Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
14-69341009-ATAAATTCTCTTCCTTAAAAAACAGCCATTTCAAAAGATTTTC-A c.*525_*566delGAAAATCTTTTGAAATGGCTGTTTTTTAAGGAAGAGAATTTA splice_region ACTN1 2 25590 7.81555E-5 12795 0 NA
14-69341501-A-AG c.*74dupC splice_region ACTN1 3 75514 3.97277E-5 37757 0 NA
14-69341579-G-A p.Leu892Leu synonymous ACTN1 1 82516 1.21189E-5 41258 0 3.18634E-5
14-69341592-C-T p.Gly888Asp missense ACTN1 1 82706 1.2091E-5 41353 0 4.09547E-6
14-69341593-C-T p.Gly888Ser missense ACTN1 2 82722 2.41774E-5 41361 0 1.79321E-5
14-69341597-C-T p.Leu886Leu synonymous ACTN1 1 82758 1.20834E-5 41379 0 NA
14-69341603-C-T p.Thr884Thr synonymous ACTN1 2 82818 2.41493E-5 41409 0 8.07057E-6
14-69341609-G-A p.Phe882Phe synonymous ACTN1 1 82918 1.20601E-5 41459 0 5.03525E-4
14-69341612-G-A p.Ser881Ser synonymous ACTN1 1 82918 1.20601E-5 41459 0 NA
14-69341621-G-C p.Asp878Glu missense ACTN1 1 82936 1.20575E-5 41468 0 3.18695E-5
14-69341626-G-C p.Leu877Val missense ACTN1 2 82926 2.41179E-5 41463 0 NA
14-69341638-C-T p.Val873Met missense ACTN1 1 82898 1.2063E-5 41449 0 8.45594E-6
14-69341639-G-A p.Ser872Ser synonymous ACTN1 2 82902 2.41249E-5 41451 0 8.01462E-6
14-69341642-G-A p.Asp871Asp synonymous ACTN1 1 82896 1.20633E-5 41448 0 4.00586E-6
14-69341644-C-T p.Asp871Asn missense ACTN1 1 82860 1.20685E-5 41430 0 NA
14-69341647-G-A p.Pro870Ser missense ACTN1 2 82866 2.41354E-5 41433 0 NA
14-69341650-C-A p.Gly869Cys missense ACTN1 6 82844 7.24253E-5 41422 0 3.71139E-4
14-69341651-G-A p.Thr868Thr synonymous ACTN1 2 82864 2.41359E-5 41432 0 1.59327E-4
14-69341653-T-A p.Thr868Ser missense ACTN1 1337 82784 0.0161505 41392 17 0.014375
14-69341654-G-A p.Tyr867Tyr synonymous ACTN1 1 82836 1.2072E-5 41418 0 NA
14-69341658-G-A p.Pro866Leu missense ACTN1 1862 82828 0.0224803 41414 22 0.0220579
14-69341660-G-A p.Ala865Ala synonymous ACTN1 2 82868 2.41348E-5 41434 0 1.686E-5
14-69341662-C-T p.Ala865Thr missense ACTN1 13 82840 1.56929E-4 41420 0 7.20236E-5
14-69341662-C-G p.Ala865Pro missense ACTN1 1 82840 1.20715E-5 41420 0 NA
14-69341663-C-T p.Met864Ile missense ACTN1 1 82858 1.20688E-5 41429 0 3.99898E-6
14-69341670-G-A p.Ala862Val missense ACTN1 5 82806 6.03821E-5 41403 0 9.59616E-5
14-69341672-G-C p.Ile861Met missense ACTN1 1 82814 1.20753E-5 41407 0 NA
14-69341688-T-C p.Gln856Arg missense ACTN1 1 82796 1.20779E-5 41398 0 NA
14-69341690-G-A p.Asp855Asp synonymous ACTN1 2 82750 2.41692E-5 41375 0 NA
14-69341696-T-C p.Pro853Pro synonymous ACTN1 2 82690 2.41867E-5 41345 0 NA
14-69341707-G-A p.Arg850Cys missense ACTN1 6 82550 7.26832E-5 41275 0 3.4057E-5
14-69341709-C-T p.Arg849His missense ACTN1 9 82488 1.09107E-4 41244 0 3.18878E-4
14-69341719-C-T p.Asp846Asn missense ACTN1 7 82362 8.49907E-5 41181 0 3.42483E-5
14-69341723-G-A p.Thr844Thr synonymous ACTN1 1 82278 1.21539E-5 41139 0 4.01216E-6
14-69341730-T-C p.Tyr842Cys missense ACTN1 2 82102 2.43599E-5 41051 0 6.25E-4
14-69341733-T-C p.Asn841Ser missense+splice_region ACTN1 1 82010 1.21936E-5 41005 0 8.70489E-6
14-69341738-C-CGAGGAGAGAGTG p.Ser877_Gln878insThrLeuSerSer disruptive_inframe_insertion ACTN1 5 81586 6.1285E-5 40793 0 3.18715E-5
14-69341739-G-A p.Ser877Leu missense ACTN1 1 81638 1.22492E-5 40819 0 NA
14-69341741-G-A c.2521-7C>T splice_region ACTN1 2 81588 2.45134E-5 40794 0 4.05268E-6
14-69341742-G-A p.Ser876Phe missense ACTN1 1 81514 1.22678E-5 40757 0 3.18715E-5
14-69341743-A-G p.Ser876Pro missense ACTN1 2 81432 2.45604E-5 40716 0 4.05416E-6
14-69341744-G-C p.Leu875Leu synonymous ACTN1 2 81404 2.45688E-5 40702 0 3.57577E-5
14-69341750-G-A p.Thr873Thr synonymous ACTN1 1 81054 1.23375E-5 40527 0 6.37146E-5
14-69341755-G-A p.Leu872Leu synonymous ACTN1 15 80748 1.85763E-4 40374 0 6.25E-4
14-69341756-G-A p.Phe871Phe synonymous ACTN1 1 80666 1.23968E-5 40333 0 9.65904E-5
14-69341757-A-C p.Phe871Cys missense ACTN1 1 80602 1.24066E-5 40301 0 3.18695E-5
14-69341757-A-T p.Phe871Tyr missense ACTN1 1 80602 1.24066E-5 40301 0 NA
14-69341760-G-A p.Ala870Val missense ACTN1 2 80198 2.49383E-5 40099 0 1.27453E-4
14-69341762-C-T p.Ala869Ala synonymous ACTN1 2 80120 2.49626E-5 40060 0 NA
14-69341765-A-G p.Phe868Phe synonymous ACTN1 4 80062 4.99613E-5 40031 0 NA
14-69341769-T-A p.Asp867Val missense ACTN1 2 79360 2.52016E-5 39680 0 NA
14-69341771-CAG-C p.Leu866fs frameshift ACTN1 2 79744 2.50803E-5 39872 0 1.15554E-5
14-69341773-G-GCAGCCGTAAAGCGGCGCGGCCCGACA p.Leu866fs frameshift ACTN1 3 79478 3.77463E-5 39739 0 4.30378E-6
14-69341789-G-A p.Arg860Arg synonymous ACTN1 3 79532 3.77207E-5 39766 0 8.93671E-6
14-69341790-C-T p.Arg860His missense ACTN1 6 79568 7.54072E-5 39784 0 6.37064E-5
14-69341792-G-T p.Gly859Gly synonymous ACTN1 1 79546 1.25713E-5 39773 0 NA
14-69341796-G-C p.Ser858Trp missense ACTN1 1 79634 1.25575E-5 39817 0 4.59474E-6
14-69341800-C-T p.Val857Met missense ACTN1 1 79732 1.2542E-5 39866 0 3.1839E-5
14-69341814-G-C p.Pro852Arg missense ACTN1 1 79550 1.25707E-5 39775 0 6.39032E-5
14-69341816-C-T p.Pro851Pro synonymous ACTN1 26 79442 3.27283E-4 39721 0 0.00180604
14-69341819-C-T p.Thr850Thr synonymous ACTN1 1 79356 1.26014E-5 39678 0 1.05893E-5
14-69341820-G-A p.Thr850Met missense ACTN1 1 79356 1.26014E-5 39678 0 3.18451E-5
14-69341826-G-T p.Ala848Asp missense ACTN1 1 79284 1.26129E-5 39642 0 3.18613E-5
14-69341829-G-A p.Ala847Val missense ACTN1 1 79212 1.26243E-5 39606 0 5.76395E-6
14-69341832-T-C p.His846Arg missense ACTN1 1 79214 1.2624E-5 39607 0 1.19467E-5
14-69341837-C-G p.Thr844Thr synonymous ACTN1 1 79018 1.26553E-5 39509 0 NA
14-69341840-T-C p.Gln843Gln synonymous ACTN1 1 78980 1.26614E-5 39490 0 4.39599E-5
14-69341843-C-T p.Met842Ile missense ACTN1 2 78874 2.53569E-5 39437 0 4.50537E-5
14-69341844-A-AT p.Met842fs frameshift ACTN1 246 78850 0.00311985 39425 1 0.00745413
14-69341844-A-C p.Met842Arg missense ACTN1 1 78856 1.26813E-5 39428 0 NA
14-69341860-G-GT p.Gln837fs frameshift ACTN1 4 78498 5.09567E-5 39249 0 6.91429E-6
14-69341861-TAACTACAG-T p.Leu836fs frameshift ACTN1 1 78458 1.27457E-5 39229 0 1.38209E-5
14-69343813-G-A p.Leu836Leu synonymous ACTN1 2 83040 2.40848E-5 41520 0 5.03525E-4
14-69343856-G-A p.Ala821Ala synonymous ACTN1 4 83078 4.81475E-5 41539 0 9.92441E-5
14-69343865-G-A p.Arg818Arg synonymous ACTN1 23 82962 2.77235E-4 41481 0 4.14039E-4
14-69343866-C-T p.Arg818His missense ACTN1 1 82972 1.20523E-5 41486 0 NA
14-69343882-T-C p.Ile813Val missense ACTN1 1 82834 1.20723E-5 41417 0 NA
14-69343903-C-G p.Val806Leu missense ACTN1 4 82646 4.83992E-5 41323 0 NA
14-69343911-C-T p.Arg803His missense ACTN1 5 82472 6.06266E-5 41236 0 3.29783E-5
14-69343913-G-A p.Asn802Asn synonymous ACTN1 1 82428 1.21318E-5 41214 0 NA
14-69343933-T-C p.Met796Val missense ACTN1 1 82062 1.21859E-5 41031 0 8.2481E-6
14-69343938-C-T p.Arg794His missense ACTN1 18 81730 2.20237E-4 40865 0 6.36983E-5
14-69343947-T-A p.Glu791Val missense ACTN1 1 81488 1.22717E-5 40744 0 NA
14-69345169-C-T c.2151+6G>A splice_region ACTN1 2 80680 2.47893E-5 40340 0 1.00628E-5
14-69345170-G-A c.2151+5C>T splice_region ACTN1 3 80766 3.71443E-5 40383 0 5.63581E-5
14-69345170-G-T c.2151+5C>A splice_region ACTN1 2 80766 2.47629E-5 40383 0 NA
14-69345204-C-T p.Ala708Thr missense ACTN1 1 81622 1.22516E-5 40811 0 6.37836E-5
14-69345206-C-T p.Arg707His missense ACTN1 4 81654 4.89872E-5 40827 0 6.37796E-5
14-69345217-C-T p.Thr703Thr synonymous ACTN1 6 81716 7.3425E-5 40858 0 3.18674E-5
14-69345218-G-A p.Thr703Met missense ACTN1 11 81708 1.34626E-4 40854 0 2.23044E-4
14-69345234-T-C p.Thr698Ala missense ACTN1 1 81556 1.22615E-5 40778 0 1.2366E-5
14-69345240-T-C p.Lys696Glu missense+splice_region ACTN1 2 81464 2.45507E-5 40732 0 4.10018E-6
14-69345244-T-C c.2086-4A>G splice_region ACTN1 1 81316 1.22977E-5 40658 0 4.10236E-6
14-69345245-G-A c.2086-5C>T splice_region ACTN1 2 81324 2.4593E-5 40662 0 2.74223E-5
14-69345245-G-C c.2086-5C>G splice_region ACTN1 7 81322 8.60776E-5 40661 0 3.27778E-5
14-69345247-G-A c.2086-7C>T splice_region ACTN1 2 81266 2.46105E-5 40633 0 9.10017E-6
14-69345699-C-T c.2361+7G>A splice_region ACTN1 2 82466 2.42524E-5 41233 0 7.42538E-5
14-69345699-C-A c.2361+7G>T splice_region ACTN1 1 82466 1.21262E-5 41233 0 2.47513E-5
14-69345700-G-A c.2361+6C>T splice_region ACTN1 2 82478 2.42489E-5 41239 0 3.20143E-5
14-69345701-A-C c.2361+5T>G splice_region ACTN1 3 82470 3.63769E-5 41235 0 3.2E-5
14-69345714-C-T p.Asp785Asn missense ACTN1 3 82402 3.64069E-5 41201 0 3.30028E-5
14-69345716-T-C p.Asn784Ser missense ACTN1 3 82432 3.63936E-5 41216 0 2.475E-5
14-69345726-C-G p.Asp781His missense ACTN1 1 82402 1.21356E-5 41201 0 NA
14-69345742-G-A p.Leu775Leu synonymous ACTN1 1 82262 1.21563E-5 41131 0 1.65235E-5
14-69345743-A-T p.Leu775His missense ACTN1 3 82246 3.64759E-5 41123 0 NA
14-69345754-G-A p.Phe771Phe synonymous ACTN1 1 82126 1.21764E-5 41063 0 NA
14-69345757-C-T p.Glu770Glu synonymous ACTN1 3 82092 3.65444E-5 41046 0 3.19857E-5
14-69345762-C-T p.Glu769Lys missense ACTN1 3 82016 3.65782E-5 41008 0 3.20082E-5
14-69345763-G-A p.Pro297Pro splice_region+synonymous ACTN1 1 81986 1.21972E-5 40993 0 1.43596E-4
14-69345765-G-T p.Pro297Thr missense+splice_region ACTN1 1 81968 1.21999E-5 40984 0 NA
14-69346681-G-A p.Arg760Trp missense+splice_region ACTN1 2 83100 2.40674E-5 41550 0 3.18573E-5
14-69346687-AG-A p.Phe758fs frameshift ACTN1 2 83194 2.40402E-5 41597 0 NA
14-69346705-G-A p.Arg752Trp missense ACTN1 1 83282 1.20074E-5 41641 0 3.18593E-5
14-69346709-C-T p.Glu750Glu synonymous ACTN1 1 83304 1.20042E-5 41652 0 NA
14-69346720-G-C p.Gln747Glu missense ACTN1 7 83310 8.40235E-5 41655 0 9.55597E-5
14-69346751-C-T p.Leu736Leu synonymous ACTN1 1 83294 1.20057E-5 41647 0 NA
14-69346751-C-A p.Leu736Leu synonymous ACTN1 1 83294 1.20057E-5 41647 0 1.19299E-5
14-69346768-C-T p.Val731Ile missense ACTN1 2 83270 2.40183E-5 41635 0 3.18552E-5
14-69346769-C-T p.Glu730Glu synonymous ACTN1 1 83268 1.20094E-5 41634 0 7.95368E-6
14-69346793-G-A p.Thr722Thr synonymous ACTN1 8 83160 9.62001E-5 41580 0 7.9557E-5
14-69346818-C-T p.Arg714His missense ACTN1 1 82856 1.20691E-5 41428 0 3.98213E-6
14-69346827-T-C c.2134-2A>G splice_acceptor ACTN1 1 82706 1.2091E-5 41353 0 NA
14-69346830-A-AT c.2134-6_2134-5insA splice_region ACTN1 1 82612 1.21048E-5 41306 0 NA
14-69347533-G-A p.Thr709Thr synonymous ACTN1 1 83118 1.20311E-5 41559 0 NA
14-69347535-T-C p.Thr709Ala missense ACTN1 1 83112 1.2032E-5 41556 0 NA
14-69347549-T-C p.Lys704Arg missense ACTN1 3 83210 3.60534E-5 41605 0 1.98864E-5
14-69347552-T-C p.Asn703Ser missense ACTN1 1 83232 1.20146E-5 41616 0 NA
14-69347560-G-A p.Ile700Ile synonymous ACTN1 1 83262 1.20103E-5 41631 0 2.78392E-5
14-69347566-C-T p.Ala698Ala synonymous ACTN1 2 83258 2.40217E-5 41629 0 2.47186E-5
14-69347589-C-T p.Asp691Asn missense ACTN1 1 83248 1.20123E-5 41624 0 3.1902E-5
14-69347590-G-A p.Gly690Gly synonymous ACTN1 14 83238 1.68192E-4 41619 0 4.46942E-4
14-69347607-T-A p.Ile685Phe missense ACTN1 1 83284 1.20071E-5 41642 0 NA
14-69347617-G-A p.Tyr681Tyr synonymous ACTN1 1 83276 1.20083E-5 41638 0 1.64734E-5
14-69347632-C-T p.Lys676Lys synonymous ACTN1 3768 83210 0.045283 41605 117 0.06125
14-69347641-C-T p.Gln673Gln synonymous ACTN1 38 83272 4.56336E-4 41636 0 5.68378E-4
14-69347646-G-A p.Arg672Trp missense ACTN1 2 83266 2.40194E-5 41633 0 7.95444E-6
14-69347647-C-CAGA p.Leu671dup disruptive_inframe_insertion ACTN1 1 83274 1.20085E-5 41637 0 NA
14-69347651-T-G p.His670Pro missense ACTN1 2 83262 2.40206E-5 41631 0 3.97697E-6
14-69347668-C-T p.Leu664Leu synonymous ACTN1 2 83238 2.40275E-5 41619 0 6.37349E-5
14-69347677-A-G p.His661His synonymous ACTN1 2 83190 2.40414E-5 41595 0 9.56206E-5
14-69347680-C-T p.Met660Ile missense ACTN1 1 83172 1.20233E-5 41586 0 3.97785E-6
14-69347688-T-C p.Ile658Val missense ACTN1 1 83138 1.20282E-5 41569 0 1.64872E-5
14-69347701-G-T p.Ile653Ile synonymous ACTN1 2 82982 2.41016E-5 41491 0 NA
14-69349184-G-A p.Thr648Thr synonymous ACTN1 1 82640 1.21007E-5 41320 0 1.99265E-5
14-69349196-G-A p.Pro644Pro synonymous ACTN1 346 82852 0.00417612 41426 4 0.00895361
14-69349201-C-T p.Gly643Arg missense ACTN1 2 82866 2.41354E-5 41433 0 1.66378E-5
14-69349202-G-T p.Ile642Ile synonymous ACTN1 2 82878 2.41319E-5 41439 0 NA
14-69349202-G-A p.Ile642Ile synonymous ACTN1 2 82878 2.41319E-5 41439 0 6.25E-4
14-69349209-T-G p.Asn640Thr missense ACTN1 1 82956 1.20546E-5 41478 0 NA
14-69349211-G-T p.Ala639Ala synonymous ACTN1 1 82948 1.20557E-5 41474 0 3.18674E-5
14-69349220-T-G p.Gly636Gly synonymous ACTN1 2 82958 2.41086E-5 41479 0 NA
14-69349233-C-T p.Arg632His missense ACTN1 1 82964 1.20534E-5 41482 0 NA
14-69349258-G-T p.Arg624Arg synonymous ACTN1 1 83030 1.20438E-5 41515 0 NA
14-69349262-A-G p.His622His synonymous ACTN1 2 83016 2.40917E-5 41508 0 5.03525E-4
14-69349271-C-T p.Thr619Thr synonymous ACTN1 2 83040 2.40848E-5 41520 0 NA
14-69349272-G-A p.Thr619Met missense ACTN1 11 83012 1.32511E-4 41506 0 2.86679E-4
14-69349272-G-T p.Thr619Lys missense ACTN1 1 83012 1.20465E-5 41506 0 8.27842E-6
14-69349298-C-G p.Leu610Leu synonymous ACTN1 1 82866 1.20677E-5 41433 0 3.98203E-6
14-69349306-G-A p.Arg608Trp missense ACTN1 2 82770 2.41633E-5 41385 0 7.96438E-6
14-69349309-C-T p.Val607Met missense+splice_region ACTN1 1 82748 1.20849E-5 41374 0 NA
14-69349312-G-A c.1819-3C>T splice_region ACTN1 1 82706 1.2091E-5 41353 0 3.18532E-5
14-69349313-G-C c.1819-4C>G splice_region ACTN1 1 82686 1.20939E-5 41343 0 3.98191E-6
14-69349316-C-T c.1819-7G>A splice_region ACTN1 1 82544 1.21148E-5 41272 0 3.98305E-6
14-69349603-C-T p.Gly602Asp missense ACTN1 1 83288 1.20065E-5 41644 0 3.18552E-5
14-69349604-C-T p.Gly602Ser missense ACTN1 1 83294 1.20057E-5 41647 0 NA
14-69349617-A-C p.Pro597Pro synonymous ACTN1 2 83236 2.40281E-5 41618 0 2.47207E-5
14-69349620-C-T p.Thr596Thr synonymous ACTN1 2 83216 2.40338E-5 41608 0 3.18532E-5
14-69349626-G-A p.Thr594Thr synonymous ACTN1 1 83236 1.2014E-5 41618 0 NA
14-69349632-G-A p.Tyr592Tyr synonymous ACTN1 1 83210 1.20178E-5 41605 0 7.95995E-6
14-69349647-C-T p.Ala587Ala synonymous ACTN1 5 83340 5.99952E-5 41670 0 4.37484E-5
14-69349648-G-A p.Ala587Val missense ACTN1 3 83356 3.59902E-5 41678 0 6.36902E-5
14-69349652-T-C p.Met586Val missense ACTN1 3 83380 3.59799E-5 41690 0 3.1839E-5
14-69349665-G-T p.Thr581Thr synonymous ACTN1 1 83392 1.19916E-5 41696 0 NA
14-69349674-A-G p.Ile578Ile synonymous ACTN1 3 83378 3.59807E-5 41689 0 1.59236E-4
14-69349683-C-T p.Val575Val synonymous ACTN1 4 83374 4.79766E-5 41687 0 8.23683E-6
14-69349695-G-A p.Ile571Ile synonymous ACTN1 1 83352 1.19973E-5 41676 0 NA
14-69349701-C-T p.Leu569Leu synonymous ACTN1 1 83318 1.20022E-5 41659 0 1.19304E-5
14-69349715-G-A p.Arg565Cys missense ACTN1 1 83202 1.20189E-5 41601 0 3.18471E-5
14-69349716-C-T p.Glu564Glu synonymous ACTN1 3 83216 3.60508E-5 41608 0 8.23683E-6
14-69349724-C-T p.Asp562Asn missense ACTN1 2 83146 2.40541E-5 41573 0 1.1937E-5
14-69349725-G-A p.Ala561Ala synonymous ACTN1 49 83140 5.89367E-4 41570 0 0.0025
14-69349771-C-A p.Gly546Val missense+splice_region ACTN1 1 82508 1.212E-5 41254 0 NA
14-69350878-G-T c.1635+7C>A splice_region ACTN1 1 82784 1.20796E-5 41392 0 NA
14-69350878-G-A c.1635+7C>T splice_region ACTN1 1 82784 1.20796E-5 41392 0 8.05477E-6
14-69350880-C-T c.1635+5G>A splice_region ACTN1 1 82640 1.21007E-5 41320 0 NA
14-69350888-G-C p.Ile544Met missense ACTN1 1 82940 1.20569E-5 41470 0 NA
14-69350888-G-A p.Ile544Ile synonymous ACTN1 2 82940 2.41138E-5 41470 0 NA
14-69350895-T-C p.Glu542Gly missense ACTN1 2 83060 2.4079E-5 41530 0 3.18979E-5
14-69350897-A-C p.Ile541Met missense ACTN1 7 83068 8.42683E-5 41534 0 NA
14-69350927-G-T p.Asp531Glu missense ACTN1 1 83284 1.20071E-5 41642 0 NA
14-69350942-C-T p.Glu526Glu synonymous ACTN1 1 83326 1.20011E-5 41663 0 NA
14-69350951-G-A p.Asn523Asn synonymous ACTN1 22 83322 2.64036E-4 41661 0 0.00201613
14-69350964-G-A p.Ala519Val missense ACTN1 7 83340 8.39933E-5 41670 0 9.06305E-5
14-69350976-G-A p.Ala515Val missense ACTN1 1 83362 1.19959E-5 41681 0 NA
14-69350984-C-G p.Leu512Phe missense ACTN1 1 83376 1.19939E-5 41688 0 NA
14-69350988-T-C p.Tyr511Cys missense ACTN1 2 83368 2.399E-5 41684 0 6.37389E-5
14-69351000-A-G p.Ile507Thr missense ACTN1 1 83374 1.19941E-5 41687 0 3.18837E-5
14-69351017-C-T p.Glu501Glu synonymous ACTN1 1 83362 1.19959E-5 41681 0 NA
14-69351020-G-A p.Thr500Thr synonymous ACTN1 2 83354 2.3994E-5 41677 0 1.65741E-5
14-69351020-G-C p.Thr500Thr synonymous ACTN1 1 83354 1.1997E-5 41677 0 NA
14-69351532-T-C p.Asn485Ser missense ACTN1 5 83330 6.00024E-5 41665 0 5.03525E-4
14-69351563-G-A p.Arg475Cys missense ACTN1 2 83312 2.40061E-5 41656 0 1.19302E-5
14-69351566-C-T p.Ala474Thr missense ACTN1 2 83300 2.40096E-5 41650 0 1.27413E-4
14-69351567-G-A p.Asn473Asn synonymous ACTN1 2 83288 2.40131E-5 41644 0 8.23818E-6
14-69351576-G-A p.Pro470Pro synonymous ACTN1 616 83254 0.00739904 41627 12 0.0156708
14-69352156-G-A p.Ile457Ile synonymous ACTN1 4 82620 4.84144E-5 41310 0 2.83735E-4
14-69352162-G-A p.Ala455Ala synonymous ACTN1 1 82702 1.20916E-5 41351 0 9.5706E-5
14-69352171-C-T p.Glu452Glu synonymous ACTN1 29 82830 3.50115E-4 41415 0 6.696E-4
14-69352207-G-A p.Phe440Phe synonymous ACTN1 21 83034 2.52908E-4 41517 0 1.59317E-4
14-69352221-T-G p.Lys436Gln missense ACTN1 2 83078 2.40738E-5 41539 0 3.97861E-6
14-69352230-G-A p.Leu433Leu synonymous ACTN1 18007 82736 0.217644 41368 2120 0.28
14-69352243-C-T p.Ser428Ser synonymous ACTN1 5 83062 6.0196E-5 41531 0 4.77521E-5
14-69352255-G-A p.Thr424Thr synonymous ACTN1 66 83022 7.9497E-4 41511 0 0.00302115
14-69352259-T-C p.Glu423Gly missense ACTN1 4 83022 4.818E-5 41511 0 3.18776E-5
14-69352260-C-T p.Glu423Lys missense ACTN1 1 83024 1.20447E-5 41512 0 NA
14-69352275-G-A p.Arg418* stop_gained ACTN1 1 82958 1.20543E-5 41479 0 NA
14-69356857-G-A p.Asp411Asp splice_region+synonymous ACTN1 3 81434 3.68397E-5 40717 0 9.23664E-5
14-69356872-G-A p.His406His synonymous ACTN1 12 82492 1.45469E-4 41246 0 6.25E-4
14-69356891-C-T p.Arg400Gln missense ACTN1 1 83024 1.20447E-5 41512 0 5.06047E-5
14-69356918-C-T p.Arg391Gln missense ACTN1 1 83230 1.20149E-5 41615 0 6.25E-4
14-69356930-C-T p.Arg387Gln missense ACTN1 1 83296 1.20054E-5 41648 0 NA
14-69356932-G-T p.Ile386Ile synonymous ACTN1 1791 83282 0.0215052 41641 29 0.020625
14-69356953-C-T p.Glu379Glu synonymous ACTN1 1 83334 1.19999E-5 41667 0 3.97684E-6
14-69356962-C-T p.Lys376Lys synonymous ACTN1 72 83324 8.64097E-4 41662 0 4.77232E-4
14-69356971-C-G p.Gln373His missense ACTN1 1 83296 1.20054E-5 41648 0 3.9769E-6
14-69356974-C-T p.Glu372Glu synonymous ACTN1 2 83280 2.40154E-5 41640 0 1.59081E-5
14-69356980-G-A p.Cys370Cys synonymous ACTN1 2 83262 2.40206E-5 41631 0 3.97738E-6
14-69356996-T-C p.Asn365Ser missense ACTN1 1 83178 1.20224E-5 41589 0 3.18715E-5
14-69358781-T-C p.Arg359Gly missense ACTN1 3 82034 3.65702E-5 41017 0 1.65426E-5
14-69358783-C-A p.Gly358Val missense ACTN1 1 82018 1.21924E-5 41009 0 NA
14-69358803-A-T p.Pro351Pro synonymous ACTN1 2 82422 2.42654E-5 41211 0 8.24919E-6
14-69358808-G-A p.Arg350Trp missense ACTN1 1 82470 1.21256E-5 41235 0 3.19366E-5
14-69358824-C-T p.Lys344Lys synonymous ACTN1 1 82760 1.20831E-5 41380 0 NA
14-69358836-C-G p.Thr340Thr synonymous ACTN1 1 82976 1.20517E-5 41488 0 8.24008E-6
14-69358836-C-A p.Thr340Thr synonymous ACTN1 3 82976 3.6155E-5 41488 0 1.64802E-5
14-69358836-C-T p.Thr340Thr synonymous ACTN1 3 82976 3.6155E-5 41488 0 2.78496E-5
14-69358839-G-A p.Asn339Asn synonymous ACTN1 2 83068 2.40767E-5 41534 0 NA
14-69358846-T-C p.Asn337Ser missense ACTN1 2 83200 2.40385E-5 41600 0 7.95469E-6
14-69358851-C-G p.Glu335Asp missense ACTN1 1 83274 1.20085E-5 41637 0 2.47186E-5
14-69358863-C-T p.Lys331Lys synonymous ACTN1 433 83316 0.00519708 41658 7 0.0102366
14-69358867-T-C p.Glu330Gly missense ACTN1 1 83308 1.20036E-5 41654 0 NA
14-69358870-T-C p.Gln329Arg missense ACTN1 1 83318 1.20022E-5 41659 0 NA
14-69358872-C-T p.Val328Val synonymous ACTN1 2 83312 2.40061E-5 41656 0 1.98839E-5
14-69358877-T-TG p.Lys327fs frameshift ACTN1 1 83330 1.20005E-5 41665 0 NA
14-69358881-C-T p.Pro325Pro synonymous ACTN1 2 83316 2.4005E-5 41658 0 5.76711E-5
14-69358889-G-A p.His323Tyr missense ACTN1 3 83302 3.60135E-5 41651 0 3.18776E-5
14-69358895-G-A p.Arg321Cys missense ACTN1 1 83288 1.20065E-5 41644 0 8.23886E-6
14-69358898-G-A p.Arg320Trp missense ACTN1 4 83278 4.80319E-5 41639 0 9.06275E-5
14-69358921-T-C p.Lys312Arg missense ACTN1 1 83240 1.20135E-5 41620 0 3.97684E-6
14-69358926-T-C p.Gln310Gln synonymous ACTN1 1 83238 1.20137E-5 41619 0 5.76872E-5
14-69358934-C-CATGCATGGT p.His307_Ala308insThrMetHis conservative_inframe_insertion ACTN1 2 83182 2.40437E-5 41591 0 NA
14-69358936-T-A p.His307Leu missense ACTN1 1 83170 1.20236E-5 41585 0 8.24348E-6
14-69358950-G-A p.Pro302Pro synonymous ACTN1 3 82986 3.61507E-5 41493 0 2.58659E-4
14-69358951-G-A p.Pro302Leu missense ACTN1 1 82968 1.20528E-5 41484 0 NA
14-69358958-G-A p.Arg300Trp missense ACTN1 1 82822 1.20741E-5 41411 0 NA
14-69358971-C-T p.Pro295Pro synonymous ACTN1 63 82470 7.63914E-4 41235 0 0.006875
14-69358976-T-C p.Ile294Val missense ACTN1 1 82300 1.21507E-5 41150 0 8.36092E-6
14-69358982-G-A p.Arg292Cys missense ACTN1 2 81958 2.44027E-5 40979 0 1.19896E-5
14-69358984-C-T p.Arg291His missense ACTN1 4 81650 4.89896E-5 40825 0 2.94558E-4
14-69358985-G-A p.Arg291Cys missense ACTN1 9 81660 1.10213E-4 40830 0 1.59327E-4
14-69358988-T-C p.Ile290Val missense ACTN1 1 81386 1.22871E-5 40693 0 NA
14-69360368-C-A c.855+4G>T splice_region ACTN1 2 82604 2.42119E-5 41302 0 1.99295E-5
14-69360371-C-G c.855+1G>C splice_donor ACTN1 2 82656 2.41967E-5 41328 0 NA
14-69360381-C-T p.Leu282Leu synonymous ACTN1 1 82894 1.20636E-5 41447 0 3.98127E-6
14-69360384-C-T p.Lys260Lys splice_region+synonymous ACTN1 10 82968 1.20528E-4 41484 0 6.43246E-4
14-69360390-G-A p.Tyr279Tyr synonymous ACTN1 1 83126 1.20299E-5 41563 0 8.24498E-6
14-69360391-T-C p.Tyr279Cys missense ACTN1 1 83146 1.2027E-5 41573 0 2.78563E-5
14-69360396-T-C p.Glu277Glu synonymous ACTN1 1 83214 1.20172E-5 41607 0 NA
14-69360400-A-G p.Met276Thr missense ACTN1 1 83234 1.20143E-5 41617 0 NA
14-69360401-T-C p.Met276Val missense ACTN1 1 83236 1.2014E-5 41618 0 NA
14-69360408-C-T p.Glu273Glu synonymous ACTN1 1 83248 1.20123E-5 41624 0 8.24239E-6
14-69360411-G-A p.Asn272Asn synonymous ACTN1 2 83264 2.402E-5 41632 0 2.47268E-5
14-69360425-C-T p.Val268Ile missense ACTN1 1 83298 1.20051E-5 41649 0 3.18573E-5
14-69360426-G-A p.Ala267Ala synonymous ACTN1 2 83290 2.40125E-5 41645 0 2.47264E-5
14-69360435-C-T p.Lys264Lys synonymous ACTN1 3 83282 3.60222E-5 41641 0 1.19382E-5
14-69360444-G-A p.Arg261Arg synonymous ACTN1 1 83224 1.20158E-5 41612 0 3.98067E-6
14-69360463-G-A p.Ala255Val missense+splice_region ACTN1 2 83014 2.40923E-5 41507 0 3.18613E-5
14-69369187-C-G c.762+7G>C splice_region ACTN1 1 83262 1.20103E-5 41631 0 8.24117E-6
14-69369188-G-A c.762+6C>T splice_region ACTN1 4 83262 4.80411E-5 41631 0 1.23398E-4
14-69369193-C-A c.762+1G>T splice_donor ACTN1 1 83284 1.20071E-5 41642 0 NA
14-69369212-G-A p.Ala248Ala synonymous ACTN1 3 83324 3.6004E-5 41662 0 4.11923E-5
14-69369215-G-A p.His247His synonymous ACTN1 3 83330 3.60014E-5 41665 0 3.18593E-5
14-69369233-G-A p.Tyr241Tyr synonymous ACTN1 16 83348 1.91966E-4 41674 0 5.03525E-4
14-69369261-C-T p.Arg232Gln missense ACTN1 1 83352 1.19973E-5 41676 0 7.96096E-6
14-69369274-C-T p.Val228Ile missense ACTN1 15 83330 1.80007E-4 41665 0 6.25E-4
14-69369275-G-A p.Ile227Ile synonymous ACTN1 2 83312 2.40061E-5 41656 0 0.00125
14-69371366-T-C c.676+6A>G splice_region ACTN1 292 83292 0.00350574 41646 1 0.00573139
14-69371376-G-A p.Ala224Ala synonymous ACTN1 312 83324 0.00374442 41662 3 0.00726022
14-69371379-A-G p.Asp223Asp synonymous ACTN1 1 83342 1.19988E-5 41671 0 8.24117E-6
14-69371389-T-G p.Lys220Thr missense ACTN1 4 83352 4.79893E-5 41676 0 NA
14-69371397-G-C p.Asp217Glu missense ACTN1 1 83344 1.19985E-5 41672 0 NA
14-69371417-C-T p.Val211Met missense ACTN1 3 83338 3.5998E-5 41669 0 3.57984E-5
14-69371418-G-A p.Asp210Asp synonymous ACTN1 10 83330 1.20005E-4 41665 0 3.97753E-5
14-69371427-C-T p.Thr207Thr synonymous ACTN1 2 83332 2.40004E-5 41666 0 6.25E-4
14-69371440-G-T p.Thr203Lys missense ACTN1 3 83306 3.60118E-5 41653 0 NA
14-69371456-A-G c.595-3T>C splice_region ACTN1 3 83218 3.60499E-5 41609 0 3.18654E-5
14-69376028-C-T c.594+7G>A splice_region ACTN1 1 82846 1.20706E-5 41423 0 8.26173E-6
14-69376030-C-T c.594+5G>A splice_region ACTN1 1 82872 1.20668E-5 41436 0 7.96514E-6
14-69376040-G-A p.Arg197Trp missense ACTN1 1 83004 1.20476E-5 41502 0 3.18878E-5
14-69376049-C-T p.Gly194Arg missense ACTN1 32 83062 3.85254E-4 41531 0 4.14356E-4
14-69376050-G-A p.Tyr193Tyr synonymous ACTN1 13 83078 1.56479E-4 41539 0 6.37349E-5
14-69376065-G-A p.Pro188Pro synonymous ACTN1 6 82978 7.23083E-5 41489 0 8.25164E-5
14-69376069-C-T p.Arg187Gln missense ACTN1 3 82960 3.6162E-5 41480 0 3.18756E-5
14-69376071-G-A p.His186His synonymous ACTN1 4 82922 4.82381E-5 41461 0 6.37024E-5
14-69376098-G-A p.Leu177Leu synonymous ACTN1 1 82612 1.21048E-5 41306 0 2.39366E-5
14-69376118-C-T c.516-5G>A splice_region ACTN1 1 82170 1.21699E-5 41085 0 NA
14-69376120-G-A c.516-7C>T splice_region ACTN1 15 82126 1.82646E-4 41063 0 7.20046E-5
14-69376691-T-C p.Ile166Val missense ACTN1 2 82822 2.41482E-5 41411 0 NA
14-69376708-G-A p.Pro160Leu missense ACTN1 1 82980 1.20511E-5 41490 0 8.24144E-6
14-69376712-C-A p.Ala159Ser missense ACTN1 1 82994 1.20491E-5 41497 0 8.24158E-6
14-69376716-C-T p.Lys157Lys synonymous ACTN1 1 83020 1.20453E-5 41510 0 NA
14-69376763-T-A c.428-4A>T splice_region ACTN1 1 82524 1.21177E-5 41262 0 3.18756E-5
14-69378863-AGA-GGG c.427+8_427+10delTCTinsCCC splice_region ACTN1 2 83260 2.40211E-5 41630 0 NA
14-69378869-C-T c.427+4G>A splice_region ACTN1 1 83282 1.20074E-5 41641 0 8.24035E-6
14-69378879-C-T p.Val141Met missense ACTN1 1 83330 1.20005E-5 41665 0 3.97791E-6
14-69378880-G-A p.Ser140Ser synonymous ACTN1 8 83330 9.60038E-5 41665 0 9.55475E-5
14-69378902-C-G p.Arg133Pro missense ACTN1 1 83372 1.19944E-5 41686 0 NA
14-69378903-G-A p.Arg133Cys missense ACTN1 2 83376 2.39877E-5 41688 0 NA
14-69378906-G-A p.Leu132Leu synonymous ACTN1 4 83378 4.79743E-5 41689 0 8.23696E-6
14-69378907-G-T p.Ile131Ile synonymous ACTN1 1 83374 1.19941E-5 41687 0 NA
14-69378919-G-T p.Ile127Ile synonymous ACTN1 4 83368 4.798E-5 41684 0 1.27478E-4
14-69378930-G-A p.Leu124Leu synonymous ACTN1 1 83352 1.19973E-5 41676 0 8.23696E-6
14-69378955-G-A p.Ile115Ile synonymous ACTN1 3 83270 3.60274E-5 41635 0 6.37267E-5
14-69387726-C-T p.Glu113Lys missense ACTN1 1 82356 1.21424E-5 41178 0 8.24933E-6
14-69387727-G-A p.Ala112Ala synonymous ACTN1 3 82392 3.64113E-5 41196 0 NA
14-69387733-G-A p.Ile110Ile synonymous ACTN1 3 82624 3.63091E-5 41312 0 8.24497E-5
14-69387735-T-C p.Ile110Val missense ACTN1 1 82728 1.20878E-5 41364 0 1.59274E-5
14-69387737-G-C p.Ser109Cys missense ACTN1 2 82792 2.41569E-5 41396 0 3.98143E-6
14-69387739-C-T p.Val108Val synonymous ACTN1 15 82846 1.81059E-4 41423 0 3.87418E-4
14-69387751-G-A p.Gly104Gly synonymous ACTN1 1 83098 1.2034E-5 41549 0 NA
14-69387760-G-A p.Ala101Ala synonymous ACTN1 10 83194 1.20201E-4 41597 0 2.47158E-5
14-69387766-G-C p.Phe99Leu missense ACTN1 1 83252 1.20117E-5 41626 0 3.9782E-6
14-69387787-G-A p.Asn92Asn synonymous ACTN1 1 83352 1.19973E-5 41676 0 2.78441E-5
14-69387797-T-C p.Lys89Arg missense ACTN1 1 83352 1.19973E-5 41676 0 NA
14-69387819-G-T p.Arg82Arg synonymous ACTN1 7 83286 8.40477E-5 41643 0 5.03525E-4
14-69387837-G-A p.Arg76Cys missense ACTN1 1 83170 1.20236E-5 41585 0 1.65066E-5
14-69387845-G-T c.221-3C>A splice_region ACTN1 1 83076 1.20372E-5 41538 0 NA
14-69387845-GT-G c.221-4delA splice_region ACTN1 1 83076 1.20372E-5 41538 0 3.1839E-5
14-69387849-G-GTTCTC c.221-8_221-7insGAGAA splice_region ACTN1 1 82976 1.20517E-5 41488 0 NA
14-69387975-T-C n.95+7A>G splice_region ACTN1 28 70944 3.94677E-4 35472 0 9.5584E-5
14-69387983-C-T n.94G>A splice_region ACTN1 2 67988 2.9417E-5 33994 0 NA
14-69387984-G-A n.93C>T splice_region ACTN1 5 67362 7.42258E-5 33681 0 6.36983E-5
14-69392268-G-A c.220+7C>T splice_region ACTN1 1 81600 1.22549E-5 40800 0 2.87283E-4
14-69392290-G-A p.Leu69Leu synonymous ACTN1 4 82228 4.86452E-5 41114 0 3.18918E-5
14-69392307-A-G p.Leu63Pro missense ACTN1 1 82442 1.21297E-5 41221 0 3.99428E-6
14-69392308-G-A c.-9C>T 5_prime_UTR_premature_start_codon_gain ACTN1 1 82456 1.21277E-5 41228 0 NA
14-69392309-G-A p.Gly62Gly synonymous ACTN1 1 82438 1.21303E-5 41219 0 3.99396E-6
14-69392313-T-A p.Asp61Val missense ACTN1 1 82454 1.2128E-5 41227 0 NA
14-69392315-C-T p.Arg60Arg synonymous ACTN1 2 82430 2.4263E-5 41215 0 NA
14-69392318-G-C p.Phe59Leu missense ACTN1 2 82442 2.42595E-5 41221 0 3.99068E-6
14-69392330-G-C p.Ile55Met missense ACTN1 3 82476 3.63742E-5 41238 0 8.25478E-6
14-69392339-G-A c.-40C>T 5_prime_UTR_premature_start_codon_gain ACTN1 1 82488 1.2123E-5 41244 0 6.60426E-5
14-69392351-C-T p.Ala48Ala synonymous ACTN1 1 82464 1.21265E-5 41232 0 1.19934E-5
14-69392378-T-A c.-79A>T 5_prime_UTR_premature_start_codon_gain ACTN1 1 81860 1.2216E-5 40930 0 8.31974E-6
14-69392382-G-A p.Thr38Met missense ACTN1 1 81704 1.22393E-5 40852 0 7.51014E-5
14-69440979-G-A n.83C>T splice_region ACTN1 1 41310 2.42072E-5 20655 0 NA
14-69444223-T-A c.-219A>T 5_prime_UTR_premature_start_codon_gain ACTN1 1 768 0.00130208 384 0 3.82263E-4
14-69444283-T-C c.-91+8A>G splice_region ACTN1 1 1976 5.06073E-4 988 0 4.78225E-4
14-69444660-G-A c.102+7C>T splice_region ACTN1 1 9846 1.01564E-4 4923 0 7.79606E-6
14-69444661-G-A c.102+6C>T splice_region ACTN1 967 9788 0.0987944 4894 50 0.0983229
14-69444666-C-T c.102+1G>A splice_donor ACTN1 1 9900 1.0101E-4 4950 0 NA
14-69444686-G-C p.Pro28Arg missense ACTN1 1 10152 9.85028E-5 5076 0 1.27771E-4
14-69444695-G-A p.Ser25Leu missense ACTN1 3 10246 2.92797E-4 5123 0 4.66505E-4
14-69444710-C-G p.Trp20Ser missense ACTN1 2 10388 1.9253E-4 5194 0 1.91534E-4
14-69444730-G-T c.36+3C>A splice_region ACTN1 1 10464 9.55658E-5 5232 0 NA
14-69444807-C-A c.-39G>T 5_prime_UTR_premature_start_codon_gain ACTN1 1 10502 9.522E-5 5251 0 NA
14-69444830-G-C c.-62C>G 5_prime_UTR_premature_start_codon_gain ACTN1 1 10522 9.5039E-5 5261 0 NA
14-69444950-A-G p.Leu9Pro missense ACTN1 1 10534 9.49307E-5 5267 0 6.37959E-5
14-69444956-A-G p.Leu7Pro missense ACTN1 3 10534 2.84792E-4 5267 0 2.98567E-4
14-69445019-G-A c.-44C>T 5_prime_UTR_premature_start_codon_gain ACTN1 1 10528 9.49848E-5 5264 0 1.77857E-5
14-69445181-G-A c.-206C>T 5_prime_UTR_premature_start_codon_gain ACTN1 1 8128 1.23031E-4 4064 0 NA
14-69445663-G-A c.105+6C>T splice_region ACTN1 1 77910 1.28353E-5 38955 0 NA
14-69445681-C-T p.Lys31Lys synonymous ACTN1 1 79302 1.261E-5 39651 0 NA
14-69445698-C-G p.Asp26His missense ACTN1 1 79806 1.25304E-5 39903 0 4.13924E-6
14-69445699-C-T p.Leu25Leu synonymous ACTN1 1 79870 1.25203E-5 39935 0 3.19632E-5
14-69445710-C-T p.Asp22Asn missense ACTN1 1 80088 1.24863E-5 40044 0 NA
14-69445722-C-T p.Asp18Asn missense ACTN1 1 80384 1.24403E-5 40192 0 NA
14-69445722-C-A p.Asp18Tyr missense ACTN1 1 80384 1.24403E-5 40192 0 NA
14-69445747-G-T p.Thr9Thr synonymous ACTN1 1 80582 1.24097E-5 40291 0 NA
14-69445754-T-C p.Gln7Arg missense ACTN1 1 80494 1.24233E-5 40247 0 NA
14-69445919-G-A c.-146C>T 5_prime_UTR_premature_start_codon_gain ACTN1 6 55142 1.0881E-4 27571 0 2.55558E-4
14-69446018-C-G c.-245G>C 5_prime_UTR_premature_start_codon_gain ACTN1 1 11862 8.43028E-5 5931 0 1.29391E-4
14-69446036-C-G c.-263G>C 5_prime_UTR_premature_start_codon_gain ACTN1 5 5292 9.44822E-4 2646 0 3.24444E-5
14-69446052-C-A c.-279G>T 5_prime_UTR_premature_start_codon_gain ACTN1 1 2278 4.38982E-4 1139 0 1.4042E-4
14-69446074-A-C c.-301T>G 5_prime_UTR_premature_start_codon_gain ACTN1 1 3188 3.13676E-4 1594 0 6.39264E-5
14-69446113-C-A c.-340G>T 5_prime_UTR_premature_start_codon_gain ACTN1 374 2304 0.162326 1152 37 0.170222