Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
2-98273332-T-C p.Lys374Glu missense ACTR1B 1 81370 1.22895E-5 40685 0 NA
2-98273347-G-A p.Arg369Cys missense ACTR1B 3 81798 3.66757E-5 40899 0 1.40542E-5
2-98273378-C-T p.Val358Val synonymous ACTR1B 20 82276 2.43084E-4 41138 0 0.00352467
2-98273394-A-G p.Phe353Ser missense ACTR1B 1 82406 1.2135E-5 41203 0 NA
2-98273397-G-C p.Thr352Ser missense ACTR1B 3 82436 3.63919E-5 41218 0 4.55067E-6
2-98273402-C-T p.Leu350Leu synonymous ACTR1B 5 82458 6.06369E-5 41229 0 2.13347E-5
2-98273423-G-A p.Gly343Gly splice_region+synonymous ACTR1B 2 82492 2.42448E-5 41246 0 3.18552E-5
2-98273431-G-A c.1029-8C>T splice_region ACTR1B 1 82460 1.21271E-5 41230 0 2.09266E-5
2-98273612-C-T c.1028+3G>A splice_region ACTR1B 4 82402 4.85425E-5 41201 0 NA
2-98273622-A-C p.Trp341Gly missense ACTR1B 1 82452 1.21283E-5 41226 0 NA
2-98273632-C-T p.Leu337Leu synonymous ACTR1B 3 82420 3.63989E-5 41210 0 6.36821E-5
2-98273645-G-A p.Pro333Leu missense ACTR1B 1 82344 1.21442E-5 41172 0 3.18431E-5
2-98273651-G-A p.Ser331Leu missense ACTR1B 3 82330 3.64387E-5 41165 0 6.79212E-5
2-98273652-A-T p.Ser331Thr missense ACTR1B 1 82298 1.2151E-5 41149 0 8.33556E-6
2-98273655-T-C p.Ile330Val missense+splice_region ACTR1B 1 82292 1.21518E-5 41146 0 7.99303E-6
2-98273661-A-G c.988-6T>C splice_region ACTR1B 55205 81914 0.673939 40957 19095 0.705195
2-98273951-C-A p.Ser316Ile missense ACTR1B 6 83132 7.21744E-5 41566 0 1.19294E-5
2-98273961-G-A p.Arg313* stop_gained ACTR1B 1 83056 1.20401E-5 41528 0 8.2371E-6
2-98273968-G-A p.Phe310Phe synonymous ACTR1B 2 82996 2.40975E-5 41498 0 3.18492E-5
2-98274400-C-T c.925+6G>A splice_region ACTR1B 3 83050 3.61228E-5 41525 0 3.34924E-5
2-98274408-T-C p.Lys308Arg missense+splice_region ACTR1B 1 83106 1.20328E-5 41553 0 8.32945E-6
2-98274416-C-T p.Thr305Thr synonymous ACTR1B 4 83130 4.81174E-5 41565 0 2.78733E-5
2-98274417-G-A p.Thr305Met missense ACTR1B 1 83150 1.20265E-5 41575 0 4.14415E-5
2-98274426-C-T p.Gly302Asp missense ACTR1B 1 83160 1.2025E-5 41580 0 NA
2-98274436-C-T p.Val299Met missense ACTR1B 5 83168 6.01193E-5 41584 0 NA
2-98274439-T-C p.Ile298Val missense ACTR1B 1 83192 1.20204E-5 41596 0 NA
2-98274443-G-A n.1149C>T splice_region ACTR1B 2 83190 2.40414E-5 41595 0 8.25219E-6
2-98274445-C-T p.Ala296Thr missense ACTR1B 4 83178 4.80896E-5 41589 0 3.18613E-4
2-98274452-C-T p.Thr293Thr synonymous ACTR1B 1 83186 1.20213E-5 41593 0 2.47464E-5
2-98274453-G-A p.Thr293Met missense ACTR1B 4 83176 4.80908E-5 41588 0 5.03525E-4
2-98274456-C-T p.Arg292Gln missense ACTR1B 4 83174 4.8092E-5 41587 0 6.37267E-5
2-98274457-G-A p.Arg292Trp missense ACTR1B 1 83170 1.20236E-5 41585 0 7.95545E-6
2-98274458-GCGCAGGTCCATGTCGGACTTGTGTATGGCGAAGGCCACCAC-G p.Val278fs frameshift ACTR1B 1 83174 1.2023E-5 41587 0 NA
2-98274468-A-G p.Met288Thr missense ACTR1B 2 83194 2.40402E-5 41597 0 1.7317E-4
2-98274470-G-A p.Asp287Asp synonymous ACTR1B 2 83194 2.40402E-5 41597 0 NA
2-98274472-C-T p.Asp287Asn missense ACTR1B 3 83184 3.60646E-5 41592 0 2.4739E-5
2-98274473-G-A p.Ser286Ser synonymous ACTR1B 2 83182 2.40437E-5 41591 0 8.24579E-6
2-98274480-TGTA-T p.Ile283_His284delinsAsn disruptive_inframe_deletion ACTR1B 2 83190 2.40414E-5 41595 0 8.24633E-6
2-98274497-C-T p.Val278Val synonymous ACTR1B 3 83146 3.60811E-5 41573 0 8.24688E-6
2-98274509-C-A p.Gly274Gly synonymous ACTR1B 1 83144 1.20273E-5 41572 0 NA
2-98274512-C-T p.Glu273Glu synonymous ACTR1B 2 83172 2.40466E-5 41586 0 1.98904E-5
2-98274518-C-G p.Glu271Asp missense ACTR1B 2 83162 2.40494E-5 41581 0 NA
2-98274521-A-G p.Asp270Asp synonymous ACTR1B 17 83170 2.04401E-4 41585 0 2.86825E-4
2-98274525-C-T p.Gly269Glu missense ACTR1B 1 83180 1.20221E-5 41590 0 3.18532E-5
2-98274527-G-C p.Val268Val synonymous ACTR1B 55901 82918 0.674172 41459 19346 0.705345
2-98274527-GAC-CAA p.Val268Leu missense ACTR1B 35 83188 4.20734E-4 41594 0 NA
2-98274529-C-A p.Val268Phe missense ACTR1B 109 83178 0.00131044 41589 0 0.00143321
2-98274536-C-A p.Pro265Pro synonymous ACTR1B 1 83186 1.20213E-5 41593 0 NA
2-98274536-C-T p.Pro265Pro synonymous ACTR1B 1 83186 1.20213E-5 41593 0 3.18471E-5
2-98274540-T-C p.Gln264Arg missense ACTR1B 1 83156 1.20256E-5 41578 0 3.97956E-6
2-98274551-CTCGGGGGCCCGGAA-C p.Phe256fs frameshift ACTR1B 1 83136 1.20285E-5 41568 0 NA
2-98274553-C-T p.Glu260Lys missense ACTR1B 1 83082 1.20363E-5 41541 0 3.98559E-6
2-98274562-G-A p.Arg257Trp missense ACTR1B 2 83030 2.40877E-5 41515 0 3.31055E-5
2-98274565-A-T p.Phe256Ile missense ACTR1B 1 83018 1.20456E-5 41509 0 NA
2-98274578-CACCTTTAGTGTACAAGATTGAGGCAGACAGGCTTCCTGGAGAAGCGGGCTACCCCTTCCCCCAGGCTGGGCATCGGCTGCCACTCCAGTGCCAGGCCCGGCCACTT-C p.Val251fs frameshift ACTR1B 1 82926 1.20589E-5 41463 0 NA
2-98274579-A-G p.Val251Ala missense+splice_region ACTR1B 1 82894 1.20636E-5 41447 0 NA
2-98274584-T-C c.751-4A>G splice_region ACTR1B 1 82874 1.20665E-5 41437 0 3.18613E-5
2-98274678-GC-G c.750+8delG splice_region ACTR1B 1 82746 1.20852E-5 41373 0 NA
2-98274679-C-A c.750+8G>T splice_region ACTR1B 2 82756 2.41674E-5 41378 0 3.98172E-6
2-98274693-C-T p.Thr248Thr synonymous ACTR1B 3 82858 3.62065E-5 41429 0 2.23015E-4
2-98274701-C-T p.Gly246Ser missense ACTR1B 1 82916 1.20604E-5 41458 0 3.18532E-5
2-98274702-G-A p.Asp245Asp synonymous ACTR1B 121 82908 0.00145945 41454 1 0.00352467
2-98274711-C-T p.Thr242Thr synonymous ACTR1B 2 82952 2.41103E-5 41476 0 3.2981E-5
2-98274712-G-T p.Thr242Lys missense ACTR1B 7 82970 8.43678E-5 41485 0 7.95659E-5
2-98274712-G-A p.Thr242Met missense ACTR1B 1 82970 1.20525E-5 41485 0 2.47366E-5
2-98274729-C-T p.Thr236Thr synonymous ACTR1B 1 82994 1.20491E-5 41497 0 3.97839E-5
2-98274730-G-A p.Thr236Met missense ACTR1B 11 82964 1.32588E-4 41482 0 9.89169E-5
2-98274741-C-T p.Glu232Glu synonymous ACTR1B 1 82980 1.20511E-5 41490 0 NA
2-98274742-T-C p.Glu232Gly missense ACTR1B 1 82944 1.20563E-5 41472 0 NA
2-98274750-C-T p.Gln229Gln synonymous ACTR1B 1 82904 1.20621E-5 41452 0 NA
2-98274765-C-A p.Leu224Leu synonymous ACTR1B 1 82748 1.20849E-5 41374 0 NA
2-98274775-G-A p.Ala221Val missense ACTR1B 2 82562 2.42242E-5 41281 0 1.5921E-5
2-98274779-G-A p.Arg220* stop_gained ACTR1B 1 82460 1.21271E-5 41230 0 1.19404E-5
2-98274783-C-T c.658-4G>A splice_region ACTR1B 421 82354 0.00511208 41177 3 0.010325
2-98274783-C-A c.658-4G>T splice_region ACTR1B 1 82362 1.21415E-5 41181 0 NA
2-98274784-G-A c.658-5C>T splice_region ACTR1B 107 82408 0.00129842 41204 0 6.13009E-4
2-98274899-T-G p.Thr216Thr synonymous ACTR1B 2 83176 2.40454E-5 41588 0 1.66472E-5
2-98274905-G-A p.Val214Val synonymous ACTR1B 88 83198 0.00105772 41599 0 6.25E-4
2-98274908-A-C p.Val213Val synonymous ACTR1B 1 83208 1.20181E-5 41604 0 3.18939E-5
2-98274910-C-T p.Val213Ile missense ACTR1B 2 83216 2.40338E-5 41608 0 NA
2-98274923-C-T p.Ser208Ser synonymous ACTR1B 2 83216 2.40338E-5 41608 0 4.37654E-5
2-98274943-C-T p.Gly202Arg missense ACTR1B 1 83264 1.201E-5 41632 0 NA
2-98274951-C-T p.Arg199His missense ACTR1B 2 83256 2.40223E-5 41628 0 NA
2-98274963-C-T p.Arg195Gln missense ACTR1B 4 83224 4.80631E-5 41612 0 3.57972E-5
2-98274964-G-A p.Arg195* stop_gained ACTR1B 1 83240 1.20135E-5 41620 0 3.18715E-5
2-98274968-G-A p.Tyr193Tyr synonymous ACTR1B 3 83234 3.6043E-5 41617 0 8.24565E-6
2-98274973-G-A p.Arg192Cys missense ACTR1B 2 83244 2.40258E-5 41622 0 4.94764E-5
2-98274979-C-T p.Val190Ile missense ACTR1B 5 83246 6.00629E-5 41623 0 8.24321E-5
2-98274982-C-T p.Asp189Asn missense ACTR1B 2 83228 2.40304E-5 41614 0 3.18837E-5
2-98274983-G-A p.Arg188Arg synonymous ACTR1B 1 83226 1.20155E-5 41613 0 NA
2-98274985-G-A p.Arg188Cys missense ACTR1B 2 83220 2.40327E-5 41610 0 3.18959E-5
2-98274988-C-T p.Gly187Ser missense ACTR1B 1 83238 1.20137E-5 41619 0 6.37552E-5
2-98274989-G-A p.Ala186Ala synonymous ACTR1B 5 83232 6.0073E-5 41616 0 2.47227E-5
2-98274994-T-C p.Ile185Val missense ACTR1B 2 83258 2.40217E-5 41629 0 NA
2-98274995-G-A p.Asp184Asp synonymous ACTR1B 5 83266 6.00485E-5 41633 0 0.0020141
2-98275006-T-C p.Met181Val missense ACTR1B 1 83250 1.2012E-5 41625 0 3.97712E-6
2-98275017-G-A p.Pro177Leu missense ACTR1B 2 83212 2.4035E-5 41606 0 8.239E-6
2-98275028-G-A p.Gly173Gly synonymous ACTR1B 16 83182 1.92349E-4 41591 0 1.9489E-4
2-98275035-T-C p.Tyr171Cys missense ACTR1B 2 83178 2.40448E-5 41589 0 1.98881E-5
2-98275035-T-G p.Tyr171Ser missense ACTR1B 1 83178 1.20224E-5 41589 0 NA
2-98275045-C-T p.Val168Met missense ACTR1B 1 83090 1.20351E-5 41545 0 8.24022E-6
2-98275051-G-A p.His166Tyr missense ACTR1B 2 83062 2.40784E-5 41531 0 5.03525E-4
2-98275064-C-T p.Gly161Gly synonymous ACTR1B 2 82856 2.41383E-5 41428 0 1.64859E-5
2-98275065-CCT-C p.Asp162fs frameshift ACTR1B 5 82826 6.03675E-5 41413 0 1.5953E-4
2-98275073-T-C p.Leu158Leu synonymous ACTR1B 1 82692 1.20931E-5 41346 0 NA
2-98275088-C-T p.Thr153Thr synonymous ACTR1B 1 82292 1.21518E-5 41146 0 7.97188E-6
2-98275089-G-A p.Thr153Met missense ACTR1B 24 82212 2.91928E-4 41106 0 6.25E-4
2-98275091-G-T p.Arg152Arg synonymous ACTR1B 2 82144 2.43475E-5 41072 0 NA
2-98275093-G-A p.Arg152Cys missense ACTR1B 1 82066 1.21853E-5 41033 0 8.25014E-6
2-98275103-G-A p.Tyr148Tyr synonymous ACTR1B 1 81754 1.22318E-5 40877 0 6.25E-4
2-98275106-C-T p.Leu147Leu splice_region+synonymous ACTR1B 1 81662 1.22456E-5 40831 0 3.18898E-5
2-98275108-T-TG c.441-3dupC splice_region ACTR1B 1 81616 1.22525E-5 40808 0 NA
2-98275111-C-G c.441-5G>C splice_region ACTR1B 1 81518 1.22672E-5 40759 0 NA
2-98275335-C-T c.440+7G>A splice_region ACTR1B 1 83188 1.2021E-5 41594 0 1.19444E-5
2-98275341-C-G c.440+1G>C splice_donor ACTR1B 1 83224 1.20158E-5 41612 0 8.24049E-6
2-98275343-G-A p.Leu147Leu splice_region+synonymous ACTR1B 110 83244 0.00132142 41622 0 0.00280702
2-98275354-G-A p.Ala143Val missense ACTR1B 4647 83178 0.0558681 41589 185 0.0852802
2-98275362-G-A p.Ser140Ser synonymous ACTR1B 1 83254 1.20114E-5 41627 0 NA
2-98275363-G-A p.Ser140Phe missense ACTR1B 1 83258 1.20109E-5 41629 0 NA
2-98275377-C-T p.Pro135Pro synonymous ACTR1B 4 83272 4.80354E-5 41636 0 5.03525E-4
2-98275378-G-A p.Pro135Leu missense ACTR1B 2 83270 2.40183E-5 41635 0 8.23886E-6
2-98275382-C-T p.Val134Met missense ACTR1B 2 83266 2.40194E-5 41633 0 3.18857E-5
2-98275383-G-A p.Asn133Asn synonymous ACTR1B 125 83278 0.001501 41639 1 0.00114147
2-98275402-A-G p.Val127Ala missense ACTR1B 62 83262 7.44637E-4 41631 0 0.00194764
2-98275405-T-C p.Glu126Gly missense ACTR1B 1 83258 1.20109E-5 41629 0 3.97703E-6
2-98275410-C-T p.Ala124Ala synonymous ACTR1B 3 83238 3.60412E-5 41619 0 3.57935E-5
2-98275419-C-T p.Arg121Arg synonymous ACTR1B 1 83218 1.20166E-5 41609 0 2.47284E-5
2-98275432-G-A p.Pro117Leu missense ACTR1B 2 83184 2.40431E-5 41592 0 8.24756E-6
2-98275437-G-A p.Leu115Leu synonymous ACTR1B 6 83160 7.21501E-5 41580 0 3.18552E-5
2-98275441-G-A p.Pro114Leu missense ACTR1B 2 83130 2.40587E-5 41565 0 7.42685E-5
2-98275449-C-T p.Thr111Thr synonymous ACTR1B 352 83072 0.00423729 41536 2 0.00957661
2-98275450-G-A p.Thr111Met missense ACTR1B 3 83074 3.61124E-5 41537 0 4.77384E-5
2-98275469-G-T c.316-3C>A splice_region ACTR1B 1 82766 1.20823E-5 41383 0 3.18654E-5
2-98275470-C-T c.316-4G>A splice_region ACTR1B 6 82726 7.25286E-5 41363 0 1.59294E-5
2-98275471-G-A c.316-5C>T splice_region ACTR1B 2 82726 2.41762E-5 41363 0 2.38943E-5
2-98275474-G-A c.316-8C>T splice_region ACTR1B 121 82624 0.00146447 41312 0 0.00340808
2-98275807-C-T c.315+8G>A splice_region ACTR1B 2 81618 2.45044E-5 40809 0 7.96762E-6
2-98275808-G-A c.315+7C>T splice_region ACTR1B 1 81694 1.22408E-5 40847 0 3.18898E-5
2-98275821-C-T p.Ser103Ser synonymous ACTR1B 9 82050 1.09689E-4 41025 0 6.25E-4
2-98275822-GAGA-G p.Phe102del disruptive_inframe_deletion ACTR1B 1 82080 1.21832E-5 41040 0 NA
2-98275827-G-C p.Thr101Thr synonymous ACTR1B 2 82202 2.43303E-5 41101 0 8.25096E-6
2-98275832-G-A p.Gln100* stop_gained ACTR1B 1 82224 1.21619E-5 41112 0 NA
2-98275845-G-A p.Ser95Ser synonymous ACTR1B 2 82174 2.43386E-5 41087 0 3.97877E-6
2-98275848-G-A p.Tyr94Tyr synonymous ACTR1B 1 82142 1.2174E-5 41071 0 3.97867E-6
2-98275853-C-A p.Val93Phe missense ACTR1B 5 82082 6.09147E-5 41041 0 3.97877E-6
2-98275853-C-T p.Val93Ile missense ACTR1B 6 82082 7.30976E-5 41041 0 7.42182E-5
2-98275860-C-T p.Trp90* stop_gained ACTR1B 1 81994 1.2196E-5 40997 0 NA
2-98275860-C-A p.Trp90Cys missense ACTR1B 2 81994 2.4392E-5 40997 0 NA
2-98275863-G-C p.Ile89Met missense ACTR1B 4 81940 4.88162E-5 40970 0 NA
2-98275869-T-C p.Glu87Glu synonymous ACTR1B 2 81776 2.44571E-5 40888 0 NA
2-98275876-T-G p.Asp85Ala missense ACTR1B 44 81610 5.3915E-4 40805 0 2.50672E-4
2-98275889-G-A p.Arg81* stop_gained ACTR1B 1 81126 1.23265E-5 40563 0 7.96045E-6
2-98275898-C-T p.Gly78Ser missense ACTR1B 1 80964 1.23512E-5 40482 0 3.18959E-5
2-98275899-G-A p.His77His synonymous ACTR1B 2 80822 2.47457E-5 40411 0 8.24742E-6
2-98275907-T-C p.Met75Val missense ACTR1B 1 80848 1.23689E-5 40424 0 2.47464E-5
2-98275915-C-T p.Arg72His missense ACTR1B 1 80540 1.24162E-5 40270 0 8.25082E-6
2-98275916-G-A p.Arg72Cys missense ACTR1B 4 80604 4.96253E-5 40302 0 NA
2-98275920-G-C p.Thr70Thr synonymous ACTR1B 1 80636 1.24014E-5 40318 0 8.25178E-6
2-98275921-G-C p.Thr70Ser missense ACTR1B 1 80608 1.24057E-5 40304 0 NA
2-98275923-C-T p.Leu69Leu synonymous ACTR1B 3 80482 3.72754E-5 40241 0 2.98979E-4
2-98275935-G-A p.His65His synonymous ACTR1B 1 79984 1.25025E-5 39992 0 3.993E-6
2-98277026-G-A c.189+8C>T splice_region ACTR1B 2 82934 2.41156E-5 41467 0 9.55597E-5
2-98277027-G-C c.189+7C>G splice_region ACTR1B 3 82968 3.61585E-5 41484 0 3.18512E-5
2-98277030-T-A c.189+4A>T splice_region ACTR1B 2 83006 2.40946E-5 41503 0 1.15492E-4
2-98277045-G-A p.Pro60Ser missense ACTR1B 1 83054 1.20404E-5 41527 0 NA
2-98277049-G-A p.Ile58Ile synonymous ACTR1B 138 83050 0.00166165 41525 1 0.00283421
2-98277051-T-C p.Ile58Val missense ACTR1B 1 83064 1.20389E-5 41532 0 5.03525E-4
2-98277061-C-A p.Gly54Gly synonymous ACTR1B 1 83060 1.20395E-5 41530 0 3.97788E-6
2-98277078-C-A p.Ala49Ser missense ACTR1B 2 82990 2.40993E-5 41495 0 8.25055E-6
2-98277084-C-T p.Val47Met missense ACTR1B 8 83012 9.63716E-5 41506 0 8.25164E-6
2-98277087-G-A p.Arg46Trp missense ACTR1B 2 82986 2.41005E-5 41493 0 8.2526E-6
2-98277089-A-T p.Met45Lys missense ACTR1B 1 82988 1.20499E-5 41494 0 NA
2-98277090-T-C p.Met45Val missense ACTR1B 9822 82794 0.118632 41397 830 0.160624
2-98277092-T-G p.His44Pro missense ACTR1B 1 82972 1.20523E-5 41486 0 8.25314E-6
2-98277097-C-T p.Pro42Pro synonymous ACTR1B 4 82942 4.82265E-5 41471 0 9.90638E-5
2-98277098-G-A p.Pro42Leu missense ACTR1B 2 82932 2.41161E-5 41466 0 NA
2-98277101-C-T p.Arg41Gln missense ACTR1B 1 82916 1.20604E-5 41458 0 8.25505E-6
2-98278338-C-T c.113+7G>A splice_region ACTR1B 3 82384 3.64148E-5 41192 0 9.50471E-6
2-98278349-T-C p.Asn37Asp missense ACTR1B 1 82486 1.21233E-5 41243 0 7.78655E-5
2-98278360-T-C p.Tyr33Cys missense ACTR1B 1 82530 1.21168E-5 41265 0 NA
2-98278368-A-T p.Ile30Ile synonymous ACTR1B 5 82544 6.05738E-5 41272 0 1.33583E-5
2-98278388-C-T p.Gly24Ser missense ACTR1B 1 82550 1.21139E-5 41275 0 NA
2-98278399-A-G p.Val20Ala missense ACTR1B 1 82404 1.21353E-5 41202 0 4.67434E-6
2-98278400-C-A p.Val20Leu missense ACTR1B 1 82450 1.21286E-5 41225 0 4.18247E-5
2-98278404-C-G p.Ser18Ser synonymous ACTR1B 2 82394 2.42736E-5 41197 0 4.80284E-5
2-98278404-C-T p.Ser18Ser synonymous ACTR1B 3 82394 3.64104E-5 41197 0 9.60569E-5
2-98278413-C-A c.49-4G>T splice_region ACTR1B 2 82284 2.43061E-5 41142 0 4.95653E-6
2-98280303-C-G c.48+3G>C splice_region ACTR1B 1 63334 1.57893E-5 31667 0 NA
2-98280328-T-C p.Asn9Ser missense ACTR1B 1 64416 1.55241E-5 32208 0 NA
2-98280347-A-G p.Ser3Pro missense ACTR1B 1 62002 1.61285E-5 31001 0 NA
2-98280357-C-A c.-4G>T 5_prime_UTR_premature_start_codon_gain ACTR1B 1 58046 1.72277E-5 29023 0 NA
2-98280358-G-A c.-5C>T 5_prime_UTR_premature_start_codon_gain ACTR1B 3 57776 5.19247E-5 28888 0 6.31313E-4
2-98280368-G-A c.-15C>T 5_prime_UTR_premature_start_codon_gain ACTR1B 1 54062 1.84973E-5 27031 0 1.01874E-4
2-98280382-G-A c.-29C>T 5_prime_UTR_premature_start_codon_gain ACTR1B 1 46652 2.14353E-5 23326 0 NA
2-98280400-C-G c.-47G>C 5_prime_UTR_premature_start_codon_gain ACTR1B 166 35056 0.00473528 17528 2 0.0102048
2-98280414-G-A c.-61C>T 5_prime_UTR_premature_start_codon_gain ACTR1B 2 31424 6.36456E-5 15712 0 2.32065E-4
2-98280418-G-A c.-65C>T 5_prime_UTR_premature_start_codon_gain ACTR1B 1 32734 3.05493E-5 16367 0 NA
2-98280432-G-A c.-79C>T 5_prime_UTR_premature_start_codon_gain ACTR1B 2 34090 5.86682E-5 17045 0 NA
2-98280438-G-A c.-85C>T 5_prime_UTR_premature_start_codon_gain ACTR1B 10 32586 3.0688E-4 16293 0 0.00233645
2-98280515-G-A c.-162C>T 5_prime_UTR_premature_start_codon_gain ACTR1B 2 19958 1.0021E-4 9979 0 NA