Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
3-52009172-C-T c.-125C>T 5_prime_UTR_premature_start_codon_gain ACY1 2 34552 5.78838E-5 17276 0 NA
3-52009185-C-T c.-112C>T 5_prime_UTR_premature_start_codon_gain ACY1 1 34388 2.90799E-5 17194 0 NA
3-52009219-C-G c.-78C>G splice_region ACY1 3 33212 9.03288E-5 16606 0 9.59447E-5
3-52009227-C-G c.-77+7C>G splice_region ACY1 18 32810 5.48613E-4 16405 0 9.2711E-4
3-52011879-C-T c.-76-8C>T splice_region ACY1 3843 77910 0.0493261 38955 195 0.0891708
3-52011965-G-GT p.Trp2fs frameshift ACY1 1 82694 1.20928E-5 41347 0 NA
3-52011978-G-A p.Ala6Thr missense ACY1 2 82676 2.41908E-5 41338 0 1.1944E-5
3-52011981-C-A p.Pro7Thr missense ACY1 4 82698 4.83688E-5 41349 0 2.54858E-4
3-52011983-C-G p.Pro7Pro synonymous ACY1 1 82716 1.20896E-5 41358 0 NA
3-52011983-C-T p.Pro7Pro synonymous ACY1 1 82716 1.20896E-5 41358 0 NA
3-52011999-G-A p.Ala13Thr missense ACY1 2 82760 2.41663E-5 41380 0 3.9801E-6
3-52012000-C-G p.Ala13Gly missense ACY1 3026 82674 0.0366016 41337 279 0.0752342
3-52012001-C-T p.Ala13Ala synonymous ACY1 1 82758 1.20834E-5 41379 0 3.97997E-6
3-52012004-TG-T p.Glu16fs frameshift ACY1 1 82774 1.20811E-5 41387 0 NA
3-52012007-G-A p.Gly15Gly synonymous ACY1 1 82756 1.20837E-5 41378 0 1.19403E-5
3-52012017-A-G p.Met19Val missense ACY1 1 82722 1.20887E-5 41361 0 4.14175E-5
3-52012024-A-G p.Gln21Arg missense ACY1 8 82752 9.66744E-5 41376 0 9.55901E-5
3-52012030-G-C p.Trp23Ser missense ACY1 1 82730 1.20875E-5 41365 0 NA
3-52012036-T-C p.Val25Ala missense ACY1 1 82682 1.20945E-5 41341 0 3.18695E-5
3-52012040-A-T p.Ser26Ser synonymous ACY1 2 82672 2.4192E-5 41336 0 8.31836E-6
3-52012048-C-A p.Ala29Glu missense ACY1 1 82662 1.20975E-5 41331 0 NA
3-52012053-C-T p.Arg31Cys missense ACY1 6 82662 7.25847E-5 41331 0 4.38366E-5
3-52012054-G-A p.Arg31His missense ACY1 6 82634 7.26093E-5 41317 0 9.16671E-5
3-52012068-G-T p.Ala36Ser missense ACY1 1 82588 1.21083E-5 41294 0 NA
3-52012069-C-T p.Ala36Val missense ACY1 3 82578 3.63293E-5 41289 0 3.18512E-5
3-52012070-G-A p.Ala36Ala synonymous ACY1 2 82610 2.42101E-5 41305 0 2.22958E-4
3-52012087-C-G p.Thr42Ser missense ACY1 1 82582 1.21092E-5 41291 0 3.1841E-5
3-52012105-G-A c.136+7G>A splice_region ACY1 8 82402 9.7085E-5 41201 0 6.24714E-5
3-52012271-G-A c.137-4G>A splice_region ACY1 2 82284 2.43061E-5 41142 0 6.3168E-6
3-52012281-G-A p.Arg48Lys missense ACY1 1 82312 1.21489E-5 41156 0 NA
3-52012283-T-C p.Trp49Arg missense ACY1 5 82294 6.07578E-5 41147 0 7.56001E-5
3-52012291-C-T p.Cys51Cys synonymous ACY1 1 82298 1.2151E-5 41149 0 3.18471E-5
3-52012297-G-T p.Met53Ile missense ACY1 1 82310 1.21492E-5 41155 0 NA
3-52012298-G-T p.Glu54* stop_gained ACY1 1 82318 1.2148E-5 41159 0 3.18613E-5
3-52012313-C-A p.Leu59Ile missense ACY1 2 82242 2.43185E-5 41121 0 6.28607E-6
3-52012314-T-C p.Leu59Pro missense ACY1 4 82236 4.86405E-5 41118 0 1.63413E-4
3-52012319-C-T p.Arg61Cys missense ACY1 1 82192 1.21666E-5 41096 0 4.46987E-5
3-52012320-G-A p.Arg61His missense ACY1 1715 82140 0.020879 41070 20 0.0186353
3-52012325-A-T p.Ser63Cys missense ACY1 1 82126 1.21764E-5 41063 0 NA
3-52012326-G-T p.Ser63Ile missense ACY1 11 82134 1.33927E-4 41067 0 2.23015E-4
3-52012334-G-A p.Ala66Thr missense ACY1 1 81998 1.21954E-5 40999 0 3.18634E-5
3-52012354-C-T p.His72His synonymous ACY1 4 81810 4.88938E-5 40905 0 NA
3-52012357-A-G p.Arg73Arg synonymous ACY1 1 81752 1.22321E-5 40876 0 6.30756E-6
3-52012360-G-A p.Gly74Gly synonymous ACY1 1 81692 1.22411E-5 40846 0 NA
3-52012366-C-T p.Thr76Thr synonymous ACY1 2 81528 2.45314E-5 40764 0 4.6516E-5
3-52012371-C-T p.Pro78Leu missense ACY1 1 81440 1.2279E-5 40720 0 4.67421E-5
3-52012372-G-A p.Pro78Pro synonymous ACY1 8 81428 9.82463E-5 40714 0 9.36944E-5
3-52012391-G-A c.252+1G>A splice_donor ACY1 1 80974 1.23496E-5 40487 0 NA
3-52012392-T-TTTTGGGAACTCGGCACCTTCAAAGGAGGCAAGCACA c.252+2_252+3insTTTGGGAACTCGGCACCTTCAAAGGAGGCAAGCACA splice_region ACY1 1 80910 1.23594E-5 40455 0 NA
3-52012392-T-TTTTGGGAACTCGGCACCTTCAAAGGAGGCAAGCACAGAGGCAGGGCG c.252+2_252+3insTTTGGGAACTCGGCACCTTCAAAGGAGGCAAGCACAGAGGCAGGGCG splice_region ACY1 1 80908 1.23597E-5 40454 0 NA
3-52012393-G-T c.252+3G>T splice_region ACY1 1 80888 1.23628E-5 40444 0 NA
3-52012398-C-A c.252+8C>A splice_region ACY1 1 80662 1.23974E-5 40331 0 NA
3-52018062-G-A c.-18-1G>A splice_acceptor ACY1 1 82562 1.21121E-5 41281 0 8.32071E-6
3-52018071-G-A p.Thr87Thr synonymous ACY1 1 82632 1.21018E-5 41316 0 1.66265E-5
3-52018072-C-T p.Arg88Cys missense ACY1 2 82642 2.42008E-5 41321 0 1.99684E-5
3-52018077-C-T p.Ser89Ser synonymous ACY1 1 82654 1.20986E-5 41327 0 NA
3-52018081-A-G p.Met1? start_lost ACY1 1 82704 1.20913E-5 41352 0 NA
3-52018098-C-G p.Pro6Pro synonymous ACY1 2 82650 2.41984E-5 41325 0 NA
3-52018099-G-C p.Glu7Gln missense ACY1 1 82710 1.20904E-5 41355 0 5.03525E-4
3-52018107-G-A p.Glu9Glu synonymous ACY1 1 82608 1.21054E-5 41304 0 NA
3-52018111-C-G p.Pro11Ala missense ACY1 1 82592 1.21077E-5 41296 0 3.18613E-5
3-52018128-C-T p.Phe16Phe synonymous ACY1 15 82280 1.82304E-4 41140 0 6.25E-4
3-52018130-G-A p.Arg17His missense ACY1 1 82186 1.21675E-5 41093 0 6.37064E-5
3-52018134-G-C p.Gln18His missense ACY1 1 82154 1.21723E-5 41077 0 NA
3-52018138-C-G p.Leu20Val missense ACY1 8 82064 9.74849E-5 41032 0 7.4995E-5
3-52018141-C-T p.Arg21Cys missense ACY1 1 81962 1.22008E-5 40981 0 NA
3-52018148-G-A p.Arg23His missense ACY1 1 81642 1.22486E-5 40821 0 3.99584E-6
3-52018148-G-C p.Arg23Pro missense ACY1 1 81642 1.22486E-5 40821 0 NA
3-52018149-C-G p.Arg23Arg synonymous ACY1 469 81596 0.00574783 40798 7 0.0221774
3-52018153-G-A p.Val25Ile missense ACY1 2 81366 2.45803E-5 40683 0 NA
3-52018160-C-T p.Pro27Leu missense ACY1 1 80900 1.23609E-5 40450 0 NA
3-52018161-C-G p.Pro27Pro synonymous ACY1 364 80850 0.00450216 40425 3 0.004375
3-52018171-T-A p.Tyr31Asn missense ACY1 2 80002 2.49994E-5 40001 0 1.20154E-5
3-52018174-G-C p.Gly32Arg missense+splice_region ACY1 2 79670 2.51036E-5 39835 1 4.00943E-6
3-52018175-G-GAGCTGCTGTGGCTTTCTT c.94+1_94+2insAGCTGCTGTGGCTTTCTT splice_donor ACY1 3 79556 3.77093E-5 39778 0 NA
3-52019217-C-T c.95-6C>T splice_region ACY1 1 81562 1.22606E-5 40781 0 4.36887E-6
3-52019245-G-C p.Glu39Asp missense ACY1 3 82410 3.64033E-5 41205 0 NA
3-52019256-G-A p.Arg43His missense ACY1 1 82474 1.2125E-5 41237 0 1.91217E-4
3-52019256-G-T p.Arg43Leu missense ACY1 1 82474 1.2125E-5 41237 0 3.83828E-5
3-52019263-G-C p.Leu45Leu synonymous ACY1 6 82534 7.26973E-5 41267 0 9.36907E-4
3-52019277-A-G p.Gln50Arg missense ACY1 2 82626 2.42055E-5 41313 0 4.15521E-6
3-52019285-GAGGTGAGCCTGGGGCCCTAAGCGGGGAAGGGAGGTGGGCCTGGGCACTTCCTCACCCTGCTCAGACCACCTACCCTCCTGACCATCTCC-G p.Glu53fs frameshift ACY1 8 82670 9.67703E-5 41335 1 NA
3-52019285-G-C p.Glu53Gln missense+splice_region ACY1 1 82670 1.20963E-5 41335 0 NA
3-52019292-G-A c.159+5G>A splice_region ACY1 1 82660 1.20978E-5 41330 0 1.64449E-5
3-52019346-T-C c.160-4T>C splice_region ACY1 1 82922 1.20595E-5 41461 0 7.97467E-6
3-52019356-T-A p.Tyr56Asn missense ACY1 1 82994 1.20491E-5 41497 0 NA
3-52019363-C-G p.Pro58Arg missense ACY1 4 83012 4.81858E-5 41506 0 1.66937E-5
3-52019365-G-T p.Asp59Tyr missense ACY1 1 83028 1.20441E-5 41514 0 NA
3-52019377-G-A p.Val54Met missense+splice_region ACY1 1 83062 1.20392E-5 41531 0 3.97972E-6
3-52019383-C-A p.Pro56Thr missense ACY1 2 83078 2.40738E-5 41539 0 NA
3-52019397-G-A p.Val60Val synonymous ACY1 1 83132 1.20291E-5 41566 0 3.18573E-5
3-52019400-C-T p.Thr61Thr synonymous ACY1 2 83114 2.40633E-5 41557 0 3.58075E-5
3-52019401-G-A p.Val62Met missense ACY1 2 83136 2.4057E-5 41568 0 3.18613E-5
3-52019427-T-G p.Pro70Pro synonymous ACY1 1 83114 1.20317E-5 41557 0 2.78474E-5
3-52019427-T-A p.Pro70Pro synonymous ACY1 2 83114 2.40633E-5 41557 0 1.19346E-5
3-52019459-C-T p.Thr81Met missense ACY1 5 82856 6.03457E-5 41428 1 0.00100705
3-52019460-G-A p.Thr81Thr synonymous ACY1 1 82828 1.20732E-5 41414 0 1.19463E-5
3-52019471-C-A p.Pro85His missense ACY1 1 82600 1.21065E-5 41300 0 3.98473E-6
3-52019482-G-GAACATTGGAGTCACGACCCCTT c.264+1_264+2insAACATTGGAGTCACGACCCCTT splice_donor ACY1 4 82276 4.86169E-5 41138 1 NA
3-52019482-G-GAACATTGGAGTCACGACCCCTTTGAGGCCT c.264+1_264+2insAACATTGGAGTCACGACCCCTTTGAGGCCT splice_donor ACY1 1 82276 1.21542E-5 41138 0 NA
3-52019861-C-T c.265-7C>T splice_region ACY1 38 82610 4.59993E-4 41305 0 0.004375
3-52019879-T-G p.Ser92Arg missense ACY1 2 82786 2.41587E-5 41393 0 4.00179E-6
3-52019882-C-T p.His93His synonymous ACY1 5 82826 6.03675E-5 41413 0 4.00118E-5
3-52019883-G-A p.Asp94Asn missense ACY1 2 82836 2.41441E-5 41418 0 6.37349E-5
3-52019910-G-C p.Glu103Gln missense ACY1 1 82910 1.20613E-5 41455 0 1.85694E-5
3-52019911-A-G p.Glu103Gly missense+splice_region ACY1 2 82914 2.41214E-5 41457 0 6.37064E-5
3-52019914-G-A c.310+1G>A splice_donor ACY1 4 82898 4.82521E-5 41449 0 1.87157E-5
3-52019921-C-T c.310+8C>T splice_region ACY1 3 82924 3.61777E-5 41462 0 NA
3-52019928-A-G p.Arg109Gly missense ACY1 6 82874 7.23991E-5 41437 0 1.85373E-4
3-52019930-G-A p.Arg109Arg synonymous ACY1 3 82862 3.62048E-5 41431 0 1.20645E-5
3-52019935-C-T p.Ala111Val missense ACY1 31 82838 3.74224E-4 41419 0 7.32811E-4
3-52019942-C-T p.Asp113Asp synonymous ACY1 1 82806 1.20764E-5 41403 0 NA
3-52019945-G-C p.Met114Ile missense ACY1 1 82796 1.20779E-5 41398 0 8.08819E-6
3-52019948-G-A p.Lys115Lys synonymous ACY1 3 82768 3.62459E-5 41384 0 NA
3-52019950-G-A p.Cys116Tyr missense ACY1 2 82724 2.41768E-5 41362 0 1.21806E-5
3-52019951-C-T p.Cys116Cys synonymous ACY1 1 82708 1.20907E-5 41354 0 1.22152E-5
3-52019952-G-A p.Val117Ile missense ACY1 4 82700 4.83676E-5 41350 0 1.22089E-5
3-52019956-G-C p.Ser118Thr missense ACY1 4 82680 4.83793E-5 41340 0 5.04032E-4
3-52019964-T-TACCTGGAAGCTGTGAGGAGGCTGAAGGTG c.359+2_359+3insACCTGGAAGCTGTGAGGAGGCTGAAGGTG splice_region ACY1 3 82658 3.62941E-5 41329 0 NA
3-52019964-T-TACCTGGAAGCTGTGAGGAGGCTGAAGGTGGAGGGCCACCGGTTCCCCA c.359+2_359+3insACCTGGAAGCTGTGAGGAGGCTGAAGGTGGAGGGCCACCGGTTCCCCA splice_region ACY1 1 82660 1.20978E-5 41330 0 NA
3-52020268-C-G c.360-3C>G splice_region ACY1 1 82556 1.2113E-5 41278 0 NA
3-52020273-A-G p.Tyr121Cys missense+splice_region ACY1 1 82592 1.21077E-5 41296 0 NA
3-52020295-G-T n.652G>T splice_region ACY1 78 82910 9.40779E-4 41455 0 8.41878E-4
3-52020311-C-T p.Arg134Trp missense ACY1 3 82930 3.61751E-5 41465 0 1.9921E-4
3-52020312-G-A p.Arg134Gln missense ACY1 1 82928 1.20587E-5 41464 0 3.19652E-5
3-52020332-A-G p.Met141Val missense ACY1 1 82920 1.20598E-5 41460 0 1.68084E-5
3-52020346-TGGTAGGAGTGGCTCAGATACCTTTGGGAAAGGGGAGGGTGGGGCGGGGCAGCCTCCTCATCTCACGTCCCTGCTGCTTTTACA-T p.Asp146fs frameshift ACY1 7 82792 8.45492E-5 41396 1 NA
3-52020432-TGAG-T p.Glu148del disruptive_inframe_deletion ACY1 1 82786 1.20793E-5 41393 0 NA
3-52020436-G-A p.Glu148Lys missense ACY1 1 82840 1.20715E-5 41420 0 8.28288E-6
3-52020443-G-C p.Gly150Ala missense ACY1 1 82904 1.20621E-5 41452 0 NA
3-52020446-G-T p.Gly151Val missense ACY1 1 82910 1.20613E-5 41455 0 NA
3-52020454-G-T p.Gly154Cys missense ACY1 1 82976 1.20517E-5 41488 0 NA
3-52020459-GG-AA p.MetGlu155IleLys missense ACY1 6 83048 7.22474E-5 41524 0 NA
3-52020459-G-A p.Met155Ile missense ACY1 3 83048 3.61237E-5 41524 0 0.00151057
3-52020460-G-A p.Glu156Lys missense ACY1 3 83042 3.61263E-5 41521 0 9.55901E-5
3-52020468-C-T p.Phe158Phe synonymous ACY1 1 83080 1.20366E-5 41540 0 9.08992E-6
3-52020469-G-A p.Val159Met missense ACY1 1 83086 1.20357E-5 41543 0 7.21917E-5
3-52020473-A-AGCGGCCTGAGTTCC p.His165fs frameshift ACY1 19 83112 2.28607E-4 41556 0 1.59388E-4
3-52020475-C-T p.Arg161Trp missense ACY1 1 83106 1.20328E-5 41553 0 2.40362E-5
3-52020476-G-A p.Arg161Gln missense ACY1 2 83132 2.40581E-5 41566 0 3.59991E-5
3-52020478-C-G p.Pro162Ala missense ACY1 2 83142 2.40552E-5 41571 0 3.99645E-5
3-52020489-C-T p.His165His synonymous ACY1 1 83198 1.20195E-5 41599 0 7.97995E-6
3-52020490-G-A p.Ala166Thr missense ACY1 2 83196 2.40396E-5 41598 0 3.18776E-5
3-52020508-GC-G p.Leu173fs frameshift ACY1 2 83210 2.40356E-5 41605 0 3.18735E-5
3-52020508-G-C p.Ala172Pro missense ACY1 4 83210 4.80711E-5 41605 0 2.3889E-5
3-52020510-C-A p.Ala172Ala synonymous ACY1 2 83222 2.40321E-5 41611 0 5.03525E-4
3-52020515-A-G p.Asp174Gly missense ACY1 2 83234 2.40286E-5 41617 0 3.18898E-5
3-52020519-GGGTGAGCAGGTTGGCAAGCCAATGAGCAGCCAGGCAGGGAGTAGGAGGCTGCTAGTGGGGACTGAGCTGCTCCACCCTCTGAACCCCCTTTCCCTCCTCA-G p.Gly176fs frameshift ACY1 7 83256 8.4078E-5 41628 0 NA
3-52020523-G-A c.526+3G>A splice_region ACY1 1 83206 1.20184E-5 41603 0 NA
3-52020615-C-T c.527-6C>T splice_region ACY1 1 83168 1.20239E-5 41584 0 NA
3-52020623-A-G p.Ile177Val missense+splice_region ACY1 1 83186 1.20213E-5 41593 0 8.23669E-5
3-52020630-A-G p.Asn179Ser missense ACY1 378 83172 0.0045448 41586 2 0.00883122
3-52020631-T-C p.Asn179Asn synonymous ACY1 2 83194 2.40402E-5 41597 0 2.23058E-4
3-52020638-G-A p.Asp182Asn missense ACY1 2 83190 2.40414E-5 41595 0 8.23669E-6
3-52020642-C-A p.Ala183Asp missense ACY1 1 83194 1.20201E-5 41597 0 NA
3-52020647-A-G p.Thr185Ala missense ACY1 1 83206 1.20184E-5 41603 0 6.3743E-5
3-52020652-CTT-C p.Phe187fs frameshift ACY1 7 83204 8.41306E-5 41602 0 0.00151057
3-52020653-T-C p.Phe187Leu missense ACY1 2 83212 2.4035E-5 41606 0 NA
3-52020655-T-C p.Phe187Phe synonymous ACY1 1 83208 1.20181E-5 41604 0 8.23683E-6
3-52020660-G-C p.Ser189Thr missense ACY1 1 83214 1.20172E-5 41607 0 3.18796E-5
3-52020664-G-A p.Glu190Glu synonymous ACY1 2 83198 2.4039E-5 41599 0 NA
3-52020665-C-T p.Arg191Trp missense ACY1 2 83186 2.40425E-5 41593 0 1.6475E-5
3-52020668-A-AG p.Ser192fs frameshift ACY1 24 83172 2.88559E-4 41586 0 0.00100705
3-52020673-C-T p.Pro193Pro synonymous ACY1 1 83180 1.20221E-5 41590 0 NA
3-52021004-G-A p.Trp195* stop_gained ACY1 1 82460 1.21271E-5 41230 0 8.41255E-6
3-52021006-G-T p.Val196Leu missense+splice_region ACY1 1 82504 1.21206E-5 41252 0 NA
3-52021007-T-C p.Val196Ala missense ACY1 1 82494 1.21221E-5 41247 0 3.35537E-5
3-52021010-G-A p.Arg197Gln missense ACY1 20 82652 2.41978E-4 41326 0 2.55346E-4
3-52021010-G-C p.Arg197Pro missense ACY1 1 82654 1.20986E-5 41327 0 NA
3-52021016-CCAG-C p.Ser200del disruptive_inframe_deletion ACY1 1 82782 1.20799E-5 41391 0 1.66575E-5
3-52021030-C-T p.Pro204Ser missense ACY1 2 82946 2.41121E-5 41473 0 3.97962E-6
3-52021035-C-T p.Gly205Gly synonymous ACY1 1 82970 1.20525E-5 41485 0 8.28377E-6
3-52021040-C-T p.Ala207Val missense ACY1 1 83014 1.20462E-5 41507 0 7.95691E-6
3-52021045-C-T p.Arg209Cys missense ACY1 31 83032 3.7335E-4 41516 0 6.25E-4
3-52021059-C-T p.Asp213Asp synonymous ACY1 3 83098 3.6102E-5 41549 0 NA
3-52021069-G-A p.Glu217Lys missense ACY1 1 83116 1.20314E-5 41558 0 8.25709E-6
3-52021074-G-A p.Lys218Lys synonymous ACY1 2 83120 2.40616E-5 41560 0 1.19324E-5
3-52021076-TGGTACGTGGCACCCCAGGAGGGAGTCTGGGAGTTCAGGAGGCTCTATCCTGAGGCCACTGTCCCATTTAACCTCATATTCTCATA-T p.His220fs frameshift ACY1 7 83124 8.42115E-5 41562 1 NA
3-52021081-C-G c.657+4C>G splice_region ACY1 2 83116 2.40628E-5 41558 0 NA
3-52021085-G-A c.657+8G>A splice_region ACY1 1 83128 1.20296E-5 41564 0 3.97731E-6
3-52021158-C-T c.658-5C>T splice_region ACY1 1 83260 1.20106E-5 41630 0 NA
3-52021159-A-G c.658-4A>G splice_region ACY1 1 83258 1.20109E-5 41629 0 NA
3-52021166-A-C p.Lys221Gln missense ACY1 1 83274 1.20085E-5 41637 0 NA
3-52021166-A-T p.Lys221* stop_gained ACY1 1 83274 1.20085E-5 41637 0 NA
3-52021169-G-T p.Val222Phe missense ACY1 1 83256 1.20111E-5 41628 0 NA
3-52021179-C-T p.Ser225Phe missense ACY1 2 83266 2.40194E-5 41633 0 NA
3-52021187-G-A p.Ala228Thr missense ACY1 2 83246 2.40252E-5 41623 0 1.6481E-5
3-52021194-G-A p.Arg230Gln missense ACY1 4 83236 4.80561E-5 41618 0 6.25E-4
3-52021195-G-C p.Arg230Arg synonymous ACY1 1 83232 1.20146E-5 41616 0 NA
3-52021198-G-A p.Glu231Glu synonymous ACY1 1 83238 1.20137E-5 41619 0 NA
3-52021204-A-C p.Glu233Asp missense ACY1 11 83228 1.32167E-4 41614 0 9.5451E-5
3-52021331-G-A p.Ser197Asn missense ACY1 1 82212 1.21637E-5 41106 0 NA
3-52021340-C-T p.Pro200Leu missense ACY1 2 82330 2.42925E-5 41165 0 3.30109E-5
3-52021348-AAG-A p.Glu245fs frameshift ACY1 2 82464 2.4253E-5 41232 0 NA
3-52021355-G-T p.Gly246Gly synonymous ACY1 1 82502 1.21209E-5 41251 0 3.18634E-5
3-52021358-C-T p.Ser247Ser synonymous ACY1 1 82504 1.21206E-5 41252 0 2.4766E-5
3-52021358-C-G p.Ser247Ser synonymous ACY1 1 82504 1.21206E-5 41252 0 5.03525E-4
3-52021359-G-A p.Val248Met missense ACY1 1 82522 1.2118E-5 41261 0 3.98251E-6
3-52021367-C-T p.Ser250Ser synonymous ACY1 2 82644 2.42002E-5 41322 0 2.47684E-5
3-52021368-G-A p.Val251Met missense ACY1 2 82666 2.41937E-5 41333 0 1.59388E-4
3-52021373-CCTGA-C p.Thr254fs frameshift ACY1 4 82794 4.83127E-5 41397 0 3.18573E-5
3-52021387-A-G p.Glu257Gly missense ACY1 1 82908 1.20616E-5 41454 0 8.25682E-6
3-52021394-C-T p.Gly259Gly synonymous ACY1 8 82912 9.64878E-5 41456 0 9.90867E-5
3-52021395-G-A p.Val260Met missense ACY1 5 82956 6.02729E-5 41478 0 4.77525E-5
3-52021402-A-G p.Tyr262Cys missense ACY1 1 83008 1.2047E-5 41504 0 2.47709E-5
3-52021407-G-T p.Val264Leu missense ACY1 1 83024 1.20447E-5 41512 0 NA
3-52021413-C-A p.Pro266Thr missense ACY1 2 83028 2.40883E-5 41514 0 8.25709E-6
3-52021422-A-G p.Met269Val missense ACY1 24 83068 2.8892E-4 41534 0 3.3816E-4
3-52021425-A-G p.Ser270Gly missense ACY1 1 83062 1.20392E-5 41531 0 NA
3-52021428-G-A p.Ala271Thr missense ACY1 5 83064 6.01946E-5 41532 0 2.78487E-5
3-52021444-G-A p.Arg276His missense ACY1 2 83052 2.40813E-5 41526 0 1.1937E-5
3-52021446-G-A p.Val277Met missense ACY1 1 83044 1.20418E-5 41522 0 1.19371E-5
3-52021452-C-G p.Pro279Ala missense ACY1 3 83068 3.6115E-5 41534 0 6.37024E-5
3-52021453-C-T p.Pro279Leu missense ACY1 2 83054 2.40807E-5 41527 0 1.07554E-4
3-52021454-G-A p.Pro279Pro synonymous ACY1 3 83058 3.61193E-5 41529 0 3.18532E-5
3-52021456-A-C p.Asp280Ala missense ACY1 3 83058 3.61193E-5 41529 0 1.59155E-5
3-52021461-G-A p.Asp282Asn missense ACY1 3 83044 3.61254E-5 41522 0 7.9595E-6
3-52021462-A-G p.Asp282Gly missense ACY1 1 83032 1.20435E-5 41516 0 NA
3-52021467-AAGGTGCCACCTCCACCTGGGTTTGGAGGAGGGATCCTGGGTCCTCAGTCTTGTCCTAGAGGCCTCTGGAAAGCCTGAAGGATCAGCTCGTCTCCCTTCTCTT-A p.Lys284fs frameshift ACY1 5 83030 6.02192E-5 41515 1 NA
3-52021565-C-G c.853-7C>G splice_region ACY1 1 82562 1.21121E-5 41281 0 5.18523E-5
3-52021580-G-A p.Glu287Glu synonymous ACY1 1 82436 1.21306E-5 41218 0 8.39941E-6
3-52021590-C-G p.Gln291Glu missense ACY1 9 82422 1.09194E-4 41211 0 0.00151057
3-52021597-GGT-G p.Cys294fs frameshift ACY1 3 82452 3.63848E-5 41226 0 3.98765E-6
3-52021613-C-T p.Gly298Gly synonymous ACY1 9 82538 1.09041E-4 41269 0 2.19384E-4
3-52021613-C-A p.Gly298Gly synonymous ACY1 1 82538 1.21156E-5 41269 0 9.56267E-5
3-52021614-G-A p.Glu299Lys missense ACY1 4 82586 4.84344E-5 41293 0 2.53122E-4
3-52021617-G-A p.Gly300Arg missense ACY1 2 82670 2.41926E-5 41335 0 1.59549E-5
3-52021632-T-C p.Phe305Leu missense ACY1 2 82840 2.41429E-5 41420 0 8.55798E-6
3-52021640-G-GAA c.921_921+1insAA splice_donor ACY1 3 82868 3.62022E-5 41434 0 NA
3-52021643-A-G c.921+3A>G splice_region ACY1 5 82858 6.03442E-5 41429 0 1.19932E-5
3-52022532-T-C c.922-8T>C splice_region ACY1 1 83214 1.20172E-5 41607 0 NA
3-52022543-T-C p.Trp309Arg missense ACY1 2 83284 2.40142E-5 41642 0 3.97674E-6
3-52022551-C-A p.His311Gln missense ACY1 4 83294 4.80227E-5 41647 0 7.95336E-6
3-52022555-C-G p.Gln313Glu missense ACY1 1 83304 1.20042E-5 41652 0 NA
3-52022557-A-C p.Gln313His missense ACY1 2 83296 2.40108E-5 41648 0 6.37918E-5
3-52022558-G-T p.Val314Leu missense ACY1 8 83302 9.60361E-5 41651 0 1.27518E-4
3-52022563-AC-A p.Pro316fs frameshift ACY1 1 83304 1.20042E-5 41652 0 3.97668E-6
3-52022564-C-A p.Pro316Thr missense ACY1 1 83310 1.20034E-5 41655 0 NA
3-52022603-C-T p.Arg329Trp missense ACY1 1 83314 1.20028E-5 41657 0 7.95349E-6
3-52022604-G-A p.Arg329Gln missense ACY1 5 83312 6.00154E-5 41656 0 9.06275E-5
3-52022607-T-A p.Val330Asp missense ACY1 2 83316 2.4005E-5 41658 0 3.57901E-5
3-52022610-G-A p.Cys331Tyr missense ACY1 1 83316 1.20025E-5 41658 0 4.9434E-5
3-52022618-ATGTGAG-A p.Met334fs frameshift ACY1 1 83306 1.20039E-5 41653 0 1.64794E-5
3-52022625-C-G c.1001+6C>G splice_region ACY1 5 83296 6.00269E-5 41648 0 7.95469E-6
3-52022627-C-T c.1001+8C>T splice_region ACY1 2 83286 2.40136E-5 41643 0 4.94519E-5
3-52022627-C-G c.1001+8C>G splice_region ACY1 1 83286 1.20068E-5 41643 0 NA
3-52022794-G-A p.Leu338Leu synonymous ACY1 46 83268 5.52433E-4 41634 0 0.00453172
3-52022802-A-G p.Glu341Gly missense ACY1 6 83262 7.20617E-5 41631 0 9.55901E-5
3-52022804-A-C p.Ile342Leu missense ACY1 1 83260 1.20106E-5 41630 0 NA
3-52022821-T-C p.Thr347Thr synonymous ACY1 8 83266 9.60776E-5 41633 0 1.27445E-4
3-52022822-G-A p.Asp348Asn missense ACY1 1 83264 1.201E-5 41632 0 3.18654E-5
3-52022828-C-T p.Arg350Cys missense ACY1 2 83268 2.40188E-5 41634 0 3.97731E-6
3-52022831-T-G p.Tyr351Asp missense ACY1 1 83266 1.20097E-5 41633 0 NA
3-52022832-A-G p.Tyr351Cys missense ACY1 2 83268 2.40188E-5 41634 0 8.23642E-6
3-52022837-C-T p.Arg353Cys missense ACY1 303 83258 0.00363929 41629 1 0.00302586
3-52022838-G-A p.Arg353His missense ACY1 2 83264 2.402E-5 41632 0 3.29457E-5
3-52022840-G-A p.Ala354Thr missense+splice_region ACY1 1 83250 1.2012E-5 41625 0 6.25E-4
3-52022841-CGGTGAGCCACTTGCATATAGTGCCTGGGCAGTGGACTGGGCCTGAGTGCTGGCTTTTCCCTAACGGCTCTTCCTCACCCCTGCA-C p.Val355fs frameshift ACY1 5 83260 6.00528E-5 41630 0 NA
3-52022841-C-T p.Ala354Val missense+splice_region ACY1 2 83260 2.40211E-5 41630 0 8.23642E-6
3-52022842-G-A p.Ala354Ala splice_region+synonymous ACY1 4 83260 4.80423E-5 41630 0 8.23642E-5
3-52022926-G-A c.1063-1G>A splice_acceptor ACY1 1 83190 1.20207E-5 41595 0 1.56502E-4
3-52022928-T-TG p.Val357fs frameshift ACY1 1 83184 1.20215E-5 41592 0 NA
3-52022929-G-A p.Val355Val splice_region+synonymous ACY1 1 83180 1.20221E-5 41590 0 NA
3-52022944-A-G p.Leu360Leu synonymous ACY1 1 83198 1.20195E-5 41599 0 8.23737E-6
3-52022954-C-T p.Pro364Ser missense ACY1 2 83208 2.40361E-5 41604 0 1.81237E-4
3-52022963-C-T p.Arg367Cys missense ACY1 15 83174 1.80345E-4 41587 0 3.1841E-5
3-52022964-G-A p.Arg367His missense ACY1 6 83174 7.21379E-5 41587 0 6.60155E-4
3-52022968-A-G p.Thr368Thr synonymous ACY1 1 83158 1.20253E-5 41579 0 NA
3-52022974-G-A p.Val370Val synonymous ACY1 7 83170 8.4165E-5 41585 0 1.59226E-4
3-52022980-G-A p.Leu372Leu synonymous ACY1 2 83138 2.40564E-5 41569 0 NA
3-52022984-G-A p.Asp374Asn missense ACY1 1 83138 1.20282E-5 41569 0 3.18451E-5
3-52022989-C-T p.His375His synonymous ACY1 23 83080 2.76842E-4 41540 0 0.00100705
3-52022991-A-G p.Asp376Gly missense ACY1 1 83086 1.20357E-5 41543 0 1.9884E-5
3-52022992-T-C p.Asp376Asp synonymous ACY1 1 83086 1.20357E-5 41543 0 NA
3-52022996-C-T p.Arg378Trp missense ACY1 5 83040 6.02119E-5 41520 0 0.00151057
3-52022997-G-A p.Arg378Gln missense ACY1 3 83020 3.61359E-5 41510 0 0.00100705
3-52023003-A-G p.His380Arg missense ACY1 1 82966 1.20531E-5 41483 0 NA
3-52023018-TC-T p.Arg386fs frameshift ACY1 1 82684 1.20942E-5 41342 0 1.19352E-5
3-52023020-C-T p.Arg386Cys missense ACY1 245 82570 0.00296718 41285 6 0.00452431
3-52023021-G-A p.Arg386His missense ACY1 9 82496 1.09096E-4 41248 0 8.75434E-5
3-52023025-G-A p.Gly387Gly synonymous ACY1 1 82326 1.21468E-5 41163 0 8.25287E-6
3-52023032-A-G p.Ile390Val missense ACY1 3 81980 3.65943E-5 40990 0 1.59252E-5
3-52023036-A-G p.Tyr391Cys missense ACY1 1 81658 1.22462E-5 40829 0 8.2646E-6
3-52023037-T-G p.Tyr391* stop_gained ACY1 1 81572 1.22591E-5 40786 0 NA
3-52023041-C-T p.Arg393Cys missense ACY1 64 81120 7.88955E-4 40560 1 0.00178435
3-52023041-C-G p.Arg393Gly missense ACY1 1 81124 1.23268E-5 40562 0 3.30808E-5
3-52023042-G-A p.Arg393His missense ACY1 336 80912 0.00415266 40456 1 0.004375
3-52023043-C-T p.Arg393Arg synonymous ACY1 2 80876 2.47292E-5 40438 0 NA
3-52023052-T-A p.Pro396Pro synonymous ACY1 2 79644 2.51117E-5 39822 0 NA
3-52023054-C-T p.Ala397Val missense ACY1 1 79254 1.26177E-5 39627 0 3.99189E-6
3-52023083-G-A p.Asp407Asn missense ACY1 3 74390 4.0328E-5 37195 0 4.01017E-6