Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
22-17662378-T-G p.Lys511Gln missense CECR1 1 83018 1.20456E-5 41509 0 3.1841E-5
22-17662380-G-A p.Thr510Ile missense CECR1 1 83050 1.20409E-5 41525 0 NA
22-17662385-C-T p.Val508Val synonymous CECR1 1 83108 1.20325E-5 41554 0 NA
22-17662387-C-T p.Val508Met missense CECR1 1 83108 1.20325E-5 41554 0 5.16923E-5
22-17662394-T-G p.Ile505Ile synonymous CECR1 1 83144 1.20273E-5 41572 0 NA
22-17662430-G-C p.Phe493Leu missense CECR1 2 83114 2.40633E-5 41557 0 NA
22-17662435-T-C p.Thr492Ala missense CECR1 4 83052 4.81626E-5 41526 0 9.55718E-5
22-17662442-C-G p.Glu489Asp missense CECR1 47 82996 5.66292E-4 41498 0 4.14435E-4
22-17662444-C-G p.Glu489Gln missense CECR1 9 82990 1.08447E-4 41495 0 1.48273E-4
22-17662448-C-T p.Glu487Glu synonymous CECR1 2 82960 2.4108E-5 41480 0 3.18593E-5
22-17662455-A-G p.Leu485Pro missense CECR1 1 82830 1.20729E-5 41415 0 NA
22-17662457-G-C p.Thr484Thr synonymous CECR1 1 82808 1.20761E-5 41404 0 NA
22-17662461-C-T p.Ser483Asn missense CECR1 2 82746 2.41704E-5 41373 0 3.18451E-5
22-17662466-C-A p.Lys481Asn missense+splice_region CECR1 3 82654 3.62959E-5 41327 0 1.59396E-5
22-17662468-TGCAG-T c.1443-6_1443-3delCTGC splice_region CECR1 1 82578 1.21098E-5 41289 0 NA
22-17662470-C-T c.1443-4G>A splice_region CECR1 1 82548 1.21142E-5 41274 0 NA
22-17662704-A-G c.1442+6T>C splice_region CECR1 11 82912 1.32671E-4 41456 0 6.77334E-5
22-17662707-C-T c.1442+3G>A splice_region CECR1 2 82966 2.41063E-5 41483 0 NA
22-17662722-A-G p.Met477Thr missense CECR1 2 83110 2.40645E-5 41555 0 1.65E-5
22-17662729-G-A p.Leu475Leu synonymous CECR1 6 83152 7.2157E-5 41576 0 3.50475E-4
22-17662758-A-G p.Met465Thr missense CECR1 2 83264 2.402E-5 41632 0 3.18756E-5
22-17662759-T-TC p.Met465fs frameshift CECR1 1 83260 1.20106E-5 41630 0 NA
22-17662760-C-T p.Gly464Gly synonymous CECR1 1 83276 1.20083E-5 41638 0 NA
22-17662766-A-G p.Ile462Ile synonymous CECR1 8 83292 9.60476E-5 41646 0 4.37452E-5
22-17662767-A-G p.Ile462Thr missense CECR1 26 83292 3.12155E-4 41646 0 4.78103E-4
22-17662772-C-G p.Met460Ile missense CECR1 1 83302 1.20045E-5 41651 0 3.295E-5
22-17662774-T-A p.Met460Leu missense CECR1 1 83308 1.20036E-5 41654 0 7.95336E-6
22-17662779-A-G p.Val458Ala missense CECR1 1 83312 1.20031E-5 41656 0 3.18776E-5
22-17662779-A-T p.Val458Asp missense CECR1 1 83312 1.20031E-5 41656 0 NA
22-17662793-A-G p.Tyr453Tyr synonymous CECR1 24633 83054 0.29659 41527 3773 0.295569
22-17662794-T-C p.Tyr453Cys missense CECR1 5 83336 5.99981E-5 41668 0 0.00125
22-17662802-G-A p.Gly450Gly synonymous CECR1 2 83334 2.39998E-5 41667 0 NA
22-17662803-C-G p.Gly450Ala missense CECR1 1 83332 1.20002E-5 41666 0 1.59063E-5
22-17662822-C-T p.Ala444Thr missense CECR1 1 83336 1.19996E-5 41668 0 7.95336E-6
22-17662823-T-C p.Pro443Pro synonymous CECR1 1 83334 1.19999E-5 41667 0 NA
22-17662841-C-T p.Val437Val synonymous CECR1 2 83348 2.39958E-5 41674 0 NA
22-17662846-T-TG p.Met436fs frameshift CECR1 1 83350 1.19976E-5 41675 0 NA
22-17662846-T-TGG p.Met436fs frameshift CECR1 1 83350 1.19976E-5 41675 0 NA
22-17662846-T-C p.Met436Val missense CECR1 2 83350 2.39952E-5 41675 0 NA
22-17662849-G-C p.Pro435Ala missense CECR1 11 83344 1.31983E-4 41672 0 6.32358E-4
22-17662850-G-A p.His434His synonymous CECR1 1 83344 1.19985E-5 41672 0 7.95437E-6
22-17662872-G-C p.Ala427Gly missense CECR1 1 83336 1.19996E-5 41668 0 NA
22-17662883-G-C p.Asn423Lys missense CECR1 1 83314 1.20028E-5 41657 0 3.98813E-6
22-17662898-C-T p.Val418Val synonymous CECR1 1 83298 1.20051E-5 41649 0 NA
22-17662900-C-A p.Val418Leu missense CECR1 3 83290 3.60187E-5 41645 0 4.14388E-5
22-17662917-G-C c.1240-5C>G splice_region CECR1 21750 80848 0.269023 40424 2640 0.274796
22-17663486-A-G c.1239+8T>C splice_region CECR1 1 83368 1.1995E-5 41684 0 NA
22-17663493-C-G c.1239+1G>C splice_donor CECR1 1 83380 1.19933E-5 41690 0 NA
22-17663510-C-G p.Cys408Ser missense CECR1 1 83392 1.19916E-5 41696 0 3.18573E-5
22-17663520-T-A p.Ile405Leu missense CECR1 2 83402 2.39802E-5 41701 0 3.18431E-5
22-17663537-C-T p.Trp399* stop_gained CECR1 1 83404 1.19898E-5 41702 0 NA
22-17663542-G-GT p.Tyr397fs frameshift CECR1 4 83410 4.79559E-5 41705 0 NA
22-17663543-T-G p.Tyr397Ser missense CECR1 1 83404 1.19898E-5 41702 0 NA
22-17663549-C-T p.Arg395Lys missense CECR1 1 83410 1.1989E-5 41705 0 NA
22-17663557-G-A p.Pro392Pro synonymous CECR1 2 83404 2.39797E-5 41702 0 3.18573E-5
22-17663560-G-C p.His391Gln missense CECR1 4 83404 4.79593E-5 41702 1 5.03525E-4
22-17663561-T-C p.His391Arg missense CECR1 1 83398 1.19907E-5 41699 0 3.18099E-5
22-17663562-G-A p.His391Tyr missense CECR1 1 83402 1.19901E-5 41701 0 1.19287E-5
22-17663565-T-C p.Lys390Glu missense CECR1 1 83398 1.19907E-5 41699 0 NA
22-17663585-C-T p.Gly383Asp missense CECR1 1 83394 1.19913E-5 41697 0 NA
22-17663586-C-T p.Gly383Ser missense CECR1 2 83392 2.39831E-5 41696 0 7.41339E-5
22-17663587-G-A p.Ile382Ile synonymous CECR1 1 83390 1.19918E-5 41695 0 6.25E-4
22-17663593-G-GGTA p.Thr380dup disruptive_inframe_insertion CECR1 7 83390 8.39429E-5 41695 0 5.03525E-4
22-17663598-T-A p.Thr379Ser missense CECR1 1 83384 1.19927E-5 41692 0 8.2371E-6
22-17663598-T-C p.Thr379Ala missense CECR1 1 83384 1.19927E-5 41692 0 6.58968E-5
22-17663599-G-A p.Asn378Asn synonymous CECR1 1 83380 1.19933E-5 41690 0 8.23737E-6
22-17663615-T-A p.Asp373Val missense CECR1 1 83368 1.1995E-5 41684 0 2.38586E-5
22-17663621-A-G p.Ile371Thr missense CECR1 2 83364 2.39912E-5 41682 0 NA
22-17663629-G-A p.Asp368Asp synonymous CECR1 2 83342 2.39975E-5 41671 0 2.47374E-5
22-17663634-T-G p.Ile367Leu missense CECR1 3 83336 3.59988E-5 41668 0 3.18177E-5
22-17663640-TA-GT p.GlyThr364GlyPro missense CECR1 1 83320 1.20019E-5 41660 0 NA
22-17663646-G-C p.Gln363Glu missense CECR1 1 83302 1.20045E-5 41651 0 NA
22-17663650-G-A p.Asp361Asp splice_region+synonymous CECR1 1 83284 1.20071E-5 41642 0 NA
22-17669221-A-G c.1081+8T>C splice_region CECR1 2 81312 2.45966E-5 40656 0 1.19571E-5
22-17669224-C-T c.1081+5G>A splice_region CECR1 1 81472 1.22742E-5 40736 0 NA
22-17669232-T-C p.Thr360Ala missense CECR1 4 81798 4.8901E-5 40899 0 8.27335E-6
22-17669238-C-T p.Gly358Arg missense CECR1 1 81968 1.21999E-5 40984 0 3.18613E-5
22-17669239-G-A p.Ala357Ala synonymous CECR1 6 82002 7.3169E-5 41001 0 5.9514E-4
22-17669241-C-T p.Ala357Thr missense CECR1 2 82056 2.43736E-5 41028 0 3.18756E-5
22-17669242-G-A p.His356His synonymous CECR1 5 82130 6.08791E-5 41065 0 3.30546E-5
22-17669243-TG-T p.His356fs frameshift CECR1 1 82190 1.21669E-5 41095 0 NA
22-17669244-G-A p.His356Tyr missense CECR1 2 82276 2.43084E-5 41138 0 NA
22-17669245-G-T p.Phe355Leu missense CECR1 7 82308 8.50464E-5 41154 0 2.56101E-4
22-17669250-A-G p.Phe354Leu missense CECR1 2 82486 2.42465E-5 41243 0 3.18512E-5
22-17669258-A-T p.Leu351Gln missense CECR1 1 82568 1.21112E-5 41284 0 NA
22-17669265-C-T p.Val349Ile missense CECR1 199 82636 0.00240815 41318 1 0.00251762
22-17669277-C-T p.Ala345Thr missense CECR1 2 82772 2.41628E-5 41386 0 6.6012E-5
22-17669290-A-C p.Ala340Ala synonymous CECR1 1 82824 1.20738E-5 41412 0 NA
22-17669296-C-T p.Lys338Lys synonymous CECR1 1 82814 1.20753E-5 41407 0 NA
22-17669297-T-C p.Lys338Arg missense CECR1 6 82824 7.24428E-5 41412 0 6.25E-4
22-17669302-G-C p.Asp336Glu missense CECR1 1 82792 1.20785E-5 41396 0 NA
22-17669306-T-C p.His335Arg missense CECR1 29361 81362 0.360869 40681 5586 0.39577
22-17669306-TG-CA p.His335Cys missense CECR1 1 82734 1.20869E-5 41367 0 NA
22-17669325-C-T p.Asp329Asn missense CECR1 2 82550 2.42277E-5 41275 0 1.27405E-4
22-17669328-C-T p.Glu328Lys missense CECR1 1 82534 1.21162E-5 41267 0 NA
22-17669332-C-T p.Gly326Gly synonymous CECR1 1 82404 1.21353E-5 41202 0 NA
22-17669337-C-T p.Val325Met missense+splice_region CECR1 1 82272 1.21548E-5 41136 0 8.33014E-6
22-17669339-T-C c.973-2A>G splice_acceptor CECR1 10 82164 1.21708E-4 41082 0 1.91119E-4
22-17670840-AC-GA p.GlyPhe321GlyLeu missense CECR1 1 83262 1.20103E-5 41631 0 NA
22-17670849-C-A p.Val319Leu missense CECR1 1 83294 1.20057E-5 41647 0 NA
22-17670854-G-A p.Thr317Met missense CECR1 6 83304 7.20254E-5 41652 0 9.06454E-5
22-17670869-C-T p.Arg312Gln missense CECR1 1 83320 1.20019E-5 41660 0 3.57913E-5
22-17670870-G-A p.Arg312* stop_gained CECR1 2 83316 2.4005E-5 41658 0 3.18613E-5
22-17670877-C-T p.Met309Ile missense CECR1 225 83318 0.0027005 41659 3 0.0135952
22-17670878-A-G p.Met309Thr missense CECR1 1 83318 1.20022E-5 41659 0 3.18654E-5
22-17670887-C-T p.Arg306Gln missense CECR1 3 83296 3.60161E-5 41648 0 6.37227E-5
22-17670901-G-A p.Ile301Ile synonymous CECR1 1 83254 1.20114E-5 41627 0 1.27413E-4
22-17670915-C-A p.Asp297Tyr missense CECR1 6 83200 7.21154E-5 41600 0 1.59094E-5
22-17670927-GAGAC-G c.882-9_882-6delGTCT splice_region CECR1 1 83070 1.2038E-5 41535 0 8.25287E-6
22-17672567-T-A c.881+6A>T splice_region CECR1 1 83078 1.20369E-5 41539 0 1.99195E-5
22-17672581-C-T p.Ser291Ser synonymous CECR1 1 83262 1.20103E-5 41631 0 1.65317E-5
22-17672582-G-A p.Ser291Leu missense CECR1 2 83270 2.40183E-5 41635 0 3.18674E-5
22-17672590-G-T p.Ile288Ile synonymous CECR1 1 83306 1.20039E-5 41653 0 3.18593E-5
22-17672609-T-C p.Glu282Gly missense CECR1 1 83304 1.20042E-5 41652 0 NA
22-17672636-G-A p.Ala273Val missense CECR1 2 83284 2.40142E-5 41642 0 NA
22-17672641-T-C p.Glu271Glu synonymous CECR1 1 83274 1.20085E-5 41637 0 NA
22-17672655-T-G p.Lys267Gln missense CECR1 2 83264 2.402E-5 41632 0 NA
22-17672663-C-G p.Trp264Ser missense CECR1 1 83246 1.20126E-5 41623 0 NA
22-17672665-C-G p.Glu263Asp missense CECR1 1 83252 1.20117E-5 41626 0 NA
22-17672670-C-T p.Glu262Lys missense CECR1 2 83238 2.40275E-5 41619 0 8.26146E-6
22-17672671-G-A p.Asp261Asp synonymous CECR1 20 83236 2.40281E-4 41618 0 9.23979E-4
22-17672687-C-T p.Ser256Asn missense CECR1 1 83172 1.20233E-5 41586 0 NA
22-17672703-G-A c.754-3C>T splice_region CECR1 1 83050 1.20409E-5 41525 0 NA
22-17672705-G-A c.754-5C>T splice_region CECR1 1 83016 1.20459E-5 41508 0 8.32723E-5
22-17680435-C-G c.30+4G>C splice_region CECR1 1 83324 1.20013E-5 41662 0 3.22643E-5
22-17680439-C-G p.Leu10Leu splice_region+synonymous CECR1 1 83326 1.20011E-5 41663 0 NA
22-17680447-A-C p.Trp8Gly missense CECR1 2 83352 2.39946E-5 41676 0 NA
22-17680460-G-T p.Ser3Ser synonymous CECR1 2 83356 2.39935E-5 41678 0 3.18613E-5
22-17680460-G-C p.Ser3Ser synonymous CECR1 1 83356 1.19967E-5 41678 0 9.5584E-5
22-17680560-G-A c.-92C>T 5_prime_UTR_premature_start_codon_gain CECR1 4 82104 4.87187E-5 41052 0 NA
22-17680598-T-A c.-130A>T 5_prime_UTR_premature_start_codon_gain CECR1 1 79106 1.26413E-5 39553 0 NA
22-17680610-C-T c.-142G>A 5_prime_UTR_premature_start_codon_gain CECR1 1 77658 1.2877E-5 38829 0 NA
22-17680656-G-A c.-188C>T 5_prime_UTR_premature_start_codon_gain CECR1 2870 68150 0.042113 34075 20 0.0477124
22-17684446-G-A c.753+7C>T splice_region CECR1 1 81888 1.22118E-5 40944 0 4.18109E-5
22-17684453-C-T p.Pro251Pro splice_region+synonymous CECR1 3 82096 3.65426E-5 41048 0 3.18451E-5
22-17684453-C-A p.Pro251Pro splice_region+synonymous CECR1 1 82096 1.21809E-5 41048 0 3.98289E-6
22-17684454-G-A p.Pro251Leu missense+splice_region CECR1 12 82180 1.46021E-4 41090 0 0.00101317
22-17684465-G-A p.Ala247Ala synonymous CECR1 1 82528 1.21171E-5 41264 0 NA
22-17684466-G-A p.Ala247Val missense CECR1 8 82532 9.69321E-5 41266 0 0.00101215
22-17684468-T-C p.Arg246Arg synonymous CECR1 1 82594 1.21074E-5 41297 0 3.97934E-6
22-17684474-C-G p.Glu244Asp missense CECR1 1 82724 1.20884E-5 41362 0 NA
22-17684477-C-T p.Met243Ile missense CECR1 2 82782 2.41598E-5 41391 0 3.18451E-5
22-17684488-C-T p.Val240Met missense CECR1 1 82972 1.20523E-5 41486 0 3.18431E-5
22-17684489-G-A p.Asn239Asn synonymous CECR1 3 83030 3.61315E-5 41515 0 7.95608E-5
22-17684494-C-T p.Asp238Asn missense CECR1 1 83090 1.20351E-5 41545 0 NA
22-17684498-G-A p.Tyr236Tyr synonymous CECR1 10 83180 1.20221E-4 41590 0 2.55628E-4
22-17684504-C-T p.Glu234Glu synonymous CECR1 3 83214 3.60516E-5 41607 0 1.59236E-4
22-17684511-A-G p.Met232Thr missense CECR1 1 83252 1.20117E-5 41626 0 NA
22-17684517-C-T p.Arg230Gln missense CECR1 21 83274 2.5218E-4 41637 0 0.00125
22-17684519-G-A p.Phe229Phe synonymous CECR1 6 83286 7.20409E-5 41643 0 6.36821E-5
22-17684525-A-G p.Tyr227Tyr synonymous CECR1 1 83316 1.20025E-5 41658 0 3.97668E-6
22-17684527-A-G p.Tyr227His missense CECR1 1 83332 1.20002E-5 41666 0 NA
22-17684541-GGTGC-G p.Ala221fs frameshift CECR1 1 83346 1.19982E-5 41673 0 8.24131E-6
22-17684546-G-A p.Tyr220Tyr synonymous CECR1 191 83348 0.0022916 41674 0 0.0037254
22-17684564-G-T p.Ile214Ile synonymous CECR1 1 83368 1.1995E-5 41684 0 NA
22-17684565-A-G p.Ile214Thr missense CECR1 2 83366 2.39906E-5 41683 0 1.6487E-5
22-17684566-T-C p.Ile214Val missense CECR1 2 83366 2.39906E-5 41683 0 8.24334E-6
22-17684568-G-A p.Thr213Ile missense CECR1 1 83356 1.19967E-5 41678 0 6.36983E-5
22-17684571-A-G p.Phe212Ser missense CECR1 1 83350 1.19976E-5 41675 0 NA
22-17684586-A-C p.Phe207Cys missense CECR1 1 83362 1.19959E-5 41681 0 7.95406E-6
22-17684592-G-A p.Ser205Leu missense CECR1 3 83362 3.59876E-5 41681 0 5.78073E-5
22-17684598-A-G p.Val203Ala missense CECR1 1 83354 1.1997E-5 41677 0 NA
22-17684619-A-G p.Ile196Thr missense CECR1 4 83294 4.80227E-5 41647 0 2.51488E-5
22-17684627-C-T p.Pro193Pro synonymous CECR1 3 83250 3.6036E-5 41625 0 1.51284E-4
22-17684628-G-A p.Pro193Leu missense CECR1 2 83242 2.40263E-5 41621 0 4.25742E-5
22-17684636-G-T p.Thr190Thr synonymous CECR1 3 83212 3.60525E-5 41606 0 NA
22-17684643-A-G p.Leu188Pro missense CECR1 3 83164 3.60733E-5 41582 0 3.18492E-5
22-17684644-G-C p.Leu188Val missense CECR1 1 83160 1.2025E-5 41580 0 9.68532E-5
22-17684651-A-G p.Asn185Asn synonymous CECR1 2 83116 2.40628E-5 41558 0 3.59279E-5
22-17684663-G-A p.Ser181Ser splice_region+synonymous CECR1 1 82988 1.20499E-5 41494 0 6.70588E-5
22-17687948-AACTAC-A c.542+8_542+12delGTAGT splice_region CECR1 1 83304 1.20042E-5 41652 0 NA
22-17687954-T-C c.542+7A>G splice_region CECR1 67 83328 8.04051E-4 41664 0 0.00133741
22-17687954-T-TG c.542+6_542+7insC splice_region CECR1 1 83328 1.20008E-5 41664 0 NA
22-17687956-C-T c.542+5G>A splice_region CECR1 2 83334 2.39998E-5 41667 0 1.19551E-5
22-17687957-T-A c.542+4A>T splice_region CECR1 1 83332 1.20002E-5 41666 0 NA
22-17687962-T-C p.Ser181Gly missense+splice_region CECR1 1 83368 1.1995E-5 41684 0 NA
22-17687966-A-G p.Asp179Asp synonymous CECR1 1 83372 1.19944E-5 41686 0 6.36862E-5
22-17687976-G-T p.Thr176Asn missense CECR1 1 83384 1.19927E-5 41692 0 NA
22-17687976-G-C p.Thr176Ser missense CECR1 1 83384 1.19927E-5 41692 0 NA
22-17687980-C-T p.Val175Ile missense CECR1 2 83382 2.3986E-5 41691 0 8.26255E-6
22-17687981-G-A p.Asn174Asn synonymous CECR1 2 83388 2.39843E-5 41694 0 1.65117E-5
22-17687987-C-T p.Val172Val synonymous CECR1 1 83382 1.1993E-5 41691 0 3.97735E-6
22-17687991-C-T p.Arg171Gln missense CECR1 3 83394 3.59738E-5 41697 0 3.97719E-6
22-17687992-G-A p.Arg171Trp missense CECR1 168 83398 0.00201444 41699 0 0.00455385
22-17687997-C-T p.Arg169Gln missense CECR1 14 83404 1.67858E-4 41702 0 5.09489E-4
22-17688033-T-G p.Glu157Ala missense CECR1 1 83420 1.19875E-5 41710 0 1.64737E-5
22-17688042-C-T p.Arg154His missense CECR1 3 83416 3.59643E-5 41708 0 3.18512E-5
22-17688043-G-A p.Arg154Cys missense CECR1 4 83414 4.79536E-5 41707 0 8.35023E-5
22-17688048-G-C p.Thr152Ser missense+splice_region CECR1 2 83412 2.39774E-5 41706 0 NA
22-17688048-G-A p.Thr152Ile missense+splice_region CECR1 1 83412 1.19887E-5 41706 0 1.1929E-5
22-17688059-A-G p.Phe148Phe synonymous CECR1 2 83414 2.39768E-5 41707 0 3.18431E-5
22-17688065-G-T p.Phe146Leu missense CECR1 1 83414 1.19884E-5 41707 0 NA
22-17688072-A-G p.Met144Thr missense CECR1 2 83412 2.39774E-5 41706 0 3.97636E-6
22-17688077-C-A p.Gly142Gly synonymous CECR1 1 83398 1.19907E-5 41699 0 9.5435E-5
22-17688081-C-T p.Arg141Lys missense CECR1 1 83398 1.19907E-5 41699 0 8.23669E-6
22-17688083-T-G p.Pro140Pro synonymous CECR1 1 83388 1.19921E-5 41694 0 NA
22-17688089-G-A p.Phe138Phe synonymous CECR1 3 83380 3.59799E-5 41690 0 3.29468E-5
22-17688093-C-T p.Cys137Tyr missense CECR1 1 83376 1.19939E-5 41688 0 NA
22-17688111-C-A p.Arg131Met missense CECR1 1 83318 1.20022E-5 41659 0 NA
22-17688123-T-A p.Asn127Ile missense CECR1 1 83290 1.20062E-5 41645 0 1.19346E-5
22-17688124-T-G p.Asn127His missense CECR1 1 83270 1.20091E-5 41635 0 NA
22-17688126-C-T p.Arg126Lys missense CECR1 2 83286 2.40136E-5 41643 0 3.1837E-5
22-17688128-C-T p.Val125Val synonymous CECR1 1 83276 1.20083E-5 41638 0 3.18431E-5
22-17688131-C-G p.Leu124Leu synonymous CECR1 1 83314 1.20028E-5 41657 0 3.97817E-6
22-17688141-A-G p.Met121Thr missense CECR1 20 83292 2.40119E-4 41646 0 1.56686E-4
22-17688142-T-C p.Met121Val missense CECR1 1 83282 1.20074E-5 41641 0 2.38719E-5
22-17688144-G-A p.Thr120Ile missense CECR1 4 83288 4.80261E-5 41644 0 1.64967E-5
22-17688148-C-T p.Val119Met missense CECR1 1 83260 1.20106E-5 41630 0 3.18492E-5
22-17688149-G-A p.Ile118Ile synonymous CECR1 4 83244 4.80515E-5 41622 0 6.3674E-5
22-17688156-A-G p.Ile116Thr missense CECR1 1 83192 1.20204E-5 41596 0 NA
22-17688188-G-A c.323-8C>T splice_region CECR1 1 82408 1.21347E-5 41204 0 8.43227E-6
22-17690252-G-A p.Pro106Ser missense CECR1 1 83260 1.20106E-5 41630 0 1.99341E-5
22-17690268-A-G p.Asn100Asn synonymous CECR1 2 83332 2.40004E-5 41666 0 8.25668E-6
22-17690270-T-A p.Asn100Tyr missense CECR1 1 83354 1.1997E-5 41677 0 3.97937E-6
22-17690275-A-C p.Val98Gly missense CECR1 1 83360 1.19962E-5 41680 0 NA
22-17690290-A-G p.Ile93Thr missense CECR1 4 83376 4.79754E-5 41688 0 2.38646E-5
22-17690296-T-C p.His91Arg missense CECR1 13 83380 1.55913E-4 41690 0 7.4162E-5
22-17690317-A-G p.Met84Thr missense CECR1 2 83380 2.39866E-5 41690 0 3.97703E-6
22-17690318-T-C p.Met84Val missense CECR1 12 83380 1.43919E-4 41690 0 5.09554E-4
22-17690351-C-T p.Glu73Lys missense CECR1 1 83358 1.19964E-5 41679 0 NA
22-17690353-T-C p.Lys72Arg missense CECR1 2 83356 2.39935E-5 41678 0 8.23805E-6
22-17690363-C-T p.Ala69Thr missense CECR1 3 83346 3.59945E-5 41673 0 0.00125
22-17690364-G-A p.Ile68Ile synonymous CECR1 1 83344 1.19985E-5 41672 0 NA
22-17690373-C-T p.Thr65Thr synonymous CECR1 3 83338 3.5998E-5 41669 0 3.97722E-6
22-17690374-G-A p.Thr65Met missense CECR1 101 83334 0.00121199 41667 0 6.76122E-4
22-17690378-T-C p.Met64Val missense CECR1 1 83328 1.20008E-5 41664 0 4.94332E-5
22-17690389-T-C p.Asn60Ser missense CECR1 6 83318 7.20133E-5 41659 0 3.97706E-6
22-17690392-G-A p.Ala59Val missense CECR1 2 83296 2.40108E-5 41648 0 NA
22-17690399-C-T p.Glu57Lys missense CECR1 1 83306 1.20039E-5 41653 0 NA
22-17690404-T-C p.Lys55Arg missense CECR1 1 83304 1.20042E-5 41652 0 8.23981E-6
22-17690409-G-A p.Asn53Asn synonymous CECR1 39575 82974 0.476957 41487 9812 0.453125
22-17690421-C-T p.Arg49Arg synonymous CECR1 17 83278 2.04136E-4 41639 0 3.18613E-4
22-17690423-GC-G p.Arg49fs frameshift CECR1 3 83268 3.60282E-5 41634 0 4.95851E-5
22-17690423-G-GC p.Arg49fs frameshift CECR1 8 83250 9.60961E-5 41625 0 2.39662E-4
22-17690423-G-A p.Arg49Trp missense CECR1 22 83270 2.64201E-4 41635 0 1.15578E-4
22-17690425-C-T p.Gly48Glu missense CECR1 5 83296 6.00269E-5 41648 0 1.59266E-4
22-17690425-C-A p.Gly48Val missense CECR1 1 83296 1.20054E-5 41648 0 4.94845E-5
22-17690428-C-G p.Gly47Ala missense CECR1 9 83304 1.08038E-4 41652 0 6.37227E-5
22-17690428-C-A p.Gly47Val missense CECR1 3 83304 3.60127E-5 41652 0 6.59587E-5
22-17690429-C-G p.Gly47Arg missense CECR1 1 83310 1.20034E-5 41655 0 2.3873E-5
22-17690429-C-T p.Gly47Arg missense CECR1 11 83310 1.32037E-4 41655 0 1.07428E-4
22-17690430-C-G p.Leu46Leu synonymous CECR1 9539 83104 0.114784 41552 632 0.165
22-17690430-C-A p.Leu46Leu synonymous CECR1 1 83294 1.20057E-5 41647 0 1.5918E-5
22-17690434-C-T p.Arg45Gln missense CECR1 4 83292 4.80238E-5 41646 0 8.75246E-5
22-17690435-G-A p.Arg45Trp missense CECR1 4 83286 4.80273E-5 41643 0 6.37308E-5
22-17690442-C-A p.Lys42Asn missense CECR1 1 83292 1.2006E-5 41646 0 NA
22-17690464-G-A p.Ala35Val missense CECR1 9 83204 1.08168E-4 41602 0 9.55597E-5
22-17690466-C-T p.Arg34Arg synonymous CECR1 1 83196 1.20198E-5 41598 0 8.25478E-6
22-17690467-C-T p.Arg34Gln missense CECR1 1 83192 1.20204E-5 41596 0 NA
22-17690489-C-T c.-47-1G>A splice_acceptor CECR1 5 83056 6.02003E-5 41528 0 1.99154E-5
22-17690489-C-A c.-47-1G>T splice_acceptor CECR1 4 83056 4.81603E-5 41528 0 3.18512E-5
22-17690495-C-A p.Gly25Cys missense CECR1 2 82962 2.41074E-5 41481 0 1.65557E-5
22-17690496-G-A c.-47-8C>T splice_region CECR1 3 82952 3.61655E-5 41476 0 0.00100705
22-17690505-C-G p.Met21Ile missense CECR1 1 82842 1.20712E-5 41421 0 3.98705E-6
22-17690522-G-A p.Leu16Leu synonymous CECR1 4 82546 4.84578E-5 41273 0 9.9827E-5
22-17690528-A-G p.Phe14Leu missense CECR1 1 82426 1.21321E-5 41213 0 NA
22-17690536-G-A p.Ala11Val missense CECR1 7 82004 8.53617E-5 41002 0 3.3479E-5
22-17690553-G-A p.Gly5Gly synonymous CECR1 6 80918 7.41491E-5 40459 0 3.18471E-5
22-17690558-C-T p.Asp4Asn missense CECR1 7 80646 8.67991E-5 40323 0 9.43461E-5
22-17690558-C-A p.Asp4Tyr missense CECR1 1 80648 1.23996E-5 40324 0 NA
22-17690574-G-C c.-7C>G splice_region CECR1 8 78520 1.01885E-4 39260 0 1.43074E-4
22-17690584-G-A c.-13-4C>T splice_region CECR1 1 77256 1.2944E-5 38628 0 4.16865E-6
22-17690596-G-A c.-29C>T 5_prime_UTR_premature_start_codon_gain CECR1 2 74394 2.68839E-5 37197 0 9.45573E-6
22-17690609-C-A c.-42G>T 5_prime_UTR_premature_start_codon_gain CECR1 5 70126 7.13002E-5 35063 0 1.40721E-5
22-17690610-G-A c.-43C>T 5_prime_UTR_premature_start_codon_gain CECR1 6 69712 8.60684E-5 34856 0 2.64841E-4
22-17700207-AACCTCATCATCCCACAGCTCCCAAAGGACCCCAGTTAC-A c.-47+1_-47+38delGTAACTGGGGTCCTTTGGGAGCTGTGGGATGATGAGGT splice_donor CECR1 2 20 0.1 10 0 NA
22-17702858-C-T c.-250G>A 5_prime_UTR_premature_start_codon_gain CECR1 1 8 0.125 4 0 0.16536