Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-39138318-G-T c.-68G>T 5_prime_UTR_premature_start_codon_gain ACTN4 1 63252 1.58098E-5 31626 0 NA
19-39138322-C-G c.-64C>G 5_prime_UTR_premature_start_codon_gain ACTN4 10 64080 1.56055E-4 32040 0 0.00126103
19-39138322-C-T c.-64C>T 5_prime_UTR_premature_start_codon_gain ACTN4 1 64080 1.56055E-5 32040 0 NA
19-39138323-G-T c.-63G>T 5_prime_UTR_premature_start_codon_gain ACTN4 1 64350 1.554E-5 32175 0 3.21316E-5
19-39138383-G-A p.Gly2Arg missense ACTN4 1 72970 1.37043E-5 36485 0 1.38162E-5
19-39138400-C-T p.His5His synonymous ACTN4 2 74546 2.68291E-5 37273 0 NA
19-39138410-C-G p.Gln9Glu missense ACTN4 2 75260 2.65745E-5 37630 0 5.72344E-5
19-39138425-G-C p.Gly14Arg missense ACTN4 2 75824 2.63769E-5 37912 0 NA
19-39138427-C-T p.Gly14Gly synonymous ACTN4 1 75806 1.31916E-5 37903 0 NA
19-39138438-C-T p.Ala18Val missense ACTN4 1 76234 1.31175E-5 38117 0 3.19959E-5
19-39138440-G-T p.Gly19Cys missense ACTN4 6 76464 7.84683E-5 38232 0 3.19428E-5
19-39138444-A-G p.Asn20Ser missense ACTN4 4 76662 5.21771E-5 38331 0 1.84232E-5
19-39138448-C-A p.Gly21Gly synonymous ACTN4 2 76528 2.61342E-5 38264 0 NA
19-39138448-C-T p.Gly21Gly synonymous ACTN4 2 76528 2.61342E-5 38264 0 1.04778E-4
19-39138450-C-T p.Ala22Val missense ACTN4 3 76606 3.91614E-5 38303 0 0.00206398
19-39138454-C-T p.Gly23Gly synonymous ACTN4 1 76556 1.30623E-5 38278 0 6.3389E-6
19-39138457-C-G p.Gly24Gly synonymous ACTN4 1 76584 1.30576E-5 38292 0 NA
19-39138462-G-A p.Gly26Asp missense ACTN4 1 76702 1.30375E-5 38351 0 NA
19-39138467-A-G p.Met28Val missense ACTN4 3 76640 3.91441E-5 38320 0 6.40328E-5
19-39138473-G-A p.Asp30Asn missense ACTN4 1 76694 1.30388E-5 38347 0 3.20041E-5
19-39138483-C-T p.Ala33Val missense ACTN4 1 76902 1.30036E-5 38451 0 NA
19-39138553-C-T c.162+6C>T splice_region ACTN4 5 70896 7.05258E-5 35448 0 9.1617E-4
19-39191247-C-T p.Thr57Met missense ACTN4 6 83054 7.22422E-5 41527 0 1.64872E-5
19-39191259-A-G p.Asn61Ser missense ACTN4 2 83092 2.40697E-5 41546 0 NA
19-39191260-C-T p.Asn61Asn synonymous ACTN4 1 83100 1.20337E-5 41550 0 5.03525E-4
19-39191279-G-C p.Gly68Arg missense ACTN4 1 83144 1.20273E-5 41572 0 NA
19-39191317-C-T p.Asp80Asp synonymous ACTN4 1 83030 1.20438E-5 41515 0 3.18735E-5
19-39191323-C-T p.Leu82Leu synonymous ACTN4 2311 82924 0.0278689 41462 50 0.0438066
19-39191329-C-T p.Leu84Leu synonymous ACTN4 5 82974 6.02598E-5 41487 0 3.18552E-5
19-39191357-G-T c.277+3G>T splice_region ACTN4 1 82670 1.20963E-5 41335 0 NA
19-39191637-C-A c.278-5C>A splice_region ACTN4 1 82566 1.21115E-5 41283 0 NA
19-39191648-G-A p.Arg95Gln missense ACTN4 2 82814 2.41505E-5 41407 0 NA
19-39191655-T-G p.Pro97Pro synonymous ACTN4 1 82922 1.20595E-5 41461 0 NA
19-39191661-G-A p.Pro99Pro synonymous ACTN4 15 82980 1.80766E-4 41490 0 2.86734E-4
19-39191664-G-A p.Glu100Glu synonymous ACTN4 1 83024 1.20447E-5 41512 0 2.47725E-5
19-39191670-G-T p.Gly102Gly synonymous ACTN4 6 83076 7.2223E-5 41538 0 0.00100705
19-39191679-A-G p.Arg105Arg synonymous ACTN4 1 83148 1.20267E-5 41574 0 3.97719E-6
19-39191688-A-G p.Lys108Lys synonymous ACTN4 1 83178 1.20224E-5 41589 0 NA
19-39191709-G-A p.Ala115Ala synonymous ACTN4 2 83178 2.40448E-5 41589 0 6.36943E-5
19-39191709-G-T p.Ala115Ala synonymous ACTN4 3 83178 3.60672E-5 41589 0 2.78388E-5
19-39191710-C-T p.Leu116Leu synonymous ACTN4 1 83178 1.20224E-5 41589 0 9.55414E-5
19-39191718-T-C p.Phe118Phe synonymous ACTN4 1 83182 1.20218E-5 41591 0 NA
19-39191733-C-T p.Gly123Gly synonymous ACTN4 628 83142 0.00755334 41571 5 0.0100006
19-39191736-C-G p.Val124Val synonymous ACTN4 2 83162 2.40494E-5 41581 0 6.3678E-5
19-39191738-A-G p.Lys125Arg missense ACTN4 1 83158 1.20253E-5 41579 0 8.24198E-6
19-39191739-G-A p.Lys125Lys synonymous ACTN4 1 83156 1.20256E-5 41578 0 3.97728E-6
19-39191760-A-G p.Glu132Glu splice_region+synonymous ACTN4 1 83028 1.20441E-5 41514 0 NA
19-39191761-G-GAGATT c.397_397+1insAGATT splice_donor ACTN4 1 83008 1.2047E-5 41504 0 NA
19-39195568-G-A c.398-6G>A splice_region ACTN4 1 83262 1.20103E-5 41631 0 3.97646E-6
19-39195571-C-A c.398-3C>A splice_region ACTN4 2 83260 2.40211E-5 41630 1 NA
19-39195584-C-T p.Asp136Asp synonymous ACTN4 3 83304 3.60127E-5 41652 0 8.23805E-6
19-39195585-G-A p.Gly137Ser missense ACTN4 1 83310 1.20034E-5 41655 0 5.03525E-4
19-39195590-C-T p.Asn138Asn synonymous ACTN4 6 83322 7.20098E-5 41661 0 9.55901E-5
19-39195635-C-T p.Phe153Phe synonymous ACTN4 1 83336 1.19996E-5 41668 0 5.76663E-5
19-39195636-G-A p.Ala154Thr missense ACTN4 2 83330 2.4001E-5 41665 0 NA
19-39195653-C-T p.Ser159Ser synonymous ACTN4 63 83318 7.56139E-4 41659 0 6.25E-4
19-39196688-C-T p.Thr163Thr synonymous ACTN4 1 83252 1.20117E-5 41626 0 2.47182E-5
19-39196691-G-A p.Ser164Ser synonymous ACTN4 1 83262 1.20103E-5 41631 0 8.23886E-6
19-39196696-A-G p.Lys166Arg missense ACTN4 1 83280 1.20077E-5 41640 0 NA
19-39196705-T-C p.Leu169Pro missense ACTN4 1 83288 1.20065E-5 41644 0 NA
19-39196735-C-T p.Pro179Leu missense ACTN4 91 83216 0.00109354 41608 1 0.00312221
19-39196736-G-A p.Pro179Pro synonymous ACTN4 15398 83006 0.185505 41503 1629 0.265357
19-39196745-C-T p.Asn182Asn synonymous ACTN4 32811 82782 0.396354 41391 6825 0.410606
19-39196746-G-A p.Val183Ile missense ACTN4 1 83174 1.2023E-5 41587 0 8.24035E-6
19-39196769-C-T p.Ile190Ile splice_region+synonymous ACTN4 1 82894 1.20636E-5 41447 0 NA
19-39196774-A-G c.572+3A>G splice_region ACTN4 1 82784 1.20796E-5 41392 0 1.65412E-5
19-39196776-G-T c.572+5G>T splice_region ACTN4 1 82794 1.20782E-5 41397 0 6.37146E-5
19-39196777-C-T c.572+6C>T splice_region ACTN4 2 82764 2.41651E-5 41382 0 8.28199E-6
19-39196778-G-A c.572+7G>A splice_region ACTN4 3 82712 3.62704E-5 41356 0 3.18352E-5
19-39198753-C-G c.573-4C>G splice_region ACTN4 2 83290 2.40125E-5 41645 0 NA
19-39198757-C-T p.Ser191Ser splice_region+synonymous ACTN4 6 83304 7.20254E-5 41652 1 9.0617E-5
19-39198787-G-A p.Leu201Leu synonymous ACTN4 1 83328 1.20008E-5 41664 0 NA
19-39198795-G-A p.Arg204Gln missense ACTN4 1 83324 1.20013E-5 41662 0 1.6475E-5
19-39198808-G-A p.Glu208Glu synonymous ACTN4 2 83314 2.40056E-5 41657 0 NA
19-39198817-G-A p.Glu211Glu synonymous ACTN4 1 83310 1.20034E-5 41655 0 NA
19-39198841-T-C c.651+6T>C splice_region ACTN4 2 83200 2.40385E-5 41600 0 3.19366E-5
19-39200032-T-C c.652-3T>C splice_region ACTN4 2 83224 2.40315E-5 41612 0 2.47288E-5
19-39200048-C-G p.Thr222Ser missense ACTN4 2 83256 2.40223E-5 41628 0 3.18471E-5
19-39200049-C-G p.Thr222Thr synonymous ACTN4 1 83262 1.20103E-5 41631 0 NA
19-39200085-C-T p.Tyr234Tyr synonymous ACTN4 1 83274 1.20085E-5 41637 0 NA
19-39200088-C-T p.Leu235Leu synonymous ACTN4 3 83268 3.60282E-5 41634 0 6.37024E-5
19-39200097-C-T p.Pro238Pro synonymous ACTN4 1 83258 1.20109E-5 41629 0 3.18492E-5
19-39200124-A-G c.733+8A>G splice_region ACTN4 1 83056 1.20401E-5 41528 0 NA
19-39200901-C-T p.Ile246Ile synonymous ACTN4 37 82712 4.47335E-4 41356 0 9.88142E-4
19-39200915-G-A p.Arg251Gln missense ACTN4 3 82832 3.62179E-5 41416 0 8.24851E-6
19-39200919-C-T p.Pro252Pro synonymous ACTN4 1 82858 1.20688E-5 41429 0 5.56979E-5
19-39200922-C-T p.Asp253Asp synonymous ACTN4 4 82882 4.82614E-5 41441 0 4.12419E-5
19-39200923-G-A p.Glu254Lys missense ACTN4 1 82890 1.20642E-5 41445 0 3.19E-5
19-39200946-G-T p.Val261Val synonymous ACTN4 1 82878 1.20659E-5 41439 0 8.25423E-6
19-39200952-C-T p.Ser263Ser synonymous ACTN4 2 82864 2.41359E-5 41432 0 8.25696E-6
19-39200987-C-T c.819+5C>T splice_region ACTN4 1 81898 1.22103E-5 40949 0 NA
19-39201883-CCTCTCTCTCTCTTT-C c.137-20_137-7delTTCTCTCTCTCTCT splice_region ACTN4 2 65742 3.0422E-5 32871 0 NA
19-39201896-TTC-T c.137-8_137-7delCT splice_region ACTN4 10 66988 1.4928E-4 33494 0 0.00247525
19-39201896-TTCTC-T c.137-10_137-7delCTCT splice_region ACTN4 3 67226 4.46256E-5 33613 0 1.17869E-4
19-39201910-G-C c.137-6G>C splice_region ACTN4 1 68276 1.46464E-5 34138 0 6.37877E-5
19-39201912-G-A c.137-4G>A splice_region ACTN4 17 68406 2.48516E-4 34203 0 3.6245E-4
19-39201953-C-T p.Ile58Ile synonymous ACTN4 1 69822 1.43221E-5 34911 0 1.06304E-5
19-39201956-G-T p.Met59Ile missense ACTN4 8 69792 1.14626E-4 34896 0 NA
19-39201960-T-TA p.Tyr61fs frameshift ACTN4 1 69800 1.43266E-5 34900 0 NA
19-39201962-C-T p.Tyr61Tyr synonymous ACTN4 3 69820 4.29676E-5 34910 0 9.62232E-5
19-39201968-C-T p.Ser63Ser synonymous ACTN4 1 69800 1.43266E-5 34900 0 2.11833E-5
19-39201988-C-T p.Ser70Leu missense ACTN4 2 69428 2.88068E-5 34714 0 5.09788E-5
19-39201989-G-A p.Ser70Ser synonymous ACTN4 5 69340 7.21085E-5 34670 1 6.37511E-5
19-39201992-G-C p.Gly71Gly synonymous ACTN4 8 69252 1.1552E-4 34626 0 1.04411E-4
19-39205103-C-T c.820-6C>T splice_region ACTN4 2 79600 2.51256E-5 39800 0 1.68739E-5
19-39205116-C-T p.Thr276Ile missense ACTN4 1 80500 1.24224E-5 40250 0 NA
19-39205120-C-T p.Ala277Ala synonymous ACTN4 2 80626 2.48059E-5 40313 0 1.59226E-4
19-39205125-A-T p.Asn279Ile missense ACTN4 2 80964 2.47023E-5 40482 0 NA
19-39205125-A-G p.Asn279Ser missense ACTN4 1 80964 1.23512E-5 40482 0 3.1841E-5
19-39205126-C-G p.Asn279Lys missense ACTN4 1 81006 1.23448E-5 40503 0 8.32362E-6
19-39205127-C-A p.Arg280Arg synonymous ACTN4 2 80990 2.46944E-5 40495 0 1.66431E-5
19-39205134-G-A p.Cys282Tyr missense ACTN4 1 81286 1.23022E-5 40643 0 NA
19-39205140-T-C p.Val284Ala missense ACTN4 1 81368 1.22898E-5 40684 0 NA
19-39205162-C-T p.Asn291Asn synonymous ACTN4 2 81460 2.45519E-5 40730 0 9.55779E-5
19-39205176-A-G p.Glu296Gly missense ACTN4 1 81410 1.22835E-5 40705 0 3.18593E-5
19-39205183-C-T p.Tyr298Tyr synonymous ACTN4 11 81116 1.35608E-4 40558 0 3.56663E-4
19-39205184-G-A p.Glu299Lys missense ACTN4 1 81060 1.23365E-5 40530 0 NA
19-39205207-T-A c.912+6T>A splice_region ACTN4 1 79964 1.25056E-5 39982 0 7.17349E-5
19-39205208-G-A c.912+7G>A splice_region ACTN4 3 79860 3.75657E-5 39930 0 NA
19-39207720-C-T c.913-6C>T splice_region ACTN4 1 81334 1.2295E-5 40667 0 NA
19-39207734-G-C p.Glu307Asp missense ACTN4 1 81776 1.22285E-5 40888 0 NA
19-39207741-C-T p.Arg310Trp missense ACTN4 5 81986 6.0986E-5 40993 0 6.37146E-5
19-39207742-G-A p.Arg310Gln missense ACTN4 997 81914 0.0121713 40957 9 0.016875
19-39207745-G-A p.Arg311His missense ACTN4 7 82066 8.52972E-5 41033 0 0.00151057
19-39207760-T-C p.Leu316Pro missense ACTN4 1 82536 1.21159E-5 41268 0 NA
19-39207768-C-T p.Arg319Cys missense ACTN4 1 82746 1.20852E-5 41373 0 NA
19-39207776-C-T p.Pro321Pro synonymous ACTN4 2 82888 2.41289E-5 41444 0 1.19479E-5
19-39207789-C-G p.Gln326Glu missense ACTN4 1 83036 1.2043E-5 41518 0 NA
19-39207791-G-A p.Gln326Gln synonymous ACTN4 226 83040 0.00272158 41520 4 0.00580673
19-39207818-C-T p.Phe335Phe synonymous ACTN4 1 83152 1.20262E-5 41576 0 1.1935E-5
19-39207819-C-G p.Arg336Gly missense ACTN4 1 83152 1.20262E-5 41576 0 NA
19-39207821-C-T p.Arg336Arg synonymous ACTN4 1 83154 1.20259E-5 41577 0 2.48332E-5
19-39207827-C-T p.Tyr338Tyr synonymous ACTN4 2 83176 2.40454E-5 41588 0 NA
19-39207828-C-T p.Arg339Trp missense ACTN4 1 83176 1.20227E-5 41588 0 3.97848E-6
19-39207830-G-A p.Arg339Arg synonymous ACTN4 1 83186 1.20213E-5 41593 0 8.27061E-6
19-39207848-C-T p.Pro345Pro synonymous ACTN4 1 83200 1.20192E-5 41600 0 NA
19-39207876-A-G p.Ile355Val missense ACTN4 1 83168 1.20239E-5 41584 0 NA
19-39207890-G-A p.Thr359Thr synonymous ACTN4 8 82988 9.63995E-5 41494 0 2.26799E-4
19-39207908-C-T p.Arg365Arg synonymous ACTN4 1 82704 1.20913E-5 41352 0 8.31545E-5
19-39207911-C-T p.Leu366Leu synonymous ACTN4 1 82684 1.20942E-5 41342 0 3.18492E-5
19-39207923-C-T p.Pro370Pro synonymous ACTN4 1 82456 1.21277E-5 41228 0 2.01857E-4
19-39207924-G-A p.Ala371Thr missense ACTN4 3 82360 3.64254E-5 41180 0 2.78993E-5
19-39207926-C-A p.Ala371Ala synonymous ACTN4 5 82356 6.0712E-5 41178 0 1.68626E-5
19-39207930-A-G p.Met373Val missense ACTN4 1 82230 1.2161E-5 41115 0 NA
19-39207938-C-T p.Ser375Ser synonymous ACTN4 2 81902 2.44194E-5 40951 0 6.04115E-5
19-39207939-G-A p.Glu376Lys missense ACTN4 2 81826 2.44421E-5 40913 0 NA
19-39207953-C-A p.Val380Val synonymous ACTN4 2 81440 2.4558E-5 40720 0 NA
19-39208559-T-TGCCCC c.1144-8_1144-7insGCCCC splice_region ACTN4 1 81334 1.2295E-5 40667 0 2.55415E-5
19-39208574-A-G p.Asn384Ser missense ACTN4 1 81662 1.22456E-5 40831 0 NA
19-39208575-C-T p.Asn384Asn synonymous ACTN4 1 81668 1.22447E-5 40834 0 4.37445E-6
19-39208577-A-G p.Asn385Ser missense ACTN4 3 81676 3.67305E-5 40838 0 5.92839E-5
19-39208587-G-A p.Gln388Gln synonymous ACTN4 1 81722 1.22366E-5 40861 0 NA
19-39208596-G-A p.Glu391Glu synonymous ACTN4 2 81828 2.44415E-5 40914 0 0.00125
19-39208597-C-G p.Gln392Glu missense ACTN4 59 81820 7.21095E-4 40910 0 0.00119205
19-39208617-G-A p.Glu398Glu synonymous ACTN4 1 82134 1.21752E-5 41067 0 NA
19-39208639-C-T p.Arg406Cys missense ACTN4 4 82040 4.87567E-5 41020 0 6.37146E-5
19-39208641-C-A p.Arg406Arg synonymous ACTN4 128 82048 0.00156006 41024 1 0.00283584
19-39208657-G-A p.Asp412Asn missense ACTN4 1 81644 1.22483E-5 40822 0 NA
19-39208659-C-A p.Asp412Glu missense ACTN4 1 81726 1.2236E-5 40863 0 6.37349E-5
19-39208679-G-A p.Arg419Gln missense ACTN4 1 81740 1.22339E-5 40870 0 1.24688E-5
19-39208690-T-C p.Ser423Pro missense ACTN4 1 81696 1.22405E-5 40848 0 4.15794E-6
19-39208698-C-T p.His425His synonymous ACTN4 1 81540 1.22639E-5 40770 0 3.18512E-5
19-39208699-G-A p.Glu426Lys missense ACTN4 1 81446 1.22781E-5 40723 0 3.18532E-5
19-39208702-G-A p.Ala427Thr missense ACTN4 27 81456 3.31467E-4 40728 0 0.0010101
19-39208713-C-T p.Asp430Asp splice_region+synonymous ACTN4 34 81308 4.18163E-4 40654 0 0.00105136
19-39208718-C-T c.1291+4C>T splice_region ACTN4 39 81120 4.80769E-4 40560 1 0.0025
19-39208884-G-C c.268-7G>C splice_region ACTN4 5 60260 8.29738E-5 30130 0 1.27641E-4
19-39208890-G-C c.268-1G>C splice_acceptor ACTN4 1 57592 1.73635E-5 28796 0 3.78461E-5
19-39212174-C-G c.1292-4C>G splice_region ACTN4 1 82712 1.20901E-5 41356 0 NA
19-39212189-A-G p.Met435Val missense ACTN4 1 82916 1.20604E-5 41458 0 NA
19-39212202-G-A p.Arg439Gln missense ACTN4 6 82992 7.22961E-5 41496 0 0.00125
19-39212210-G-A p.Glu442Lys missense ACTN4 5 83014 6.02308E-5 41507 0 3.82312E-4
19-39212224-A-C p.Leu446Leu synonymous ACTN4 8 83072 9.6302E-5 41536 0 9.56206E-5
19-39212224-A-G p.Leu446Leu synonymous ACTN4 1 83070 1.2038E-5 41535 0 5.03525E-4
19-39212226-C-T p.Ser447Leu missense ACTN4 2 83070 2.40761E-5 41535 0 3.18613E-5
19-39212227-G-A p.Ser447Ser synonymous ACTN4 54 83058 6.50148E-4 41529 0 4.14224E-4
19-39212230-C-T p.Asp448Asp synonymous ACTN4 1 83088 1.20354E-5 41544 0 3.97909E-6
19-39212263-C-T p.Phe459Phe synonymous ACTN4 6 83026 7.22665E-5 41513 0 9.09813E-5
19-39212264-G-A p.Glu460Lys missense ACTN4 1 83022 1.2045E-5 41511 0 8.27212E-6
19-39212269-C-T p.Ser461Ser synonymous ACTN4 4 83022 4.818E-5 41511 0 2.38985E-5
19-39212281-G-A p.Ala465Ala synonymous ACTN4 1 83010 1.20467E-5 41505 0 2.4839E-5
19-39212293-C-T p.Arg469Arg synonymous ACTN4 5 82946 6.02802E-5 41473 0 5.04032E-4
19-39212294-G-A p.Val470Met missense ACTN4 1 82958 1.20543E-5 41479 0 8.2883E-6
19-39212305-C-T p.Ile473Ile synonymous ACTN4 1 82900 1.20627E-5 41450 0 2.48905E-5
19-39212308-C-T p.Ala474Ala synonymous ACTN4 2 82894 2.41272E-5 41447 0 1.59625E-5
19-39212309-G-A p.Ala475Thr missense ACTN4 1 82902 1.20624E-5 41451 0 7.98263E-6
19-39212311-C-T p.Ala475Ala synonymous ACTN4 156 82912 0.00188151 41456 0 0.00273973
19-39212323-G-A p.Glu479Glu synonymous ACTN4 1 82806 1.20764E-5 41403 0 NA
19-39212332-C-T c.1442+4C>T splice_region ACTN4 2 82674 2.41914E-5 41337 0 1.59307E-4
19-39212336-C-T c.1442+8C>T splice_region ACTN4 2 82554 2.42266E-5 41277 0 1.61007E-5
19-39212517-A-C n.1728A>C splice_region ACTN4 1 64408 1.5526E-5 32204 0 NA
19-39214249-C-T c.1443-5C>T splice_region ACTN4 2 82102 2.43599E-5 41051 0 1.06073E-4
19-39214250-G-A c.1443-4G>A splice_region ACTN4 28 82120 3.40964E-4 41060 0 6.25E-4
19-39214254-C-T p.Asn481Asn splice_region+synonymous ACTN4 1 82216 1.21631E-5 41108 0 3.19101E-5
19-39214255-G-C p.Glu482Gln missense+splice_region ACTN4 1 82234 1.21604E-5 41117 0 NA
19-39214266-C-T p.Tyr485Tyr synonymous ACTN4 1 82476 1.21247E-5 41238 0 1.08774E-5
19-39214269-C-T p.Tyr486Tyr synonymous ACTN4 5 82518 6.05928E-5 41259 0 7.40741E-5
19-39214279-A-G p.Asn490Asp missense ACTN4 1 82660 1.20978E-5 41330 0 1.95221E-5
19-39214280-A-G p.Asn490Ser missense ACTN4 3 82680 3.62845E-5 41340 0 3.88855E-5
19-39214285-A-C p.Asn492His missense ACTN4 1 82700 1.20919E-5 41350 0 4.00349E-6
19-39214292-G-A p.Arg494Gln missense ACTN4 3 82734 3.62608E-5 41367 0 1.2012E-5
19-39214301-A-C p.Lys497Thr missense ACTN4 1 82782 1.20799E-5 41391 0 1.86442E-5
19-39214326-C-T p.Leu505Leu synonymous ACTN4 14 82692 1.69303E-4 41346 0 3.82775E-4
19-39214350-GG-AA p.ArgGlu513ArgLys missense ACTN4 1 82512 1.21194E-5 41256 0 NA
19-39214359-G-A p.Leu516Leu synonymous ACTN4 1 82382 1.21386E-5 41191 0 3.1904E-5
19-39214569-C-T c.1552-8C>T splice_region ACTN4 1 82426 1.21321E-5 41213 0 4.00622E-6
19-39214594-G-A p.Leu523Leu synonymous ACTN4 2 82908 2.41231E-5 41454 0 8.36918E-6
19-39214606-C-T p.Asp527Asp synonymous ACTN4 4 82996 4.81951E-5 41498 0 8.33931E-6
19-39214624-C-T p.Tyr533Tyr synonymous ACTN4 2 83084 2.4072E-5 41542 0 5.03525E-4
19-39214633-C-T p.Arg536Arg synonymous ACTN4 556 83110 0.00668993 41555 9 0.0382679
19-39214634-G-A p.Ala537Thr missense ACTN4 1 83112 1.2032E-5 41556 0 NA
19-39214636-G-A p.Ala537Ala synonymous ACTN4 191 83116 0.00229799 41558 1 0.0048553
19-39214642-C-T p.Pro539Pro synonymous ACTN4 1 83154 1.20259E-5 41577 0 NA
19-39214655-A-G p.Met544Val missense ACTN4 1 83160 1.2025E-5 41580 0 NA
19-39214663-C-T p.Ser546Ser synonymous ACTN4 6 83142 7.21657E-5 41571 0 2.78532E-5
19-39214664-G-A p.Ala547Thr missense ACTN4 1 83114 1.20317E-5 41557 0 1.19407E-5
19-39214694-G-A p.Val557Ile missense ACTN4 2 83124 2.40604E-5 41562 0 3.97928E-6
19-39214705-C-T p.Ile560Ile synonymous ACTN4 1 83068 1.20383E-5 41534 0 3.5818E-5
19-39214706-G-A p.Glu561Lys missense ACTN4 1 83050 1.20409E-5 41525 0 8.2728E-6
19-39214711-G-C p.Glu562Asp missense ACTN4 1 83046 1.20415E-5 41523 0 NA
19-39214715-GAGGTTCGCACCCCCCGGCCCCCCATCTTCCCAAGAGCCTCTGTGGGGCTGGGCCGCCCCCTCACTCCAGCTCCTCCCCT-G p.Glu564fs frameshift ACTN4 15 82998 1.80727E-4 41499 7 NA
19-39214721-C-T c.1692+4C>T splice_region ACTN4 1 82896 1.20633E-5 41448 0 1.65782E-5
19-39214722-G-T c.1692+5G>T splice_region ACTN4 1 82848 1.20703E-5 41424 0 NA
19-39214793-C-T c.1693-4C>T splice_region ACTN4 3 82744 3.62564E-5 41372 0 1.59462E-5
19-39214798-G-A p.Gly565Asp missense+splice_region ACTN4 2 82756 2.41674E-5 41378 0 1.66185E-5
19-39214816-A-G p.Asp571Gly missense ACTN4 3 82826 3.62205E-5 41413 0 9.58405E-5
19-39214823-C-T p.Phe573Phe synonymous ACTN4 2 82838 2.41435E-5 41419 0 NA
19-39214826-G-A p.Lys574Lys synonymous ACTN4 4 82824 4.82952E-5 41412 0 3.98245E-5
19-39214837-C-T p.Pro578Leu missense ACTN4 1 82804 1.20767E-5 41402 0 3.58463E-5
19-39214838-G-A p.Pro578Pro synonymous ACTN4 33 82812 3.98493E-4 41406 0 9.56572E-4
19-39214841-C-T p.Asp579Asp synonymous ACTN4 1 82810 1.20758E-5 41405 0 4.97851E-5
19-39214842-G-A p.Ala580Thr missense ACTN4 1 82818 1.20747E-5 41409 0 NA
19-39214844-C-T p.Ala580Ala synonymous ACTN4 4 82842 4.82847E-5 41421 0 9.56938E-5
19-39214854-C-T p.Arg584Cys missense ACTN4 2 82812 2.41511E-5 41406 0 1.19505E-5
19-39214856-C-T p.Arg584Arg synonymous ACTN4 1 82802 1.2077E-5 41401 0 3.98333E-6
19-39214864-TC-T p.Leu588fs frameshift ACTN4 1 82842 1.20712E-5 41421 0 NA
19-39214865-C-A p.Ile587Ile synonymous ACTN4 1 82868 1.20674E-5 41434 0 6.37471E-5
19-39214871-C-T p.Ala589Ala synonymous ACTN4 1 82912 1.2061E-5 41456 0 NA
19-39214874-C-T p.Ile590Ile synonymous ACTN4 93 82928 0.00112145 41464 0 0.00235834
19-39214883-G-T p.Glu593Asp missense ACTN4 1 82958 1.20543E-5 41479 0 NA
19-39214943-C-T p.Thr613Thr synonymous ACTN4 1 82794 1.20782E-5 41397 0 7.98282E-6
19-39214944-G-A p.Val614Ile missense ACTN4 3 82758 3.62503E-5 41379 0 6.37959E-5
19-39214949-C-T p.Thr615Thr synonymous ACTN4 3 82750 3.62538E-5 41375 0 3.99081E-6
19-39214972-G-T p.Trp623Leu missense ACTN4 2 82460 2.42542E-5 41230 0 3.38518E-5
19-39214977-AAGGTGGGCCGGGGCCATCCGTAGGGGCTGGGGCAGGACGGCGGGGCTGGGGGCCACCTCCCTGACCGCTCCCACACCGCGTCTCCTCTGCC-A p.Lys625fs frameshift ACTN4 15 82406 1.82026E-4 41203 7 NA
19-39214985-C-T c.1875+6C>T splice_region ACTN4 3 82310 3.64476E-5 41155 0 4.02674E-6
19-39214986-C-T c.1875+7C>T splice_region ACTN4 2 82260 2.43132E-5 41130 0 3.42542E-5
19-39214987-G-A c.1875+8G>A splice_region ACTN4 5 82302 6.07519E-5 41151 0 3.18776E-5
19-39215097-C-T p.Asp634Asp synonymous ACTN4 50 82096 6.09043E-4 41048 0 0.00625
19-39215112-G-T p.Glu639Asp missense ACTN4 1 81998 1.21954E-5 40999 0 NA
19-39215115-G-A p.Glu640Glu synonymous ACTN4 2 81914 2.44159E-5 40957 0 8.00038E-6
19-39215121-C-T p.Ser642Ser synonymous ACTN4 5 81790 6.11322E-5 40895 0 3.18674E-5
19-39215130-G-A p.Gln645Gln synonymous ACTN4 1 81540 1.22639E-5 40770 0 NA
19-39215130-G-C p.Gln645His missense ACTN4 1 81540 1.22639E-5 40770 0 NA
19-39215132-C-G p.Ser646Cys missense ACTN4 3 81494 3.68125E-5 40747 0 8.37858E-6
19-39215135-A-G p.Asn647Ser missense ACTN4 1 81286 1.23022E-5 40643 0 NA
19-39215142-C-T p.His649His synonymous ACTN4 2 80938 2.47103E-5 40469 0 NA
19-39215147-G-A p.Arg651His missense ACTN4 1 80344 1.24465E-5 40172 0 4.02622E-6
19-39215152-C-A p.Gln653Lys missense ACTN4 1 81260 1.23062E-5 40630 0 NA
19-39215156-T-C p.Phe654Ser missense ACTN4 1 80842 1.23698E-5 40421 0 NA
19-39215157-C-T p.Phe654Phe synonymous ACTN4 1 81126 1.23265E-5 40563 0 4.00712E-6
19-39215162-G-C p.Ser656Thr missense ACTN4 1 81658 1.22462E-5 40829 0 NA
19-39215172-T-C p.Asn659Asn synonymous ACTN4 5062 81060 0.0624476 40530 151 0.0840081
19-39215193-G-A p.Gln666Gln synonymous ACTN4 464 80336 0.00577574 40168 6 0.00992481
19-39215207-T-A c.2010+2T>A splice_donor ACTN4 1 79520 1.25755E-5 39760 0 NA
19-39216359-C-T c.2011-5C>T splice_region ACTN4 18 81272 2.21478E-4 40636 0 3.50564E-4
19-39216369-C-T p.Ile672Ile synonymous ACTN4 46 81892 5.61715E-4 40946 0 0.0030303
19-39216373-C-T p.Arg674Cys missense ACTN4 1 82122 1.2177E-5 41061 0 1.19943E-5
19-39216375-C-T p.Arg674Arg synonymous ACTN4 1 82300 1.21507E-5 41150 0 8.54E-6
19-39216393-C-T p.Asn680Asn synonymous ACTN4 2 82738 2.41727E-5 41369 0 6.37511E-5
19-39216399-C-T p.Thr682Thr synonymous ACTN4 1 82856 1.20691E-5 41428 0 NA
19-39216436-C-T p.Arg695Cys missense ACTN4 3 83086 3.61072E-5 41543 0 6.37105E-5
19-39216437-G-A p.Arg695His missense ACTN4 11 83098 1.32374E-4 41549 0 7.95931E-5
19-39216444-C-T p.Ile697Ile synonymous ACTN4 2 83114 2.40633E-5 41557 0 0.001875
19-39216445-G-A p.Val698Met missense ACTN4 2 83112 2.40639E-5 41556 0 3.97896E-6
19-39216453-C-T p.Tyr700Tyr synonymous ACTN4 1 83104 1.20331E-5 41552 0 8.2702E-6
19-39216510-C-G p.Ile719Met missense ACTN4 1 82868 1.20674E-5 41434 0 3.97855E-6
19-39216514-G-A p.Asp721Asn missense ACTN4 1 82772 1.20814E-5 41386 0 NA
19-39216517-A-C p.Asn722His missense ACTN4 2 82764 2.41651E-5 41382 0 8.25928E-6
19-39216547-C-T c.2190+4C>T splice_region ACTN4 44 81596 5.39242E-4 40798 0 2.81224E-4
19-39216548-G-A c.2190+5G>A splice_region ACTN4 3 81442 3.6836E-5 40721 0 2.48114E-5
19-39216549-C-T c.2190+6C>T splice_region ACTN4 6 81380 7.37282E-5 40690 0 5.18436E-5
19-39216550-G-A c.2190+7G>A splice_region ACTN4 1 81364 1.22904E-5 40682 0 8.27226E-6
19-39217592-C-T c.2191-5C>T splice_region ACTN4 64 82192 7.78665E-4 41096 4 0.005625
19-39217593-G-A c.2191-4G>A splice_region ACTN4 1 82196 1.2166E-5 41098 0 5.58543E-5
19-39217594-C-G c.2191-3C>G splice_region ACTN4 1 82276 1.21542E-5 41138 0 NA
19-39217606-G-T p.Val734Leu missense ACTN4 1 82464 1.21265E-5 41232 0 NA
19-39217623-G-C p.Leu739Leu synonymous ACTN4 5 82758 6.04171E-5 41379 0 NA
19-39217632-C-T p.Thr742Thr synonymous ACTN4 3 82872 3.62004E-5 41436 0 NA
19-39217650-C-T p.Asn748Asn synonymous ACTN4 2 82950 2.41109E-5 41475 0 5.03525E-4
19-39217671-C-T p.Leu755Leu synonymous ACTN4 1 82988 1.20499E-5 41494 0 0.00125
19-39217677-C-T p.Arg757Arg synonymous ACTN4 6 82986 7.23014E-5 41493 0 9.56267E-5
19-39217680-C-T p.Asp758Asp synonymous ACTN4 2 83014 2.40923E-5 41507 0 4.13811E-5
19-39217681-G-T p.Ala759Ser missense ACTN4 1 83008 1.2047E-5 41504 0 3.97934E-6
19-39217681-G-A p.Ala759Thr missense ACTN4 2 83008 2.40941E-5 41504 0 2.48295E-5
19-39217686-G-C p.Lys760Asn missense ACTN4 1 83052 1.20406E-5 41526 0 NA
19-39217689-C-T p.Gly761Gly synonymous ACTN4 1 83036 1.2043E-5 41518 0 8.27513E-6
19-39217722-G-A p.Ala772Ala synonymous ACTN4 27 82740 3.26323E-4 41370 0 0.00151057
19-39217738-G-A p.Asp778Asn missense ACTN4 1 82114 1.21782E-5 41057 0 NA
19-39217748-G-A c.2337+5G>A splice_region ACTN4 1 81566 1.226E-5 40783 0 3.98937E-6
19-39218579-C-T c.2338-7C>T splice_region ACTN4 1 80426 1.24338E-5 40213 0 NA
19-39218580-C-T c.2338-6C>T splice_region ACTN4 3 80458 3.72865E-5 40229 0 9.29316E-6
19-39218581-G-A c.2338-5G>A splice_region ACTN4 3 80524 3.7256E-5 40262 0 3.19611E-5
19-39218595-G-A p.Gly783Arg missense ACTN4 1 80628 1.24026E-5 40314 0 4.61672E-5
19-39218609-C-T p.Pro787Pro synonymous ACTN4 2 80088 2.49725E-5 40044 0 9.9766E-5
19-39218637-C-T p.Leu797Leu synonymous ACTN4 2 81146 2.46469E-5 40573 0 3.19224E-5
19-39218645-C-T p.Tyr799Tyr synonymous ACTN4 1 81168 1.23201E-5 40584 0 8.04201E-6
19-39218648-C-T p.Asp800Asp synonymous ACTN4 11 81190 1.35485E-4 40595 0 0.00153296
19-39218648-CG-TA p.AspVal800AspMet missense ACTN4 1 81192 1.23165E-5 40596 0 NA
19-39218649-G-A p.Val801Met missense ACTN4 276 81194 0.00339927 40597 2 0.00456957
19-39218651-G-A p.Val801Val synonymous ACTN4 1 81242 1.23089E-5 40621 0 NA
19-39218655-AACG-A p.Asp804del conservative_inframe_deletion ACTN4 1 81184 1.23177E-5 40592 0 NA
19-39218657-C-T p.Asn803Asn synonymous ACTN4 2 81146 2.46469E-5 40573 0 0.00125
19-39218661-C-T p.Arg805Trp missense ACTN4 1 81058 1.23368E-5 40529 0 6.39918E-5
19-39218662-G-A p.Arg805Gln missense ACTN4 4 81008 4.93778E-5 40504 0 4.0778E-5
19-39218671-T-A c.2418+5T>A splice_region ACTN4 1 80866 1.23661E-5 40433 0 NA
19-39218673-C-T c.2418+7C>T splice_region ACTN4 1 80794 1.23772E-5 40397 0 1.14244E-5
19-39218949-G-A c.646-7G>A splice_region ACTN4 5 76720 6.51721E-5 38360 0 6.35647E-5
19-39218976-C-T p.Asp222Asp synonymous ACTN4 1 76812 1.30188E-5 38406 0 NA
19-39218979-C-T p.Ser223Ser synonymous ACTN4 4 76790 5.20901E-5 38395 0 6.25391E-5
19-39218985-C-A p.Asp225Glu missense ACTN4 2 76782 2.60478E-5 38391 0 NA
19-39219000-T-C p.Leu230Leu synonymous ACTN4 1 76612 1.30528E-5 38306 0 6.71655E-6
19-39219010-G-GGA p.Tyr235fs frameshift ACTN4 2 76510 2.61404E-5 38255 0 NA
19-39219014-A-ATG p.Ser236fs frameshift ACTN4 2 76394 2.61801E-5 38197 0 NA
19-39219017-GC-G p.Leu237fs frameshift ACTN4 2 76348 2.61958E-5 38174 0 NA
19-39219018-C-T p.Ser236Ser synonymous ACTN4 1 76318 1.31031E-5 38159 0 6.74136E-6
19-39219025-T-C c.711+4T>C splice_region ACTN4 1 76164 1.31296E-5 38082 0 NA
19-39219028-A-G c.711+7A>G splice_region ACTN4 1 76056 1.31482E-5 38028 0 3.44187E-5
19-39219644-C-T p.Ala809Ala synonymous ACTN4 5 81082 6.1666E-5 40541 0 3.18674E-5
19-39219659-C-T p.Ile814Ile synonymous ACTN4 1 81788 1.22267E-5 40894 0 NA
19-39219665-C-T p.Ser816Ser synonymous ACTN4 2 82036 2.43795E-5 41018 0 5.98841E-5
19-39219666-C-G p.Leu817Val missense ACTN4 2 82096 2.43617E-5 41048 0 NA
19-39219671-C-T p.Val818Val synonymous ACTN4 2 82210 2.43279E-5 41105 0 1.66185E-5
19-39219679-A-G p.Asn821Ser missense ACTN4 1 82480 1.21242E-5 41240 0 NA
19-39219680-C-T p.Asn821Asn synonymous ACTN4 1 82514 1.21192E-5 41257 0 9.96761E-5
19-39219686-C-T p.Ser823Ser synonymous ACTN4 44 82662 5.32288E-4 41331 0 0.00453629
19-39219687-G-A p.Gly824Ser missense ACTN4 4 82712 4.83606E-5 41356 0 1.66085E-5
19-39219707-C-T p.Ala830Ala synonymous ACTN4 11 82974 1.32572E-4 41487 0 3.82312E-4
19-39219713-C-T p.Ile832Ile synonymous ACTN4 1 82992 1.20494E-5 41496 0 1.27518E-4
19-39219719-C-T p.Phe834Phe synonymous ACTN4 1 83006 1.20473E-5 41503 0 8.30165E-6
19-39219725-G-A p.Ser836Ser synonymous ACTN4 1 82974 1.2052E-5 41487 0 3.18733E-5
19-39219726-C-T p.Arg837Trp missense ACTN4 2 82982 2.41016E-5 41491 0 1.6605E-5
19-39219727-G-A p.Arg837Gln missense ACTN4 1 82984 1.20505E-5 41492 0 5.04032E-4
19-39219737-C-T p.Thr840Thr synonymous ACTN4 16 82976 1.92827E-4 41488 0 1.4117E-4
19-39219742-C-T p.Thr842Met missense ACTN4 2 83004 2.40952E-5 41502 0 8.30496E-6
19-39219743-G-A p.Thr842Thr synonymous ACTN4 1 82984 1.20505E-5 41492 0 3.18898E-5
19-39219746-C-T p.Asp843Asp synonymous ACTN4 7 82960 8.4378E-5 41480 0 1.2751E-4
19-39219749-G-A p.Thr844Thr synonymous ACTN4 1 82934 1.20578E-5 41467 0 3.18878E-5
19-39219764-C-T p.Ile849Ile synonymous ACTN4 2 82840 2.41429E-5 41420 0 8.30937E-5
19-39219767-T-C p.Ala850Ala synonymous ACTN4 1 82822 1.20741E-5 41411 0 NA
19-39219780-T-C p.Leu855Leu synonymous ACTN4 20583 82140 0.250584 41070 2731 0.350453
19-39219792-AAGGTGAGCGAGACCCCTACGAGGTGCATGGGGGCTGGCGAGAGGGGTCCCTGCAGTGGGAGGGGCTGAGGGGGCCAGTGTGTGGGTGGGGATGGCTCAGAGTCCCATCCTGCCTGCCCC-A p.Asn860fs frameshift ACTN4 2 82416 2.42671E-5 41208 1 NA
19-39219797-G-A c.2577+3G>A splice_region ACTN4 3 82312 3.64467E-5 41156 0 3.18898E-5
19-39219800-C-T c.2577+6C>T splice_region ACTN4 2 82156 2.43439E-5 41078 0 5.02168E-5
19-39219801-G-A c.2577+7G>A splice_region ACTN4 6 82148 7.30389E-5 41074 0 1.19935E-5
19-39219906-T-TGCCC c.2578-8_2578-7insGCCC splice_region ACTN4 2 81766 2.446E-5 40883 0 3.19101E-5
19-39219927-C-T p.Ala864Val missense ACTN4 1 82084 1.21826E-5 41042 0 NA
19-39219937-G-A p.Leu867Leu synonymous ACTN4 1 82156 1.2172E-5 41078 0 3.41245E-5
19-39219939-G-A p.Arg868Gln missense ACTN4 3 82170 3.65097E-5 41085 0 3.21391E-5
19-39219943-A-G p.Arg869Arg synonymous ACTN4 4 82224 4.86476E-5 41112 0 4.25829E-5
19-39219949-G-GC p.Asp874fs frameshift ACTN4 1 82192 1.21666E-5 41096 0 NA
19-39219953-C-G p.Pro873Ala missense ACTN4 3 82240 3.64786E-5 41120 0 8.51615E-6
19-39219954-C-T p.Pro873Leu missense ACTN4 5 82230 6.08051E-5 41115 0 3.18979E-5
19-39219956-G-A p.Asp874Asn missense ACTN4 1 82218 1.21628E-5 41109 0 5.03525E-4
19-39219959-C-G p.Gln875Glu missense ACTN4 1 82238 1.21598E-5 41119 0 5.03525E-4
19-39219964-C-A p.Ala876Ala synonymous ACTN4 1 82208 1.21643E-5 41104 0 4.01191E-6
19-39219964-C-T p.Ala876Ala synonymous ACTN4 2 82208 2.43285E-5 41104 0 NA
19-39219969-A-G p.Tyr878Cys missense ACTN4 1 82168 1.21702E-5 41084 0 NA
19-39219974-A-G p.Ile880Val missense ACTN4 1 82160 1.21714E-5 41080 0 4.24722E-5
19-39219976-C-T p.Ile880Ile synonymous ACTN4 2 82148 2.43463E-5 41074 0 7.64448E-5
19-39219977-G-A p.Ala881Thr missense ACTN4 4 82116 4.87116E-5 41058 0 1.5952E-4
19-39219981-G-T p.Arg882Leu missense ACTN4 1 82102 1.218E-5 41051 0 NA
19-39219987-C-T p.Ala884Val missense ACTN4 2 82060 2.43724E-5 41030 0 0.00100705
19-39219988-G-A p.Ala884Ala synonymous ACTN4 10 82058 1.21865E-4 41029 0 1.32412E-4
19-39219997-G-A p.Gln887Gln synonymous ACTN4 1 82008 1.21939E-5 41004 0 NA
19-39220006-C-A p.Asp890Glu missense ACTN4 316 81958 0.00385563 40979 1 0.00755287
19-39220006-C-T p.Asp890Asp synonymous ACTN4 3 81964 3.66014E-5 40982 0 3.82922E-4
19-39220007-G-A p.Ala891Thr missense ACTN4 15 81940 1.83061E-4 40970 0 5.61802E-5
19-39220009-C-T p.Ala891Ala synonymous ACTN4 8 81936 9.76372E-5 40968 0 1.59479E-4
19-39220010-G-A p.Val892Met missense ACTN4 1 81928 1.22058E-5 40964 0 2.80939E-5
19-39220015-C-T p.Pro893Pro synonymous ACTN4 16 81858 1.9546E-4 40929 0 6.10158E-4
19-39220016-G-A p.Gly894Ser missense ACTN4 167 81848 0.00204037 40924 0 0.005
19-39220024-C-T p.Leu896Leu synonymous ACTN4 5 81822 6.11083E-5 40911 0 1.11067E-4
19-39220034-T-A p.Ser900Thr missense ACTN4 1 81778 1.22282E-5 40889 0 9.58344E-5
19-39220035-C-G p.Ser900Cys missense ACTN4 1 81786 1.2227E-5 40893 0 NA
19-39220044-C-T p.Thr903Met missense ACTN4 5 81712 6.11905E-5 40856 0 6.37552E-5
19-39220057-C-A p.Gly907Gly synonymous ACTN4 3 81528 3.67972E-5 40764 0 1.20698E-5
19-39220058-G-A p.Glu908Lys missense ACTN4 4 81526 4.90641E-5 40763 0 NA
19-39220062-G-A p.Ser909Asn missense ACTN4 1 81406 1.22841E-5 40703 0 4.02502E-6
19-39220066-C-T p.Asp910Asp synonymous ACTN4 1 81330 1.22956E-5 40665 0 NA
19-39220069-G-C p.Leu911Leu synonymous ACTN4 1 81336 1.22947E-5 40668 0 NA
19-39220460-A-T n.877A>T splice_region ACTN4 1 54012 1.85144E-5 27006 0 1.92468E-4
19-39220623-C-T c.284-6C>T splice_region ACTN4 4 41228 9.70214E-5 20614 0 2.32062E-5
19-39220627-AGAG-A p.Glu96del conservative_inframe_deletion ACTN4 11 40676 2.7043E-4 20338 0 6.4834E-5
19-39220635-T-C p.Leu97Pro missense ACTN4 1 39186 2.55193E-5 19593 0 NA
19-39220638-G-A p.Ser98Asn missense ACTN4 1 38268 2.61315E-5 19134 0 NA
19-39220648-C-T p.Thr101Thr synonymous ACTN4 1 34768 2.87621E-5 17384 0 2.85453E-5
19-39220656-C-A p.Pro104His missense ACTN4 12 33972 3.53232E-4 16986 0 4.62688E-4
19-39220726-GAACCAAAAAAAAAAAAGGAAAAAAAACACAAAACAACAAA-G c.*83_*122delGGAAAAAAAACACAAAACAACAAAAACCAAAAAAAAAAAA splice_region ACTN4 134 36372 0.00368415 18186 0 0.0341794
19-39220730-CAAAAAAAAAAAAGGAAAAAAAACACAAAACAACAAAAACCA-C c.*83_*123delGGAAAAAAAACACAAAACAACAAAAACCAAAAAAAAAAAAA splice_region ACTN4 5 37652 1.32795E-4 18826 0 NA
19-39220730-CAAAAAAAAAAAAGGAAAAAAAACACAAAACAACAAAAACCAAAAA-C c.*80_*124delAAAGGAAAAAAAACACAAAACAACAAAAACCAAAAAAAAAAAAAA splice_region ACTN4 2 37686 5.30701E-5 18843 0 NA
19-39220744-GAAAAAAAACACAAAACAACAAAAACCAAAA-G c.*93_*122delCACAAAACAACAAAAACCAAAAAAAAAAAA splice_region ACTN4 2 40568 4.92999E-5 20284 0 NA
19-39220760-CAACAAAAACCAAAAAAAAAAAAAATCACAAA-C c.*109_*139delCCAAAAAAAAAAAAAATCACAAAAACAAAAA splice_region ACTN4 5 41194 1.21377E-4 20597 0 1.52687E-4
19-39220763-CAAAAACCAAAAAAAAAAAAAATCA-C c.*104_*127delAAAAACCAAAAAAAAAAAAAATCA splice_region ACTN4 1 41118 2.43202E-5 20559 0 NA
19-39220764-AAAAACCAAAAAAAAAAAAAATCAC-A c.*109_*132delCCAAAAAAAAAAAAAATCACAAAA splice_region ACTN4 1 41890 2.3872E-5 20945 0 NA
19-39220769-CCAAAAAAAAAAAAAATCA-C c.*116_*133delAAAAAAAAATCACAAAAA splice_region ACTN4 2 41536 4.8151E-5 20768 0 NA
19-39220769-CCAAAAAAAAAAAAAATCACAA-C c.*110_*130delCAAAAAAAAAAAAAATCACAA splice_region ACTN4 1 41536 2.40755E-5 20768 0 NA
19-39220770-CA-C c.*124delA splice_region ACTN4 1800 34502 0.0521709 17251 17 0.0547336
19-39220770-CAA-C c.*123_*124delAA splice_region ACTN4 38 41604 9.13374E-4 20802 0 1.07216E-4
19-39220770-CAAAAAAAAAAAAAATCACAAAAACA-C c.*117_*141delAAAAAAAATCACAAAAACAAAAAAA splice_region ACTN4 34 41768 8.1402E-4 20884 0 5.89686E-4
19-39220770-CAAAA-C c.*121_*124delAAAA splice_region ACTN4 2 41768 4.78835E-5 20884 0 NA
19-39220770-CAAA-C c.*122_*124delAAA splice_region ACTN4 1 41768 2.39418E-5 20884 0 NA