Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-100592902-C-T c.-3C>T 5_prime_UTR_premature_start_codon_gain ACTR6 28 8938 0.00313269 4469 2 0.00449159
12-100592910-C-A p.Tyr2* stop_gained ACTR6 23 8952 0.00256926 4476 0 0.00570064
12-100592916-T-C p.Gly4Gly synonymous ACTR6 3 8968 3.34523E-4 4484 0 3.50653E-4
12-100592917-C-T p.Pro5Ser missense ACTR6 3 8976 3.34225E-4 4488 0 6.25E-4
12-100592932-A-C p.Lys10Gln missense ACTR6 5 8976 5.57041E-4 4488 0 0.00210419
12-100592953-G-T p.Ala17Ser missense ACTR6 1 8982 1.11334E-4 4491 0 NA
12-100592956-T-C p.Tyr18His missense ACTR6 1 8982 1.11334E-4 4491 0 2.23471E-4
12-100592971-T-C p.Leu23Leu synonymous ACTR6 2 8966 2.23065E-4 4483 0 6.38407E-5
12-100592981-T-G p.Leu26Arg missense ACTR6 2 8964 2.23115E-4 4482 0 1.71765E-4
12-100592986-C-T p.Arg28Trp missense ACTR6 6 8940 6.71141E-4 4470 0 0.00140539
12-100592987-G-A p.Arg28Gln missense ACTR6 11 8944 0.00122987 4472 0 0.00125
12-100592997-G-C p.Thr31Thr synonymous ACTR6 1 8928 1.12007E-4 4464 0 3.19224E-5
12-100593012-A-G c.104+4A>G splice_region ACTR6 5 8884 5.6281E-4 4442 0 6.26566E-4
12-100594352-T-G c.-278T>G 5_prime_UTR_premature_start_codon_gain ACTR6 1 13396 7.46491E-5 6698 0 1.91889E-4
12-100594468-C-T c.-162C>T 5_prime_UTR_premature_start_codon_gain ACTR6 1 67490 1.4817E-5 33745 0 NA
12-100594469-G-T c.-161G>T 5_prime_UTR_premature_start_codon_gain ACTR6 51 67552 7.54974E-4 33776 0 0.00464968
12-100594479-A-G c.-151A>G 5_prime_UTR_premature_start_codon_gain ACTR6 2 71044 2.81516E-5 35522 0 NA
12-100594587-G-T c.-43G>T 5_prime_UTR_premature_start_codon_gain ACTR6 1 83294 1.20057E-5 41647 0 1.19336E-5
12-100594604-A-G c.-26A>G 5_prime_UTR_premature_start_codon_gain ACTR6 1 83372 1.19944E-5 41686 0 8.23683E-6
12-100594613-G-A c.-17G>A 5_prime_UTR_premature_start_codon_gain ACTR6 1 83394 1.19913E-5 41697 0 8.23669E-6
12-100594632-G-A p.Met1? start_lost ACTR6 1 83414 1.19884E-5 41707 0 NA
12-100594634-C-G p.Thr2Arg missense ACTR6 1 83412 1.19887E-5 41706 0 NA
12-100594635-G-A p.Thr2Thr synonymous ACTR6 2 83418 2.39756E-5 41709 0 8.23642E-6
12-100594644-G-A p.Val5Val synonymous ACTR6 1 83420 1.19875E-5 41710 0 6.36902E-5
12-100594665-C-T c.-352C>T 5_prime_UTR_premature_start_codon_gain ACTR6 97 83424 0.00116273 41712 1 0.005625
12-100594676-G-A p.Gly16Asp missense ACTR6 1 83422 1.19872E-5 41711 0 NA
12-100594681-A-G p.Ser18Gly missense ACTR6 1 83430 1.19861E-5 41715 0 NA
12-100594687-G-A p.Glu20Lys missense ACTR6 1 83426 1.19867E-5 41713 0 NA
12-100594697-C-T p.Ser23Leu missense+splice_region ACTR6 1 83416 1.19881E-5 41708 0 8.23696E-6
12-100594729-A-G c.-288A>G 5_prime_UTR_premature_start_codon_gain ACTR6 1 83316 1.20025E-5 41658 0 NA
12-100594731-A-G c.-286A>G 5_prime_UTR_premature_start_codon_gain ACTR6 1 83292 1.2006E-5 41646 0 NA
12-100594767-C-T c.-250C>T 5_prime_UTR_premature_start_codon_gain ACTR6 58 82776 7.00686E-4 41388 0 0.00165637
12-100594827-G-T c.-190G>T 5_prime_UTR_premature_start_codon_gain ACTR6 1 80602 1.24066E-5 40301 0 NA
12-100594841-G-T c.-179+3G>T splice_region ACTR6 4 79430 5.03588E-5 39715 0 NA
12-100594845-G-A c.-179+7G>A splice_region ACTR6 1 79130 1.26374E-5 39565 0 NA
12-100598719-G-T p.Val24Phe missense+splice_region ACTR6 3 82438 3.6391E-5 41219 0 3.24554E-5
12-100598739-C-A p.Phe30Leu missense ACTR6 1 82724 1.20884E-5 41362 0 NA
12-100598755-C-T p.Arg36Cys missense ACTR6 3 82756 3.62511E-5 41378 0 6.37024E-5
12-100598756-G-A p.Arg36His missense ACTR6 1 82770 1.20817E-5 41385 0 8.24538E-6
12-100598782-A-G p.Ile45Val missense ACTR6 1 82772 1.20814E-5 41386 0 3.30017E-5
12-100598791-A-G p.Ile48Val missense ACTR6 2 82712 2.41803E-5 41356 0 1.1974E-5
12-100598818-A-G p.Ile57Val missense ACTR6 50 82292 6.07592E-4 41146 0 3.82263E-4
12-100598823-C-T p.Leu58Leu synonymous ACTR6 2 82130 2.43516E-5 41065 0 9.55657E-5
12-100598839-ATCCAATTAATTATGTTTCATTTCT-A c.186+5_186+28delTCCAATTAATTATGTTTCATTTCT splice_region ACTR6 1 81462 1.22757E-5 40731 0 NA
12-100599452-A-G c.187-2A>G splice_acceptor ACTR6 3 79374 3.77958E-5 39687 0 1.68566E-5
12-100599458-A-G p.Tyr64Cys missense ACTR6 1 79528 1.25742E-5 39764 0 NA
12-100599465-G-A p.Val66Val synonymous ACTR6 42 79104 5.30947E-4 39552 0 0.00151057
12-100599467-A-G p.Asn67Ser missense ACTR6 1 79230 1.26215E-5 39615 0 8.31214E-6
12-100599479-A-G p.Gln71Arg missense ACTR6 1 79340 1.2604E-5 39670 0 NA
12-100599498-C-T p.Tyr77Tyr synonymous ACTR6 573 79082 0.00724564 39541 11 0.0169351
12-100599514-A-G p.Met1? start_lost ACTR6 1 79030 1.26534E-5 39515 0 NA
12-100599520-C-G p.Gln85Glu missense+splice_region ACTR6 1 78822 1.26868E-5 39411 0 NA
12-100599524-T-TTG p.Thr87fs frameshift ACTR6 1 78622 1.27191E-5 39311 0 NA
12-100599529-A-C p.Asn88His missense ACTR6 2 78198 2.55761E-5 39099 0 2.63986E-5
12-100601457-CTAA-C p.Asn92del disruptive_inframe_deletion ACTR6 1 82376 1.21395E-5 41188 0 4.40742E-6
12-100601457-C-T p.Thr91Ile missense ACTR6 2 82376 2.42789E-5 41188 0 2.20371E-5
12-100601460-A-G p.Asn92Ser missense ACTR6 4 82502 4.84837E-5 41251 0 1.81412E-5
12-100601467-T-C p.Ile94Ile synonymous ACTR6 1 82584 1.21089E-5 41292 0 4.23478E-6
12-100601477-C-T p.Pro98Ser missense ACTR6 1 82924 1.20592E-5 41462 0 3.18492E-5
12-100601486-AACTTC-A p.Thr103fs frameshift ACTR6 2 82986 2.41005E-5 41493 0 2.01191E-5
12-100601493-CTTCAA-C p.Ile105fs frameshift ACTR6 1 82986 1.20502E-5 41493 0 3.18431E-5
12-100601502-A-G p.Gln106Arg missense ACTR6 2 83072 2.40755E-5 41536 0 NA
12-100601536-C-T p.Tyr117Tyr synonymous ACTR6 97 83192 0.00116598 41596 1 0.00273973
12-100601541-T-A p.Phe119Tyr missense ACTR6 1 83208 1.20181E-5 41604 0 NA
12-100601564-G-GCTGGGGCTCTCA c.379_379+1insCTGGGGCTCTCA splice_donor ACTR6 1 83182 1.20218E-5 41591 0 NA
12-100601569-G-GGTAT c.379+5_379+6insGTAT splice_region ACTR6 1 83164 1.20244E-5 41582 0 NA
12-100601571-T-G c.379+7T>G splice_region ACTR6 2 83158 2.40506E-5 41579 0 NA
12-100602561-G-A p.Val131Ile missense ACTR6 2 8024 2.49252E-4 4012 0 7.81812E-6
12-100603848-T-C c.380-3T>C splice_region ACTR6 1 81958 1.22014E-5 40979 0 NA
12-100603859-C-G p.Leu130Val missense ACTR6 1 82358 1.21421E-5 41179 0 NA
12-100603867-A-C p.Ala132Ala synonymous ACTR6 28 82600 3.38983E-4 41300 0 9.5584E-4
12-100603881-G-A p.Arg137Gln missense ACTR6 3 82684 3.62827E-5 41342 0 3.18979E-5
12-100603883-G-A p.Asp138Asn missense ACTR6 2 82788 2.41581E-5 41394 0 4.0373E-6
12-100603884-AT-A p.Asp138fs frameshift ACTR6 3 82800 3.62319E-5 41400 0 1.20974E-5
12-100603890-C-T p.Pro140Leu missense ACTR6 1 82844 1.20709E-5 41422 0 1.6124E-5
12-100603894-C-T p.Ser141Ser synonymous ACTR6 78 82862 9.41324E-4 41431 1 0.00232855
12-100603894-C-A p.Ser141Ser synonymous ACTR6 1 82864 1.2068E-5 41432 0 3.18979E-5
12-100603910-A-G p.Ile147Val missense ACTR6 1 82924 1.20592E-5 41462 0 1.64962E-5
12-100603915-T-C p.Val148Val synonymous ACTR6 9 82924 1.08533E-4 41462 0 NA
12-100603920-G-T p.Ser150Ile missense ACTR6 22 82890 2.65412E-4 41445 0 6.69003E-4
12-100603937-C-CAT p.Val158fs frameshift ACTR6 1 82898 1.2063E-5 41449 0 NA
12-100603944-T-C p.Val158Ala missense ACTR6 1 82900 1.20627E-5 41450 0 NA
12-100603951-T-C p.Tyr160Tyr synonymous ACTR6 11 82840 1.32786E-4 41420 0 2.22873E-4
12-100603978-AATT-A p.Ile171del conservative_inframe_deletion ACTR6 2 82910 2.41225E-5 41455 0 NA
12-100603985-CGGTGAGTTGTATTTAATTTTCATGTTGTTTCTAAAGATTAAACAGAATGATATGTGCGATAATTAAATTTGAGTTCTCCCCTTGCA-C p.Ile173fs frameshift ACTR6 7 82910 8.44289E-5 41455 0 NA
12-100603992-T-C c.515+6T>C splice_region ACTR6 1 82954 1.20549E-5 41477 0 NA
12-100604095-T-C p.Leu180Leu synonymous ACTR6 1 83170 1.20236E-5 41585 0 NA
12-100604100-C-T p.Thr181Thr synonymous ACTR6 1 83174 1.2023E-5 41587 0 NA
12-100604124-T-C p.Ser189Ser synonymous ACTR6 1 83142 1.20276E-5 41571 0 NA
12-100604127-C-T p.Tyr190Tyr splice_region+synonymous ACTR6 1 83142 1.20276E-5 41571 0 8.24565E-6
12-100604130-G-GCAGCTACATGTTATGGATGAAACACATGTGATTAATCAAGTGAAAGAAGATGTA c.572+1_572+2insCAGCTACATGTTATGGATGAAACACATGTGATTAATCAAGTGAAAGAAGATGTA splice_donor ACTR6 1 83126 1.20299E-5 41563 0 NA
12-100604130-G-GCAGCTACATGTTATGGATGAAACACA c.572+1_572+2insCAGCTACATGTTATGGATGAAACACA splice_donor ACTR6 2 83126 2.40599E-5 41563 1 NA
12-100604133-A-G c.572+4A>G splice_region ACTR6 4 83092 4.81394E-5 41546 0 NA
12-100606029-G-A c.573-5G>A splice_region ACTR6 2 80916 2.4717E-5 40458 0 8.38814E-6
12-100606073-A-G p.Gln204Gln synonymous ACTR6 6 82698 7.25531E-5 41349 0 2.22916E-4
12-100606078-A-AAGAAGATG p.Val209fs frameshift ACTR6 1 82700 1.20919E-5 41350 0 8.00679E-6
12-100606089-T-C p.Cys210Arg missense ACTR6 1 82772 1.20814E-5 41386 0 NA
12-100606094-T-C p.Tyr211Tyr synonymous ACTR6 8 82790 9.663E-5 41395 1 NA
12-100606095-G-A p.Val212Met missense ACTR6 1 82786 1.20793E-5 41393 0 NA
12-100606112-T-C p.Tyr217Tyr synonymous ACTR6 1 82794 1.20782E-5 41397 0 4.00339E-6
12-100606119-A-G p.Met220Val missense ACTR6 1 82764 1.20825E-5 41382 0 NA
12-100606123-A-T p.Asp221Val missense ACTR6 1 82766 1.20823E-5 41383 0 NA
12-100606132-AGTATGTATAATGACAATCTAAGAATTGGAAAGTAGATTGTTAGGGGATGTTACACATAATTAGAATGTTTCATAAATCTCAATTTTGTTTTCCAG-A c.671+1_672-1delGTATGTATAATGACAATCTAAGAATTGGAAAGTAGATTGTTAGGGGATGTTACACATAATTAGAATGTTTCATAAATCTCAATTTTGTTTTCCAG splice_acceptor ACTR6 12 82758 1.45001E-4 41379 5 NA
12-100606226-A-C c.672-2A>C splice_acceptor ACTR6 1 83128 1.20296E-5 41564 0 3.18573E-5
12-100606228-GT-G p.Leu225fs frameshift ACTR6 1 83140 1.20279E-5 41570 0 NA
12-100606228-G-A p.Lys224Lys splice_region+synonymous ACTR6 1 83140 1.20279E-5 41570 0 NA
12-100606231-G-A p.Leu225Leu synonymous ACTR6 1 83168 1.20239E-5 41584 0 2.38996E-5
12-100606233-AAGG-A p.Gly227del disruptive_inframe_deletion ACTR6 1 83172 1.20233E-5 41586 0 NA
12-100606248-C-T p.Thr231Ile missense ACTR6 12 83178 1.44269E-4 41589 0 2.54972E-4
12-100606255-G-T p.Met233Ile missense ACTR6 2 83204 2.40373E-5 41602 0 8.25518E-6
12-100606256-A-G p.Ile234Val missense ACTR6 2 83206 2.40367E-5 41603 0 NA
12-100606265-G-C p.Val237Leu missense ACTR6 6 83210 7.21067E-5 41605 0 3.18436E-5
12-100606267-C-T p.Val237Val synonymous ACTR6 1 83204 1.20187E-5 41602 0 NA
12-100606280-A-G p.Ser242Gly missense ACTR6 3 83204 3.6056E-5 41602 0 8.26829E-6
12-100606286-A-G p.Ile244Val missense ACTR6 2 83210 2.40356E-5 41605 0 3.18573E-5
12-100606291-A-G p.Lys245Lys synonymous ACTR6 1 83178 1.20224E-5 41589 0 8.28404E-6
12-100606302-G-A p.Cys249Tyr missense ACTR6 1 83084 1.2036E-5 41542 0 NA
12-100612187-T-G c.751-6T>G splice_region ACTR6 1 82856 1.20691E-5 41428 0 NA
12-100612210-G-T p.Val256Val synonymous ACTR6 2 83086 2.40714E-5 41543 0 8.26774E-6
12-100612233-G-C p.Gly264Ala missense ACTR6 1 83174 1.2023E-5 41587 0 NA
12-100612248-G-A p.Arg269His missense ACTR6 1 83146 1.2027E-5 41573 0 8.26214E-6
12-100612249-T-C p.Arg269Arg synonymous ACTR6 1 83150 1.20265E-5 41575 0 2.01319E-5
12-100612254-C-T p.Ala271Val missense ACTR6 2 83136 2.4057E-5 41568 0 5.03525E-4
12-100612275-C-T p.Pro278Leu missense ACTR6 5 83034 6.02163E-5 41517 0 3.67725E-5
12-100612276-G-A p.Pro278Pro synonymous ACTR6 10 83034 1.20433E-4 41517 0 6.37471E-5
12-100612284-T-C p.Leu281Pro missense ACTR6 7 83016 8.43211E-5 41508 0 5.79547E-5
12-100612294-T-G p.Pro284Pro synonymous ACTR6 4 82892 4.82556E-5 41446 0 NA
12-100612308-T-G p.Ile289Ser missense ACTR6 1 82326 1.21468E-5 41163 0 NA
12-100612317-T-C p.Met292Thr missense ACTR6 3 82140 3.6523E-5 41070 0 4.3496E-6
12-100612320-G-A p.Gly293Glu missense ACTR6 1 82022 1.21919E-5 41011 0 1.67325E-5
12-100612341-A-G p.Tyr300Cys missense ACTR6 1 81258 1.23065E-5 40629 0 4.72184E-6
12-100612365-G-C c.922+1G>C splice_donor ACTR6 1 79700 1.25471E-5 39850 0 NA
12-100612368-C-T c.922+4C>T splice_region ACTR6 34 79466 4.27856E-4 39733 0 6.46831E-4
12-100613777-CTTTT-C c.923-8_923-5delTTTT splice_region ACTR6 1 83034 1.20433E-5 41517 0 1.68401E-5
12-100613781-T-C c.923-5T>C splice_region ACTR6 2 83032 2.40871E-5 41516 0 NA
12-100613782-AAAGAAATGCAGCCGCAT-A p.Glu308fs frameshift ACTR6 1 83032 1.20435E-5 41516 0 1.67546E-5
12-100613794-C-G p.Pro311Ala missense ACTR6 3 83100 3.61011E-5 41550 0 3.18492E-5
12-100613795-C-T p.Pro311Leu missense ACTR6 1 83096 1.20343E-5 41548 0 1.19983E-5
12-100613796-G-A p.Pro311Pro synonymous ACTR6 4 83076 4.81487E-5 41538 0 3.31488E-5
12-100613828-G-A p.Gly322Glu missense ACTR6 1 83140 1.20279E-5 41570 0 3.98064E-6
12-100613836-C-A p.Leu325Ile missense ACTR6 7 83150 8.41852E-5 41575 0 5.09554E-4
12-100613854-G-T p.Asp331Tyr missense ACTR6 1 83164 1.20244E-5 41582 0 NA
12-100613857-C-T p.Arg332Trp missense ACTR6 4 83162 4.80989E-5 41581 0 5.96944E-5
12-100613857-C-A p.Arg332Arg synonymous ACTR6 1 83162 1.20247E-5 41581 0 NA
12-100613858-G-A p.Arg332Gln missense ACTR6 2 83156 2.40512E-5 41578 0 3.29679E-5
12-100613859-G-T p.Arg332Arg synonymous ACTR6 2 83152 2.40523E-5 41576 0 8.24185E-6
12-100613860-G-T p.Val333Phe missense ACTR6 2 83148 2.40535E-5 41574 0 3.97962E-6
12-100613875-C-T p.Arg338* stop_gained ACTR6 1 83152 1.20262E-5 41576 0 3.18593E-5
12-100613876-G-A p.Arg338Gln missense ACTR6 1 83142 1.20276E-5 41571 0 1.99003E-5
12-100613882-T-G p.Leu340Arg missense ACTR6 2 83146 2.40541E-5 41573 0 8.24103E-6
12-100613886-T-C p.Thr341Thr synonymous ACTR6 1 83142 1.20276E-5 41571 0 NA
12-100613892-A-T p.Thr343Thr synonymous ACTR6 2 83124 2.40604E-5 41562 0 1.64823E-5
12-100613906-C-T p.Ser348Phe missense ACTR6 2 83086 2.40714E-5 41543 0 9.5645E-5
12-100617559-T-G c.1062-5T>G splice_region ACTR6 1 82824 1.20738E-5 41412 0 1.65191E-5
12-100617564-C-A p.Asn354Lys missense+splice_region ACTR6 1 82836 1.2072E-5 41418 0 4.97352E-5
12-100617576-T-C p.Tyr358Tyr synonymous ACTR6 1 82900 1.20627E-5 41450 0 4.084E-5
12-100617581-G-A p.Trp360* stop_gained ACTR6 1 82924 1.20592E-5 41462 0 NA
12-100617599-T-C p.Ile366Thr missense ACTR6 1 82960 1.2054E-5 41480 0 NA
12-100617601-T-G p.Ser367Ala missense ACTR6 1 82958 1.20543E-5 41479 0 NA
12-100617609-T-C p.Asn369Asn synonymous ACTR6 1 82984 1.20505E-5 41492 0 NA
12-100617635-CAA-C p.Glu380fs frameshift ACTR6 1 83064 1.20389E-5 41532 0 3.18634E-5
12-100617648-C-T p.Tyr382Tyr synonymous ACTR6 9 83094 1.08311E-4 41547 0 0.00151362
12-100617666-C-T p.Ser388Ser synonymous ACTR6 1 83090 1.20351E-5 41545 0 6.37227E-5
12-100617667-G-A p.Val389Ile missense ACTR6 1 83090 1.20351E-5 41545 0 3.29859E-5
12-100617669-C-T p.Val389Val synonymous ACTR6 1 83084 1.2036E-5 41542 0 NA
12-100617678-G-A p.Glu392Glu synonymous ACTR6 1 83072 1.20378E-5 41536 0 NA
12-100617683-T-C p.Phe394Ser missense ACTR6 1 83054 1.20404E-5 41527 0 8.25587E-6
12-100635504-G-A c.*542-7G>A splice_region ACTR6 3 74840 4.00855E-5 37420 0 4.24398E-5
12-100635506-T-G c.*542-5T>G splice_region ACTR6 1 74918 1.33479E-5 37459 0 4.13134E-5
12-100635509-A-G c.*542-2A>G splice_acceptor ACTR6 1 74904 1.33504E-5 37452 0 NA
12-100635627-G-GAAAAAAAAAAAAAAACAAAA c.*673_*674insCAAAAAAAAAAAAAAAAAAA splice_region ACTR6 1 72514 1.37904E-5 36257 0 NA
12-100635637-AAAAAAAC-A c.*669_*31567delAAAAAAC splice_region ACTR6 1 73658 1.35763E-5 36829 0 NA
12-100635640-AAAAC-A c.*672_*31567delAAAC splice_region ACTR6 1 73612 1.35847E-5 36806 0 NA
12-100635643-A-C c.*674A>C splice_region ACTR6 1 73470 1.3611E-5 36735 0 3.44424E-5