Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
10-104240621-T-C p.Ter377Ter stop_retained ACTR1A 1 83332 1.20002E-5 41666 0 3.97687E-6
10-104240626-G-A p.Thr375Thr synonymous ACTR1A 2 83344 2.39969E-5 41672 0 1.98837E-5
10-104240633-C-T p.Arg373Lys missense ACTR1A 1 83342 1.19988E-5 41671 0 NA
10-104240653-G-C p.Asp366Glu missense ACTR1A 1 83352 1.19973E-5 41676 0 3.57878E-5
10-104240653-G-A p.Asp366Asp synonymous ACTR1A 2 83352 2.39946E-5 41676 0 2.47093E-5
10-104240672-T-C p.Lys360Arg missense ACTR1A 1 83352 1.19973E-5 41676 0 NA
10-104240703-G-A p.Pro329Leu missense ACTR1A 1 83318 1.20022E-5 41659 0 NA
10-104240713-G-A p.Pro326Ser missense ACTR1A 1 83300 1.20048E-5 41650 0 6.25E-4
10-104240719-G-A p.Leu324Phe missense ACTR1A 2 83292 2.40119E-5 41646 0 3.18715E-5
10-104240883-A-G c.1028+6T>C splice_region ACTR1A 1 83320 1.20019E-5 41660 0 NA
10-104240897-C-A p.Val320Leu missense ACTR1A 3 83314 3.60084E-5 41657 0 NA
10-104240897-C-T p.Val320Met missense ACTR1A 1 83314 1.20028E-5 41657 0 5.03525E-4
10-104240903-A-G p.Phe318Leu missense ACTR1A 1 83324 1.20013E-5 41662 0 NA
10-104240918-A-T p.Ser313Thr missense ACTR1A 1 83312 1.20031E-5 41656 0 5.3945E-5
10-104241646-T-C p.Asp312Gly missense ACTR1A 1 83166 1.20241E-5 41583 0 NA
10-104241651-AAAACCTGAATGGGCAAAGAGGAGAACTTCAAGTCAATTCTCAGGGTGCCTGGAGCCAGCAGGAGCTGAACACTTCCAGGGGAAGGGCTCCAAGAGAAGAGAC-A p.Gly309fs frameshift ACTR1A 9 83194 1.08181E-4 41597 2 NA
10-104241651-A-G p.Phe310Phe synonymous ACTR1A 1 83196 1.20198E-5 41598 0 1.19295E-5
10-104241658-G-A c.926-3C>T splice_region ACTR1A 1 83220 1.20163E-5 41610 0 NA
10-104241660-A-G c.926-5T>C splice_region ACTR1A 1 83224 1.20158E-5 41612 0 NA
10-104241767-G-A p.Leu306Leu synonymous ACTR1A 1 83356 1.19967E-5 41678 0 NA
10-104241804-C-T p.Thr293Thr synonymous ACTR1A 2 83350 2.39952E-5 41675 0 3.295E-5
10-104241807-G-A p.Arg292Arg synonymous ACTR1A 1 83354 1.1997E-5 41677 0 3.1839E-5
10-104241828-C-T p.Lys285Lys synonymous ACTR1A 1 83372 1.19944E-5 41686 0 NA
10-104241852-C-T p.Glu277Glu synonymous ACTR1A 1 83348 1.19979E-5 41674 0 NA
10-104241855-G-A p.His276His synonymous ACTR1A 18 83336 2.15993E-4 41668 0 4.37463E-5
10-104241914-G-A p.Arg257Trp missense ACTR1A 1 83206 1.20184E-5 41603 0 3.9969E-6
10-104241914-G-C p.Arg257Gly missense ACTR1A 1 83206 1.20184E-5 41603 0 NA
10-104241931-A-G p.Ile251Thr missense+splice_region ACTR1A 4 83016 4.81835E-5 41508 0 9.56084E-5
10-104241936-C-T c.751-4G>A splice_region ACTR1A 2 82944 2.41127E-5 41472 0 2.49314E-5
10-104242760-C-A c.750+8G>T splice_region ACTR1A 1 83252 1.20117E-5 41626 0 3.18492E-5
10-104242762-A-G c.750+6T>C splice_region ACTR1A 19 83258 2.28206E-4 41629 0 1.91131E-4
10-104242771-A-G n.689T>C splice_region ACTR1A 1 83290 1.20062E-5 41645 0 NA
10-104242788-G-T p.Pro244Thr missense ACTR1A 1 83312 1.20031E-5 41656 0 NA
10-104242819-C-T p.Thr233Thr synonymous ACTR1A 3 83322 3.60049E-5 41661 0 8.23642E-6
10-104242836-G-A p.Pro228Ser missense ACTR1A 3 83300 3.60144E-5 41650 0 8.23642E-6
10-104242836-G-C p.Pro228Ala missense ACTR1A 2 83300 2.40096E-5 41650 0 NA
10-104242836-G-T p.Pro228Thr missense ACTR1A 1 83300 1.20048E-5 41650 0 NA
10-104243909-G-A c.657+8C>T splice_region ACTR1A 1 83186 1.20213E-5 41593 0 NA
10-104243910-C-T c.657+7G>A splice_region ACTR1A 1 83202 1.20189E-5 41601 0 3.97826E-6
10-104243914-T-C c.657+3A>G splice_region ACTR1A 3 83246 3.60378E-5 41623 0 7.95494E-6
10-104243953-T-A p.Ser207Ser synonymous ACTR1A 2 83346 2.39964E-5 41673 0 NA
10-104243956-G-A p.His206His synonymous ACTR1A 13 83346 1.55976E-4 41673 0 5.16936E-5
10-104243964-C-T p.Asp204Asn missense ACTR1A 7 83340 8.39933E-5 41670 0 6.37186E-5
10-104243965-G-A p.Tyr203Tyr synonymous ACTR1A 7 83338 8.39953E-5 41669 0 4.94364E-5
10-104243971-C-T p.Glu201Glu synonymous ACTR1A 1 83350 1.19976E-5 41675 0 NA
10-104243979-G-A p.Arg199Cys missense ACTR1A 2 83346 2.39964E-5 41673 0 NA
10-104243990-C-T p.Arg195His missense ACTR1A 2 83330 2.4001E-5 41665 0 2.47231E-5
10-104243995-G-A p.Phe193Phe synonymous ACTR1A 9 83336 1.07997E-4 41668 0 8.24131E-5
10-104244000-G-A p.Arg192Cys missense ACTR1A 2 83312 2.40061E-5 41656 0 7.95279E-6
10-104244004-G-T p.Val190Val synonymous ACTR1A 1 83312 1.20031E-5 41656 0 NA
10-104244007-G-A p.Asp189Asp synonymous ACTR1A 1 83310 1.20034E-5 41655 0 4.12113E-5
10-104244012-G-A p.Arg188Trp missense ACTR1A 1 83286 1.20068E-5 41643 0 3.97655E-6
10-104244024-C-T p.Asp184Asn missense ACTR1A 2 83282 2.40148E-5 41641 0 8.24416E-6
10-104244025-G-A p.Ile183Ile synonymous ACTR1A 1 83286 1.20068E-5 41643 0 1.59075E-5
10-104244027-T-C p.Ile183Val missense ACTR1A 1 83282 1.20074E-5 41641 0 7.9533E-6
10-104244035-A-T p.Ile180Asn missense ACTR1A 1 83262 1.20103E-5 41631 0 NA
10-104244039-A-T p.Ser179Thr missense ACTR1A 2 83252 2.40234E-5 41626 0 5.56744E-5
10-104244040-G-A p.His178His synonymous ACTR1A 1 83252 1.20117E-5 41626 0 3.9769E-6
10-104244046-C-T p.Met176Ile missense ACTR1A 1 83220 1.20163E-5 41610 0 NA
10-104244061-A-G p.Tyr171Tyr synonymous ACTR1A 1 83200 1.20192E-5 41600 0 3.9776E-6
10-104244079-G-A p.Thr165Thr synonymous ACTR1A 1 83100 1.20337E-5 41550 0 3.18817E-5
10-104244116-G-A p.Thr153Ile missense ACTR1A 1 82592 1.21077E-5 41296 0 8.33528E-6
10-104244139-G-T c.441-6C>A splice_region ACTR1A 20840 76866 0.271121 38433 2083 0.330365
10-104244140-C-G c.441-7G>C splice_region ACTR1A 1 81908 1.22088E-5 40954 0 NA
10-104245363-C-T c.440+3G>A splice_region ACTR1A 2 83170 2.40471E-5 41585 0 1.51164E-4
10-104245398-A-G p.Ala136Ala synonymous ACTR1A 2 83324 2.40027E-5 41662 1 NA
10-104245401-G-A p.Pro135Pro synonymous ACTR1A 7 83322 8.40114E-5 41661 0 6.37146E-5
10-104245407-A-G p.Asn133Asn synonymous ACTR1A 1 83350 1.19976E-5 41675 0 3.18114E-5
10-104245418-C-G p.Glu130Gln missense ACTR1A 1 83362 1.19959E-5 41681 0 NA
10-104245419-G-A p.Phe129Phe synonymous ACTR1A 2 83362 2.39917E-5 41681 0 3.29685E-5
10-104245443-C-T p.Arg121Arg synonymous ACTR1A 6 83350 7.19856E-5 41675 0 5.05051E-4
10-104245444-C-T p.Arg121Gln missense ACTR1A 2 83346 2.39964E-5 41673 0 2.47292E-5
10-104245451-T-C p.Lys119Glu missense ACTR1A 1 83356 1.19967E-5 41678 0 NA
10-104245460-T-C p.Asn116Asp missense ACTR1A 1 83346 1.19982E-5 41673 0 NA
10-104245467-C-T p.Ala113Ala synonymous ACTR1A 2 83332 2.40004E-5 41666 0 1.64913E-5
10-104245476-C-T p.Leu110Leu synonymous ACTR1A 2 83334 2.39998E-5 41667 0 NA
10-104245496-G-A c.316-6C>T splice_region ACTR1A 5 83278 6.00399E-5 41639 0 NA
10-104247901-C-T c.315+6G>A splice_region ACTR1A 4 83150 4.81058E-5 41575 0 NA
10-104247943-G-C p.Val93Val synonymous ACTR1A 5 83314 6.00139E-5 41657 0 1.64731E-5
10-104247960-G-A p.Arg88Cys missense ACTR1A 1 83356 1.19967E-5 41678 0 3.18715E-5
10-104247970-G-A p.Asn84Asn synonymous ACTR1A 1 83356 1.19967E-5 41678 0 6.37552E-5
10-104247984-C-T p.Val80Ile missense ACTR1A 5 83352 5.99866E-5 41676 0 3.57887E-5
10-104247999-T-C p.Met1? start_lost ACTR1A 1 83334 1.19999E-5 41667 0 3.97652E-6
10-104248007-C-T p.Arg72His missense ACTR1A 3 83312 3.60092E-5 41656 0 0.00151057
10-104248008-G-A p.Arg72Cys missense ACTR1A 7 83326 8.40074E-5 41663 0 0.00125
10-104248036-G-A c.190-4C>T splice_region ACTR1A 1 83118 1.20311E-5 41559 0 NA
10-104248037-G-A c.190-5C>T splice_region ACTR1A 1 83108 1.20325E-5 41554 0 3.18532E-5
10-104248039-A-G c.190-7T>C splice_region ACTR1A 2 83112 2.40639E-5 41556 0 8.23791E-6
10-104248832-G-T p.Gly59Gly synonymous ACTR1A 2 82870 2.41342E-5 41435 0 2.48789E-5
10-104248847-G-A p.Gly54Gly synonymous ACTR1A 5 82972 6.02613E-5 41486 0 5.03525E-4
10-104248872-C-T p.Arg46His missense ACTR1A 2 83054 2.40807E-5 41527 0 NA
10-104248876-C-T p.Val45Ile missense ACTR1A 4 83028 4.81765E-5 41514 0 1.59327E-4
10-104248877-G-A c.-10C>T 5_prime_UTR_premature_start_codon_gain ACTR1A 22 83036 2.64945E-4 41518 0 0.00352467
10-104248883-G-A p.Pro42Pro synonymous ACTR1A 1 82972 1.20523E-5 41486 0 8.29297E-6
10-104248895-A-ATAGTTTGGAAAG c.114-1_114insCTTTCCAAACTA splice_acceptor ACTR1A 2 82768 2.41639E-5 41384 1 NA
10-104248895-AC-A c.114-1delG splice_acceptor ACTR1A 2 82766 2.41645E-5 41383 1 NA
10-104248895-A-ATAGTTTGGAAAGCAGTATTTGGGGAT c.114-1_114insATCCCCAAATACTGCTTTCCAAACTA splice_acceptor ACTR1A 2 82768 2.41639E-5 41384 1 NA
10-104248895-A-G p.Tyr38Tyr splice_region+synonymous ACTR1A 2 82768 2.41639E-5 41384 0 3.18593E-5
10-104248903-A-C c.114-8T>G splice_region ACTR1A 1 82440 1.213E-5 41220 0 NA
10-104250336-TCAC-T p.Gly27del disruptive_inframe_deletion ACTR1A 1 83290 1.20062E-5 41645 0 NA
10-104250358-T-G p.Ile21Leu missense ACTR1A 1 83280 1.20077E-5 41640 0 3.97728E-6
10-104250365-G-A c.-93C>T 5_prime_UTR_premature_start_codon_gain ACTR1A 2 83262 2.40206E-5 41631 0 3.31186E-5
10-104250370-C-CGTTGTCGATCACGACAGGCTGGTTGGCGATCACATCGTAGGACTCCATGG c.49-1_49insCCATGGAGTCCTACGATGTGATCGCCAACCAGCCTGTCGTGATCGACAAC splice_acceptor ACTR1A 1 83264 1.201E-5 41632 0 NA
10-104250375-GGAAA-G c.49-9_49-6delTTTC splice_region ACTR1A 1 83232 1.20146E-5 41616 0 NA
10-104262384-G-A c.-56C>T 5_prime_UTR_premature_start_codon_gain ACTR1A 1 83290 1.20062E-5 41645 0 0.0025
10-104262396-G-A p.Ser3Ser synonymous ACTR1A 1 83266 1.20097E-5 41633 0 NA
10-104262454-C-A c.-50G>T 5_prime_UTR_premature_start_codon_gain ACTR1A 3 82484 3.63707E-5 41242 0 5.63462E-5
10-104262457-T-C c.-53A>G 5_prime_UTR_premature_start_codon_gain ACTR1A 2 82360 2.42836E-5 41180 0 NA
10-104262465-C-G c.-61G>C 5_prime_UTR_premature_start_codon_gain ACTR1A 7 82042 8.53221E-5 41021 0 NA
10-104262465-C-T c.-61G>A 5_prime_UTR_premature_start_codon_gain ACTR1A 1 82042 1.21889E-5 41021 0 NA