E-5 41430 0 NA
1-155029491-G-C p.Leu354Leu synonymous ADAM15 1 83022 1.2045E-5 41511 0 3.1902E-5
1-155029500-C-T p.Asp357Asp synonymous ADAM15 1 83026 1.20444E-5 41513 0 4.05936E-6
1-155029515-G-A p.Gly362Gly synonymous ADAM15 3 83090 3.61054E-5 41545 0 7.75929E-5
1-155029533-A-G p.Pro368Pro synonymous ADAM15 1 83096 1.20343E-5 41548 0 NA
1-155029534-G-T p.Gly369Cys missense ADAM15 2 83094 2.40691E-5 41547 0 8.525E-6
1-155029577-AGTAAGTAGCTGCAGGATGGAGAGAGGGTGTGGGGCAGGGGGCAGGGAGAGGCCCCCAGCCCCAACCTTCCTTGCCACCCTCCCCAG-A c.1148+1_1149-1delGTAAGTAGCTGCAGGATGGAGAGAGGGTGTGGGGCAGGGGGCAGGGAGAGGCCCCCAGCCCCAACCTTCCTTGCCACCCTCCCCAG splice_acceptor ADAM15 12 83070 1.44456E-4 41535 5 NA
1-155029660-C-T c.1149-4C>T splice_region ADAM15 1 82956 1.20546E-5 41478 0 1.67887E-5
1-155029685-C-CCT p.Ser391fs frameshift ADAM15 2 83050 2.40819E-5 41525 0 3.98568E-6
1-155029685-C-T p.Phe390Phe synonymous ADAM15 1 83050 1.20409E-5 41525 0 5.80056E-5
1-155029686-A-ACCAG p.Ser391fs frameshift ADAM15 2 83040 2.40848E-5 41520 0 3.98568E-6
1-155029696-GC-G p.Arg395fs frameshift ADAM15 1 83042 1.20421E-5 41521 0 NA
1-155029698-C-T p.Arg395* stop_gained ADAM15 1 83014 1.20462E-5 41507 0 NA
1-155029699-G-A p.Arg395Gln missense ADAM15 3 83052 3.61219E-5 41526 0 1.65319E-5
1-155029701-C-T p.Arg396Trp missense ADAM15 1 83056 1.20401E-5 41528 0 8.26528E-6
1-155029702-G-A p.Arg396Gln missense ADAM15 25 83076 3.00929E-4 41538 0 5.03525E-4
1-155029702-G-T p.Arg396Leu missense ADAM15 1 83076 1.20372E-5 41538 0 NA
1-155029709-G-T p.Leu398Leu synonymous ADAM15 69 83126 8.30065E-4 41563 1 0.0100705
1-155029709-G-A p.Leu398Leu synonymous ADAM15 2 83126 2.40599E-5 41563 0 NA
1-155029735-G-C p.Gly407Ala missense ADAM15 2 83126 2.40599E-5 41563 0 7.95798E-6
1-155029744-T-C p.Leu410Pro missense ADAM15 1 83192 1.20204E-5 41596 0 3.97763E-6
1-155029748-C-T p.Phe411Phe synonymous ADAM15 245 83176 0.00294556 41588 2 0.00764818
1-155029749-G-A p.Glu412Lys missense ADAM15 1 83194 1.20201E-5 41597 0 1.64938E-5
1-155029753-G-A p.Arg413Gln missense ADAM15 2 83190 2.40414E-5 41595 0 1.59118E-5
1-155029759-C-A p.Pro415His missense ADAM15 1 83198 1.20195E-5 41599 0 NA
1-155029768-C-G p.Pro418Arg missense ADAM15 5 83214 6.0086E-5 41607 2 NA
1-155029770-C-G p.Pro419Ala missense ADAM15 3 83226 3.60464E-5 41613 0 9.06917E-5
1-155029770-C-A p.Pro419Thr missense ADAM15 1 83226 1.20155E-5 41613 0 3.18573E-5
1-155029771-C-A p.Pro419His missense ADAM15 2 83220 2.40327E-5 41610 0 3.97706E-6
1-155029773-A-G p.Met420Val missense ADAM15 1 83192 1.20204E-5 41596 0 3.18817E-5
1-155029787-C-T p.Cys424Cys synonymous ADAM15 23 83146 2.76622E-4 41573 0 5.73212E-4
1-155029788-G-A p.Gly425Arg missense ADAM15 1 83156 1.20256E-5 41578 0 0.00100705
1-155029807-C-T p.Pro431Leu missense ADAM15 4 83098 4.81359E-5 41549 0 6.37308E-5
1-155029808-G-A p.Pro431Pro synonymous ADAM15 3 83070 3.61141E-5 41535 0 2.47504E-5
1-155029810-G-A p.Gly432Asp missense ADAM15 1 83078 1.20369E-5 41539 0 3.58069E-5
1-155029819-G-A p.Cys435Tyr missense ADAM15 1 83046 1.20415E-5 41523 0 NA
1-155029831-T-C p.Phe439Ser missense ADAM15 5 82938 6.0286E-5 41469 0 NA
1-155030107-C-G c.1324-6C>G splice_region ADAM15 51 81288 6.27399E-4 40644 1 5.73577E-4
1-155030116-T-C p.Cys443Arg missense ADAM15 1 81560 1.22609E-5 40780 0 NA
1-155030117-G-GC p.Val444fs frameshift ADAM15 1 81560 1.22609E-5 40780 0 NA
1-155030118-C-T p.Cys443Cys synonymous ADAM15 3 81604 3.67629E-5 40802 0 6.37389E-5
1-155030119-G-A p.Val444Ile missense ADAM15 1 81640 1.22489E-5 40820 0 1.64997E-5
1-155030121-C-T p.Val444Val synonymous ADAM15 1 81730 1.22354E-5 40865 0 5.96891E-5
1-155030142-G-A p.Leu451Leu synonymous ADAM15 1 82170 1.21699E-5 41085 0 5.03525E-4
1-155030165-C-T p.Ala459Val missense ADAM15 1 82482 1.21239E-5 41241 0 3.18776E-5
1-155030181-C-T p.Asp464Asp synonymous ADAM15 3 82584 3.63266E-5 41292 0 2.78379E-5
1-155030190-T-C p.Cys467Cys synonymous ADAM15 3 82628 3.63073E-5 41314 0 1.59075E-5
1-155030202-CCAGGTGGGTAGAGACTAGACTGGCCACCCGGAGCTCACCTGCCGGGGCCAAGGTGGAAAGGGTCATTCTGACCCCCGGCTGGATTTGCTCAGTGCCCACACTGATGCTCATCCACCCTCCA-C p.Gln472del splice_donor ADAM15 9 82566 1.09004E-4 41283 3 NA
1-155030205-G-GCTGCGCCCGTCTGGCTGGCAGTGTCGTCCTACCAGAGGGGATT c.1416_1416+1insCTGCGCCCGTCTGGCTGGCAGTGTCGTCCTACCAGAGGGGATT splice_donor ADAM15 2 82568 2.42225E-5 41284 1 NA
1-155030210-G-C c.1416+5G>C splice_region ADAM15 2 82542 2.42301E-5 41271 0 8.2394E-6
1-155030211-T-C c.1416+6T>C splice_region ADAM15 1 82534 1.21162E-5 41267 0 3.97725E-6
1-155030323-A-G c.1417-4A>G splice_region ADAM15 1 82656 1.20983E-5 41328 0 2.39133E-5
1-155030330-C-T p.Arg474Cys missense ADAM15 13 82738 1.57122E-4 41369 0 0.00125
1-155030331-G-A p.Arg474His missense ADAM15 1 82748 1.20849E-5 41374 0 6.37349E-5
1-155030334-C-T p.Pro475Leu missense ADAM15 7 82818 8.45227E-5 41409 0 1.83442E-4
1-155030335-G-T p.Pro475Pro synonymous ADAM15 3 82814 3.62258E-5 41407 0 1.19623E-5
1-155030335-G-A p.Pro475Pro synonymous ADAM15 1 82814 1.20753E-5 41407 0 4.12269E-5
1-155030347-G-A p.Gln479Gln synonymous ADAM15 6 82916 7.23624E-5 41458 0 6.37227E-5
1-155030352-G-A p.Arg481His missense ADAM15 1 82916 1.20604E-5 41458 0 8.77578E-5
1-155030364-G-A p.Gly485Glu missense ADAM15 110 83002 0.00132527 41501 0 0.00124275
1-155030365-G-A p.Gly485Gly synonymous ADAM15 2 83004 2.40952E-5 41502 0 4.77956E-4
1-155030365-G-T p.Gly485Gly synonymous ADAM15 1 83004 1.20476E-5 41502 0 NA
1-155030376-T-G p.Leu489Trp missense ADAM15 6 83068 7.223E-5 41534 0 9.97622E-5
1-155030396-G-C p.Asp496His missense ADAM15 2 83056 2.40801E-5 41528 0 6.3743E-5
1-155030410-T-A p.Cys500* stop_gained ADAM15 1 83032 1.20435E-5 41516 0 3.18837E-5
1-155030413-C-T p.Pro501Pro synonymous ADAM15 13 83048 1.56536E-4 41524 0 1.07909E-4
1-155030421-TCAGC-T p.Ser505fs frameshift ADAM15 1 83048 1.20412E-5 41524 0 NA
1-155030437-C-T p.Gly509Gly synonymous ADAM15 1 82948 1.20557E-5 41474 0 4.94568E-5
1-155030440-GC-G p.Cys512fs frameshift ADAM15 1 82958 1.20543E-5 41479 0 NA
1-155030446-C-T p.Cys512Cys synonymous ADAM15 1 82962 1.20537E-5 41481 0 9.89218E-5
1-155030449-T-C p.Ala513Ala synonymous ADAM15 9 82970 1.08473E-4 41485 0 9.98626E-5
1-155030452-C-T p.Gly514Gly synonymous ADAM15 9 82952 1.08496E-4 41476 0 4.79601E-4
1-155030453-G-A p.Gly515Arg missense ADAM15 2 82938 2.41144E-5 41469 0 6.25E-4
1-155030458-A-G p.Gln516Gln synonymous ADAM15 1 82964 1.20534E-5 41482 0 NA
1-155030467-C-T p.Cys519Cys synonymous ADAM15 1 82940 1.20569E-5 41470 0 7.97938E-6
1-155030473-C-T p.His521His synonymous ADAM15 11 82934 1.32636E-4 41467 1 3.18552E-5
1-155030474-G-A p.Gly522Arg missense ADAM15 1 82928 1.20587E-5 41464 0 7.97524E-6
1-155030477-C-T p.Arg523Cys missense ADAM15 4 82880 4.82625E-5 41440 0 9.55475E-5
1-155030478-G-A p.Arg523His missense ADAM15 5 82908 6.03078E-5 41454 0 3.18492E-5
1-155030481-G-T p.Cys524Phe missense ADAM15 1 82940 1.20569E-5 41470 0 NA
1-155030490-A-G p.Tyr527Cys missense ADAM15 1 82962 1.20537E-5 41481 0 3.98172E-6
1-155030492-G-A p.Ala528Thr missense ADAM15 2 82956 2.41092E-5 41478 0 NA
1-155030506-G-A p.Gln532Gln synonymous ADAM15 3 82998 3.61454E-5 41499 0 NA
1-155030512-T-C p.Leu534Leu synonymous ADAM15 1 83014 1.20462E-5 41507 0 NA
1-155030514-G-A p.Trp535* stop_gained ADAM15 1 83014 1.20462E-5 41507 0 NA
1-155030533-C-T p.Pro541Pro synonymous ADAM15 5 83032 6.02177E-5 41516 0 1.31972E-4
1-155030534-G-A p.Ala542Thr missense ADAM15 63 83036 7.58707E-4 41518 0 7.01123E-4
1-155030538-C-T p.Ala543Val missense ADAM15 13 83054 1.56525E-4 41527 0 2.23001E-4
1-155030539-G-T p.Ala543Ala synonymous ADAM15 5 83048 6.02061E-5 41524 0 3.18512E-5
1-155030539-G-A p.Ala543Ala synonymous ADAM15 3 83048 3.61237E-5 41524 0 0.00375
1-155030540-C-T p.Pro544Ser missense ADAM15 1 83048 1.20412E-5 41524 0 NA
1-155030557-A-C p.Thr549Thr synonymous ADAM15 38843 82488 0.470893 41244 9535 0.47403
1-155030557-A-T p.Thr549Thr synonymous ADAM15 1 83140 1.20279E-5 41570 0 8.2511E-6
1-155030558-G-A p.Ala550Thr missense ADAM15 2 83140 2.40558E-5 41570 0 NA
1-155030559-C-G p.Ala550Gly missense ADAM15 1 83148 1.20267E-5 41574 0 3.9807E-6
1-155030561-A-G p.Asn551Asp missense ADAM15 1 83152 1.20262E-5 41576 0 8.26132E-6
1-155030567-C-T p.Arg553Trp missense ADAM15 2 83164 2.40489E-5 41582 0 3.98289E-6
1-155030568-G-A p.Arg553Gln missense ADAM15 1 83148 1.20267E-5 41574 0 2.48004E-5
1-155030577-C-A p.Ala556Asp missense ADAM15 1 83164 1.20244E-5 41582 0 5.03525E-4
1-155030584-G-A p.Gly558Gly synonymous ADAM15 5 83158 6.01265E-5 41579 0 4.78236E-5
1-155030588-T-C p.Cys560Arg missense ADAM15 1 83152 1.20262E-5 41576 0 NA
1-155030591-G-A p.Gly561Arg missense ADAM15 1 83158 1.20253E-5 41579 0 NA
1-155030593-G-A p.Gly561Gly synonymous ADAM15 2 83156 2.40512E-5 41578 0 NA
1-155030594-C-T p.Arg562Cys missense ADAM15 4 83146 4.81081E-5 41573 0 5.03525E-4
1-155030595-G-A p.Arg562His missense ADAM15 20 83150 2.40529E-4 41575 0 6.25E-4
1-155030599-C-A p.Asn563Lys missense ADAM15 88 83176 0.001058 41588 0 0.00118566
1-155030629-TAGGTAAGTGAGGAAACCTGGCTCCTCCTTTGGGTTTCTGAGAGCCTTGGCCCTGCTCCTACTAACTCTGTGTGCCCTTCCCCCTCCCCAC-T p.Asp575fs frameshift ADAM15 15 83176 1.8034E-4 41588 7 NA
1-155030714-C-T c.1722-8C>T splice_region ADAM15 3 82968 3.61585E-5 41484 0 NA
1-155030723-G-T p.Asp575Tyr missense+splice_region ADAM15 1 83004 1.20476E-5 41502 0 8.28871E-6
1-155030743-C-T p.Leu581Leu synonymous ADAM15 4 83038 4.81707E-5 41519 0 8.27116E-6
1-155030752-G-C p.Gln584His missense ADAM15 1 83040 1.20424E-5 41520 0 NA
1-155030756-G-A p.Gly586Ser missense ADAM15 1 83042 1.20421E-5 41521 0 1.65442E-5
1-155030763-C-T p.Thr588Ile missense ADAM15 4 83000 4.81928E-5 41500 0 2.56368E-4
1-155030779-C-T p.Gly593Gly synonymous ADAM15 2 83014 2.40923E-5 41507 0 3.18512E-5
1-155030786-C-T p.Arg596Trp missense ADAM15 6 83016 7.22752E-5 41508 0 0.00100705
1-155030787-G-A p.Arg596Gln missense ADAM15 3 83020 3.61359E-5 41510 0 1.99019E-5
1-155030800-G-T p.Trp600Cys missense ADAM15 3 83018 3.61367E-5 41509 0 3.18613E-5
1-155030808-T-C p.Ile603Thr missense ADAM15 1 83044 1.20418E-5 41522 0 1.65117E-5
1-155030818-T-C p.Asn606Asn synonymous ADAM15 1 83016 1.20459E-5 41508 0 8.25627E-6
1-155030819-G-A p.Gly607Arg missense ADAM15 2 83012 2.40929E-5 41506 0 8.25723E-6
1-155030836-C-T p.Cys612Cys synonymous ADAM15 5 82964 6.02671E-5 41482 0 5.03525E-4
1-155030864-G-C p.Asp622His missense ADAM15 3 82808 3.62284E-5 41404 0 8.29986E-6
1-155030866-T-C p.Asp622Asp synonymous ADAM15 1 82766 1.20823E-5 41383 0 NA
1-155030867-G-C p.Val623Leu missense ADAM15 2 82766 2.41645E-5 41383 0 3.9903E-6
1-155030879-C-T p.Leu627Phe missense ADAM15 1 82690 1.20934E-5 41345 0 NA
1-155030885-A-C p.Thr629Pro missense ADAM15 1 82544 1.21148E-5 41272 0 NA
1-155030890-G-T p.Leu630Leu synonymous ADAM15 34 82472 4.12261E-4 41236 0 5.41505E-4
1-155030892-C-G p.Pro631Arg missense ADAM15 6 82476 7.27484E-5 41238 0 2.80809E-5
1-155030893-T-C p.Pro631Pro synonymous ADAM15 1 82478 1.21244E-5 41239 0 4.01149E-6
1-155030904-G-T p.Cys635Phe missense ADAM15 1 82280 1.21536E-5 41140 0 NA
1-155030923-C-A p.Ser625Arg missense ADAM15 5 81784 6.11367E-5 40892 0 5.0619E-4
1-155030945-G-A p.Val633Met missense ADAM15 2 81344 2.45869E-5 40672 0 4.16979E-6
1-155031157-T-G c.*207T>G splice_region ADAM15 1 82228 1.21613E-5 41114 0 NA
1-155031158-G-T c.*208G>T splice_region ADAM15 1 82228 1.21613E-5 41114 0 NA
1-155031180-G-T c.1918-6G>T splice_region ADAM15 243 82396 0.00294917 41198 0 0.00355215
1-155031193-T-C p.Ile642Thr missense ADAM15 1 82518 1.21186E-5 41259 0 NA
1-155031198-C-T p.His644Tyr missense ADAM15 1 82550 1.21139E-5 41275 0 3.18735E-5
1-155031201-C-T p.Arg645* stop_gained ADAM15 1 82558 1.21127E-5 41279 0 1.99877E-5
1-155031210-C-T p.Arg648Cys missense ADAM15 2 82620 2.42072E-5 41310 0 3.18776E-5
1-155031211-G-A p.Arg648His missense ADAM15 1 82642 1.21004E-5 41321 0 5.28961E-5
1-155031221-C-T p.Leu651Leu synonymous ADAM15 1 82654 1.20986E-5 41327 0 1.74801E-5
1-155031222-C-T p.Leu652Leu synonymous ADAM15 3 82664 3.62915E-5 41332 0 8.73103E-6
1-155031240-C-G p.Arg658Gly missense ADAM15 1 82672 1.2096E-5 41336 0 NA
1-155031241-G-A p.Arg658Gln missense ADAM15 2 82664 2.41943E-5 41332 0 3.26627E-5
1-155031244-G-A p.Ser659Asn missense ADAM15 20 82680 2.41896E-4 41340 0 0.003125
1-155031261-G-A p.Gly665Arg missense+splice_region ADAM15 1 82590 1.2108E-5 41295 0 6.25E-4
1-155032370-C-T c.1996-8C>T splice_region ADAM15 1 82064 1.21856E-5 41032 0 NA
1-155032390-A-G p.Asn670Asp missense ADAM15 2 82234 2.43208E-5 41117 0 NA
1-155032423-C-T p.Pro681Ser missense ADAM15 1 82230 1.2161E-5 41115 0 1.19393E-5
1-155032423-C-A p.Pro681Thr missense ADAM15 4 82230 4.8644E-5 41115 0 2.47464E-5
1-155032434-C-T p.Cys684Cys synonymous ADAM15 5 82204 6.08243E-5 41102 0 1.15519E-4
1-155032436-C-T p.Thr685Ile missense ADAM15 1 82204 1.21649E-5 41102 0 1.65044E-5
1-155032441-C-A p.Gln687Lys missense ADAM15 1 82182 1.21681E-5 41091 0 3.18715E-5
1-155032455-C-G c.2068+5C>G splice_region ADAM15 1 82068 1.2185E-5 41034 0 8.26023E-6
1-155032457-T-G c.2068+7T>G splice_region ADAM15 3 82062 3.65577E-5 41031 0 3.98826E-6
1-155032458-G-A c.2068+8G>A splice_region ADAM15 2 82066 2.43706E-5 41033 0 3.18979E-5
1-155032673-G-A c.2069-8G>A splice_region ADAM15 6 82658 7.25883E-5 41329 0 6.38244E-5
1-155032716-C-T p.Leu702Phe missense ADAM15 1 82770 1.20817E-5 41385 0 NA
1-155032752-A-G p.Ser714Gly missense ADAM15 1240 82506 0.0150292 41253 59 0.0322869
1-155032759-G-A p.Trp716* stop_gained ADAM15 1 82512 1.21194E-5 41256 0 NA
1-155032765-G-A p.Arg718His missense ADAM15 6 82378 7.2835E-5 41189 0 5.77691E-5
1-155032770-C-T p.Arg720Cys missense ADAM15 1 82724 1.20884E-5 41362 0 1.65019E-5
1-155032771-G-A p.Arg720His missense ADAM15 3 82710 3.62713E-5 41355 0 5.03525E-4
1-155032782-C-T p.Arg724* stop_gained ADAM15 1 82722 1.20887E-5 41361 0 3.29989E-5
1-155032783-G-A p.Arg724Gln missense ADAM15 3 82760 3.62494E-5 41380 0 5.96858E-5
1-155032785-C-T p.Leu725Phe missense ADAM15 1 82782 1.20799E-5 41391 0 8.24933E-6
1-155032802-A-C p.Gly730Gly synonymous ADAM15 1 82598 1.21068E-5 41299 0 0.0156093
1-155032818-A-C p.Ser736Arg missense+splice_region ADAM15 31 82756 3.74595E-4 41378 0 7.64867E-4
1-155032821-T-C c.2207+2T>C splice_donor ADAM15 1 82690 1.20934E-5 41345 0 NA
1-155032824-G-A c.2207+5G>A splice_region ADAM15 1 82640 1.21007E-5 41320 0 NA
1-155033243-G-C p.Ala738Pro missense ADAM15 4 81690 4.89656E-5 40845 0 3.29745E-5
1-155033248-A-G p.Gln739Gln synonymous ADAM15 1 81672 1.22441E-5 40836 0 8.24389E-6
1-155033253-G-T p.Gly741Val missense ADAM15 3 81634 3.67494E-5 40817 0 3.18512E-5
1-155033256-C-T p.Pro742Leu missense ADAM15 1 81630 1.22504E-5 40815 0 4.38366E-5
1-155033264-C-T p.Arg745Trp missense ADAM15 19 81600 2.32843E-4 40800 0 1.56688E-4
1-155033274-C-T p.Pro748Leu missense ADAM15 2 81546 2.4526E-5 40773 0 NA
1-155033277-C-T p.Pro749Leu missense ADAM15 3 81524 3.6799E-5 40762 0 6.37227E-5
1-155033278-G-T p.Pro749Pro synonymous ADAM15 80 81502 9.81571E-4 40751 0 0.00117993
1-155033278-G-A p.Pro749Pro synonymous ADAM15 2 81506 2.45381E-5 40753 0 3.30049E-5
1-155033297-C-T p.Arg756* stop_gained ADAM15 2 81362 2.45815E-5 40681 0 2.47692E-5
1-155033298-G-A p.Arg756Gln missense ADAM15 2 81352 2.45845E-5 40676 0 8.25682E-6
1-155033301-G-A p.Gly757Asp missense ADAM15 3 81324 3.68895E-5 40662 0 2.01233E-5
1-155033307-A-T p.Lys759Met missense+splice_region ADAM15 1 81294 1.2301E-5 40647 0 NA
1-155033308-G-A p.Lys759Lys splice_region+synonymous ADAM15 12451 80978 0.153758 40489 1054 0.2275
1-155033309-G-A c.2277+1G>A splice_donor ADAM15 1 81274 1.23041E-5 40637 0 1.21091E-5
1-155033800-G-GCC n.365_366dupCC splice_region ADAM15 1 69424 1.44042E-5 34712 0 NA
1-155033800-GC-G n.366delC splice_region ADAM15 1 69422 1.44047E-5 34711 0 NA
1-155033894-G-A p.Ala760Thr missense+splice_region ADAM15 3 80386 3.73199E-5 40193 0 3.99418E-6
1-155033898-G-A p.Ser762Asn missense ADAM15 1 80466 1.24276E-5 40233 0 NA
1-155033900-G-A p.Ala763Thr missense ADAM15 4 80508 4.96845E-5 40254 0 7.98524E-6
1-155033903-C-G p.Leu764Val missense ADAM15 1 80602 1.24066E-5 40301 0 3.99131E-6
1-155033907-G-A p.Ser765Asn missense ADAM15 4 80546 4.96611E-5 40273 0 1.19733E-5
1-155033907-G-T p.Ser765Ile missense ADAM15 1 80546 1.24153E-5 40273 0 NA
1-155033913-C-T p.Pro767Leu missense ADAM15 45 80706 5.57579E-4 40353 0 0.00125156
1-155033914-G-A p.Arg743Gln missense ADAM15 3 80556 3.72412E-5 40278 0 0.00100908
1-155033917-C-A p.Pro744His missense ADAM15 9 80776 1.11419E-4 40388 0 1.67706E-5
1-155033917-C-T p.Pro744Leu missense ADAM15 1 80778 1.23796E-5 40389 0 3.99444E-6
1-155033918-C-T p.Pro769Ser missense ADAM15 14288 80116 0.178341 40058 1381 0.187952
1-155033921-C-G p.Pro770Ala missense ADAM15 22 80900 2.71941E-4 40450 0 0.00151362
1-155033921-C-A p.Pro770Thr missense ADAM15 3 80902 3.70819E-5 40451 0 0.00125156
1-155033921-C-T p.Pro770Ser missense ADAM15 2 80902 2.47213E-5 40451 0 2.51729E-5
1-155033922-C-A p.Pro770His missense ADAM15 4 80866 4.94645E-5 40433 0 4.19597E-5
1-155033928-G-A p.Arg772Lys missense ADAM15 1 80740 1.23854E-5 40370 0 8.40972E-6
1-155033934-T-C p.Leu774Pro missense ADAM15 2 80866 2.47323E-5 40433 0 NA
1-155033934-T-A p.Leu774Gln missense ADAM15 1 80866 1.23661E-5 40433 0 NA
1-155033938-G-A p.Arg751His missense ADAM15 3 80850 3.71058E-5 40425 0 7.5935E-5
1-155033948-G-A p.Val779Met missense ADAM15 2 81014 2.46871E-5 40507 0 1.69889E-5
1-155033952-C-G p.Ser780Cys missense ADAM15 4 81040 4.93583E-5 40520 0 NA
1-155033955-A-G p.Lys781Arg missense ADAM15 1 81076 1.23341E-5 40538 0 4.00035E-6
1-155033969-AATC-A c.2352+5_2352+7delATC splice_region ADAM15 1 81006 1.23448E-5 40503 0 NA
1-155034047-G-C n.629-5G>C splice_region ADAM15 1 79752 1.25389E-5 39876 0 NA
1-155034051-G-T n.629-1G>T splice_acceptor ADAM15 5 79670 6.27589E-5 39835 0 NA
1-155034053-G-A n.630G>A splice_region ADAM15 1 79642 1.25562E-5 39821 0 NA
1-155034127-G-A n.699+5G>A splice_region ADAM15 1 76568 1.30603E-5 38284 0 NA
1-155034388-G-A p.Leu787Leu synonymous ADAM15 1 81750 1.22324E-5 40875 0 8.94406E-6
1-155034395-C-T p.Arg790* stop_gained ADAM15 1 81616 1.22525E-5 40808 0 NA
1-155034397-A-ACC p.Asn792fs frameshift ADAM15 9 81758 1.10081E-4 40879 0 3.20123E-5
1-155034403-TCC-T p.Pro794fs frameshift ADAM15 4 81598 4.90208E-5 40799 0 9.20437E-6
1-155034412-C-A p.Thr795Thr synonymous ADAM15 1 81932 1.22052E-5 40966 0 NA
1-155034414-G-C p.Arg796Pro missense ADAM15 7 81760 8.56164E-5 40880 0 3.49718E-5
1-155034414-G-A p.Arg796His missense ADAM15 2 81762 2.44612E-5 40881 0 1.27524E-5
1-155034416-C-T p.Pro797Ser missense ADAM15 1 81908 1.22088E-5 40954 0 8.72692E-6
1-155034421-G-A p.Leu798Leu synonymous ADAM15 20 81716 2.4475E-4 40858 0 0.00151057
1-155034425-G-A p.Ala800Thr missense ADAM15 1 81564 1.22603E-5 40782 0 3.47965E-5
1-155034432-C-T p.Pro802Leu missense ADAM15 4 81498 4.9081E-5 40749 0 3.19407E-5
1-155034433-G-T p.Pro802Pro synonymous ADAM15 1 81432 1.22802E-5 40716 0 1.91669E-4
1-155034437-G-T p.Val804Leu missense ADAM15 1 81444 1.22784E-5 40722 0 NA
1-155034439-G-T p.Val804Val synonymous ADAM15 1 81374 1.22889E-5 40687 0 NA
1-155034447-C-T p.Pro807Leu missense ADAM15 1 81096 1.23311E-5 40548 0 NA
1-155034448-GA-G p.Lys808fs frameshift ADAM15 1 81070 1.2335E-5 40535 0 4.26407E-6
1-155034448-G-A p.Pro807Pro synonymous ADAM15 1 81070 1.2335E-5 40535 0 8.72402E-6
1-155034450-A-G p.Lys808Arg missense+splice_region ADAM15 1 80994 1.23466E-5 40497 0 NA
1-155034452-G-A c.2424+1G>A splice_donor ADAM15 1 80958 1.23521E-5 40479 0 3.429E-5
1-155034453-T-C c.2424+2T>C splice_donor ADAM15 4 80710 4.95602E-5 40355 0 1.74984E-5
1-155034456-C-T p.Thr810Met missense ADAM15 2 80610 2.48108E-5 40305 0 NA
1-155034457-G-A c.2424+6G>A splice_region ADAM15 2 80450 2.48602E-5 40225 0 NA
1-155034460-G-C p.Val811Val synonymous ADAM15 10 80372 1.24421E-4 40186 0 2.54176E-4
1-155034461-G-C p.Gly812Arg missense ADAM15 1 80306 1.24524E-5 40153 0 8.83556E-6
1-155034468-AGAAG-A p.Lys815fs frameshift ADAM15 1 79582 1.25657E-5 39791 0 3.20616E-5
1-155034474-G-C p.Gly816Ala missense ADAM15 1 79234 1.26208E-5 39617 0 6.40779E-5
1-155034475-CA-C p.Thr817fs frameshift ADAM15 1 79110 1.26406E-5 39555 0 3.20595E-5
1-155034477-C-A p.Thr817Lys missense ADAM15 4 78814 5.07524E-5 39407 0 1.6038E-4
1-155034478-G-GT p.Ala818fs frameshift ADAM15 1 78612 1.27207E-5 39306 0 3.20718E-5
1-155034480-C-CCCTT p.Ser819fs frameshift ADAM15 1 78496 1.27395E-5 39248 0 3.20554E-5
1-155034489-C-T p.Pro821Leu missense ADAM15 2 77618 2.57672E-5 38809 0 NA
1-155034490-C-G p.Pro821Pro synonymous ADAM15 7 77606 9.01992E-5 38803 0 2.30976E-5
1-155034490-C-T p.Pro821Pro synonymous ADAM15 1 77610 1.28849E-5 38805 0 3.19898E-5
1-155034490-C-A p.Pro821Pro synonymous ADAM15 1 77610 1.28849E-5 38805 0 1.85309E-5
1-155034593-GGTTT-G c.*97+1_*97+4delGTTT splice_donor ADAM15 1 61386 1.62904E-5 30693 0 NA
1-155034597-T-C c.*97+4T>C splice_region ADAM15 1 61070 1.63747E-5 30535 0 NA
1-155034721-T-G p.Ser760Ala missense+splice_region ADAM15 3 65236 4.59869E-5 32618 0 NA
1-155034768-C-T p.Pro752Leu missense ADAM15 6 69532 8.62912E-5 34766 0 NA
1-155034771-C-T p.Thr753Ile missense ADAM15 1 70212 1.42426E-5 35106 0 NA
1-155034792-G-A p.Arg760Gln missense ADAM15 13 71846 1.80943E-4 35923 0 3.50981E-5
1-155034803-C-G p.Pro787Arg missense ADAM15 4 72836 5.49179E-5 36418 0 NA
1-155034804-C-T p.Pro764Leu missense ADAM15 4 72768 5.49692E-5 36384 0 6.18774E-6
1-155034817-G-A p.Gly792Arg missense ADAM15 1 74018 1.35102E-5 37009 0 NA
1-155034826-C-G p.Pro795Ala missense ADAM15 2 74482 2.68521E-5 37241 0 7.70832E-5
1-155034828-C-G p.Pro772Arg missense ADAM15 1 74972 1.33383E-5 37486 0 NA
1-155034831-A-G p.Ter773Trpext*? stop_lost ADAM15 1 75102 1.33152E-5 37551 0 NA
1-155034840-CTCCAGGTAGGAGGAGCCCTGGGCATGGGTGGGCGGGGCGAGTGACCTGGGGGAAAGGGGCCTCTGACTCTTTTTTCTTGGCTTCCCGCAA-C p.Ser800fs frameshift ADAM15 9 75824 1.18696E-4 37912 1 NA
1-155034844-A-G p.Arg801Gly missense+splice_region ADAM15 1 75984 1.31607E-5 37992 0 NA
1-155034846-G-A c.2402+1G>A splice_donor ADAM15 3 76122 3.94104E-5 38061 0 9.27644E-5
1-155034853-G-A c.2402+8G>A splice_region ADAM15 1 76318 1.31031E-5 38159 0 4.37951E-6
1-155034930-A-G c.2403-6A>G splice_region ADAM15 7 80228 8.72513E-5 40114 0 6.40338E-5
1-155034935-G-C c.2403-1G>C splice_acceptor ADAM15 1 80300 1.24533E-5 40150 0 NA
1-155034937-C-T p.Pro802Ser missense+splice_region ADAM15 2 80286 2.49109E-5 40143 0 6.37714E-5
1-155034947-C-T p.Pro805Leu missense ADAM15 1 80418 1.2435E-5 40209 0 NA
1-155034953-C-T p.Pro807Leu missense ADAM15 3 80476 3.72782E-5 40238 0 1.76682E-5
1-155034962-C-T p.Ser810Phe missense ADAM15 1 80470 1.2427E-5 40235 0 1.20134E-5
1-155034965-C-G p.Ser811Trp missense ADAM15 2 80412 2.48719E-5 40206 0 4.00522E-6
1-155034967-C-T p.Leu812Phe missense ADAM15 1 80374 1.24418E-5 40187 0 1.78769E-5
1-155034972-C-T p.Tyr813Tyr synonymous ADAM15 3 80308 3.73562E-5 40154 0 NA
1-155035143-G-A c.*165G>A splice_region ADAM15 2 37636 5.31406E-5 18818 0 NA
1-155035178-T-C n.1067T>C splice_region ADAM15 8 31892 2.50847E-4 15946 0 3.19305E-5
1-155035222-T-C n.1118T>C splice_region ADAM15 31 21248 0.00145896 10624 0 0.00261346
1-155035242-TG-T c.*267delG splice_region ADAM15 6 17454 3.43761E-4 8727 1 NA