Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
9-111616775-TCCAGTGCAAAAGGTGCTGCCGCTTCTAAGCCCGACTCCCCCCTACCCTCTGCTATCAGATAGAAGCAAGAAACCCAGACTAGACAAGAGCCATTTCAGAGTAAACCTTTATGTGAAATTCTGTAAATGTGTATAGAGAGGCCTGTGG-T c.*41_*187del splice_region ACTL7B 1 60378 1.65623E-5 30189 0 NA
9-111616966-G-A p.Cys415Cys synonymous ACTL7B 2 82098 2.43611E-5 41049 0 NA
9-111616971-T-C p.Lys414Glu missense ACTL7B 1 82270 1.21551E-5 41135 0 1.84713E-5
9-111616982-G-T p.Ala410Asp missense ACTL7B 1 82538 1.21156E-5 41269 0 NA
9-111616986-C-T p.Val409Met missense ACTL7B 1 82674 1.20957E-5 41337 0 6.36983E-5
9-111616994-C-A p.Arg406Leu missense ACTL7B 1 82826 1.20735E-5 41413 0 NA
9-111616994-C-G p.Arg406Pro missense ACTL7B 1 82826 1.20735E-5 41413 0 5.29594E-6
9-111616994-C-T p.Arg406Gln missense ACTL7B 1 82826 1.20735E-5 41413 0 NA
9-111616999-C-T p.Glu404Glu synonymous ACTL7B 2 82884 2.41301E-5 41442 0 9.55171E-5
9-111617005-C-A p.Glu402Asp missense ACTL7B 1 82900 1.20627E-5 41450 0 1.82772E-5
9-111617012-T-A p.Lys400Met missense ACTL7B 1 82936 1.20575E-5 41468 0 NA
9-111617022-A-G p.Trp397Arg missense ACTL7B 1 82926 1.20589E-5 41463 0 2.71976E-5
9-111617032-G-A p.Phe393Phe synonymous ACTL7B 1 82902 1.20624E-5 41451 0 9.03179E-6
9-111617034-A-G p.Phe393Leu missense ACTL7B 1 82888 1.20645E-5 41444 0 4.54339E-6
9-111617036-G-A p.Ala392Val missense ACTL7B 2 82870 2.41342E-5 41435 0 9.01876E-6
9-111617043-G-C p.Leu390Val missense ACTL7B 5 82816 6.03748E-5 41408 0 8.51876E-6
9-111617061-C-G p.Gly384Arg missense ACTL7B 1 82850 1.207E-5 41425 0 3.18634E-5
9-111617073-C-A p.Val380Leu missense ACTL7B 1 82840 1.20715E-5 41420 0 NA
9-111617075-G-A p.Ser379Phe missense ACTL7B 3 82858 3.62065E-5 41429 0 1.76267E-5
9-111617080-C-A p.Lys377Asn missense ACTL7B 2 82830 2.41458E-5 41415 0 NA
9-111617089-A-G p.Pro374Pro synonymous ACTL7B 1 82770 1.20817E-5 41385 0 1.23891E-5
9-111617094-C-T p.Ala373Thr missense ACTL7B 4 82714 4.83594E-5 41357 0 4.15258E-5
9-111617097-CAG-C p.Ala371fs frameshift ACTL7B 1 82806 1.20764E-5 41403 0 NA
9-111617110-G-A p.Ser367Ser synonymous ACTL7B 4 82724 4.83536E-5 41362 0 6.37064E-5
9-111617114-T-TC p.Asp366fs frameshift ACTL7B 1 82690 1.20934E-5 41345 0 NA
9-111617125-G-A p.Leu362Leu synonymous ACTL7B 1 82610 1.21051E-5 41305 0 NA
9-111617127-G-A p.Leu362Phe missense ACTL7B 2 82602 2.42125E-5 41301 0 9.5584E-5
9-111617130-G-A p.Leu361Phe missense ACTL7B 1 82516 1.21189E-5 41258 0 NA
9-111617132-C-T p.Ser360Asn missense ACTL7B 1 82418 1.21333E-5 41209 0 NA
9-111617139-C-T p.Glu358Lys missense ACTL7B 1 82284 1.2153E-5 41142 0 6.37227E-5
9-111617139-C-G p.Glu358Gln missense ACTL7B 1 82284 1.2153E-5 41142 0 6.25E-4
9-111617151-G-A p.Arg354Cys missense ACTL7B 8 81894 9.76873E-5 40947 0 3.18674E-5
9-111617173-A-T p.Thr346Thr synonymous ACTL7B 1 81622 1.22516E-5 40811 0 8.285E-4
9-111617174-G-C p.Thr346Ser missense ACTL7B 440 81594 0.00539255 40797 3 0.0171198
9-111617184-C-T p.Gly343Ser missense ACTL7B 1 81644 1.22483E-5 40822 0 2.81535E-5
9-111617188-CAGT-C p.Leu341del disruptive_inframe_deletion ACTL7B 2 81656 2.4493E-5 40828 0 3.18634E-5
9-111617194-C-T p.Val339Val synonymous ACTL7B 1 81590 1.22564E-5 40795 0 NA
9-111617198-T-C p.Asn338Ser missense ACTL7B 1 81532 1.22651E-5 40766 0 NA
9-111617202-C-T p.Ala337Thr missense ACTL7B 2 81434 2.45598E-5 40717 0 6.56488E-5
9-111617203-G-A p.Ala336Ala synonymous ACTL7B 1 81442 1.22787E-5 40721 0 5.6429E-6
9-111617213-T-G p.Glu333Ala missense ACTL7B 3 81590 3.67692E-5 40795 0 NA
9-111617237-C-T p.Arg325His missense ACTL7B 1 81598 1.22552E-5 40799 0 5.6971E-6
9-111617237-C-A p.Arg325Leu missense ACTL7B 1 81598 1.22552E-5 40799 0 9.42241E-6
9-111617250-C-T p.Ala321Thr missense ACTL7B 3 81614 3.67584E-5 40807 0 NA
9-111617269-G-A p.Gly314Gly synonymous ACTL7B 2 82142 2.43481E-5 41071 0 5.62835E-6
9-111617272-C-G p.Pro313Pro synonymous ACTL7B 2 82182 2.43362E-5 41091 0 3.18735E-5
9-111617278-G-A p.Thr311Thr synonymous ACTL7B 9 82394 1.09231E-4 41197 0 2.23661E-5
9-111617279-G-GTGCTGCC p.Thr311fs frameshift ACTL7B 2 82398 2.42724E-5 41199 0 NA
9-111617279-G-C p.Thr311Ser missense ACTL7B 1 82398 1.21362E-5 41199 0 NA
9-111617286-C-A p.Gly309Cys missense ACTL7B 3 82428 3.63954E-5 41214 0 NA
9-111617288-G-A p.Ala308Val missense ACTL7B 2 82472 2.42507E-5 41236 1 3.18735E-5
9-111617288-G-T p.Ala308Glu missense ACTL7B 1 82472 1.21253E-5 41236 0 5.56489E-6
9-111617294-G-C p.Ser306Cys missense ACTL7B 14 82610 1.69471E-4 41305 0 1.67588E-4
9-111617327-C-T p.Arg295His missense ACTL7B 1 82786 1.20793E-5 41393 0 9.22884E-6
9-111617333-T-C p.Gln293Arg missense ACTL7B 1 82810 1.20758E-5 41405 0 NA
9-111617341-A-G p.Thr290Thr synonymous ACTL7B 9235 82604 0.111798 41302 589 0.129217
9-111617345-A-G p.Ile289Thr missense ACTL7B 1 82784 1.20796E-5 41392 0 9.63187E-6
9-111617355-C-T p.Gly286Ser missense ACTL7B 1 82732 1.20872E-5 41366 0 6.37633E-5
9-111617367-C-T p.Glu282Lys missense ACTL7B 4 82732 4.83489E-5 41366 0 1.33294E-5
9-111617368-G-A p.Tyr281Tyr synonymous ACTL7B 2 82720 2.41779E-5 41360 0 3.18695E-5
9-111617375-A-ACG p.Val279fs frameshift ACTL7B 1 82722 1.20887E-5 41361 0 NA
9-111617377-G-C p.Arg278Arg synonymous ACTL7B 2 82690 2.41867E-5 41345 0 8.53184E-6
9-111617378-C-T p.Arg278His missense ACTL7B 5 82704 6.04566E-5 41352 0 5.03525E-4
9-111617389-C-T p.Pro274Pro synonymous ACTL7B 744 82634 0.00900356 41317 12 0.0251762
9-111617403-G-A p.Leu270Leu synonymous ACTL7B 2 82566 2.4223E-5 41283 0 NA
9-111617412-C-A p.Glu267* stop_gained ACTL7B 1 82488 1.2123E-5 41244 0 NA
9-111617413-G-C p.Pro266Pro synonymous ACTL7B 273 82460 0.0033107 41230 1 0.01375
9-111617413-G-A p.Pro266Pro synonymous ACTL7B 1 82468 1.21259E-5 41234 0 NA
9-111617414-G-A p.Pro266Leu missense ACTL7B 207 82446 0.00251073 41223 0 0.001875
9-111617422-G-T p.Ala263Ala synonymous ACTL7B 144 82438 0.00174677 41219 6 0.00731269
9-111617431-G-A p.Cys260Cys synonymous ACTL7B 1 82304 1.21501E-5 41152 0 4.03128E-6
9-111617436-ACTT-A p.Lys258del conservative_inframe_deletion ACTL7B 2 82216 2.43262E-5 41108 0 3.10607E-4
9-111617460-T-C p.Ile251Val missense ACTL7B 1 81888 1.22118E-5 40944 0 NA
9-111617469-G-A p.His248Tyr missense ACTL7B 10 81752 1.22321E-4 40876 0 1.27405E-4
9-111617477-G-C p.Thr245Arg missense ACTL7B 10 81786 1.2227E-4 40893 0 1.38274E-4
9-111617480-A-G p.Phe244Ser missense ACTL7B 1 81786 1.2227E-5 40893 0 2.90112E-5
9-111617481-A-C p.Phe244Val missense ACTL7B 2 81784 2.44547E-5 40892 0 NA
9-111617484-C-T p.Ala243Thr missense ACTL7B 1 81716 1.22375E-5 40858 0 NA
9-111617485-G-A p.His242His synonymous ACTL7B 1 81748 1.22327E-5 40874 0 4.16403E-6
9-111617488-G-A p.Gly241Gly synonymous ACTL7B 1 81730 1.22354E-5 40865 0 3.18613E-5
9-111617492-G-A p.Ala240Val missense ACTL7B 1 81916 1.22076E-5 40958 0 NA
9-111617492-G-C p.Ala240Gly missense ACTL7B 1 81916 1.22076E-5 40958 0 NA
9-111617500-G-A p.Leu237Leu synonymous ACTL7B 1 82038 1.21895E-5 41019 0 2.59498E-5
9-111617545-G-C p.Ala222Ala synonymous ACTL7B 2 82102 2.43599E-5 41051 0 4.2107E-6
9-111617547-C-T p.Ala222Thr missense ACTL7B 2 82052 2.43748E-5 41026 0 2.10638E-5
9-111617550-G-A p.Arg221Cys missense ACTL7B 1 82036 1.21898E-5 41018 0 8.40075E-6
9-111617552-C-T p.Ser220Asn missense ACTL7B 1 81984 1.21975E-5 40992 0 NA
9-111617553-TGG-AGA p.ThrSer219IleCys missense ACTL7B 6 81958 7.32082E-5 40979 0 NA
9-111617563-C-G p.Pro216Pro synonymous ACTL7B 2 81732 2.44702E-5 40866 0 2.5171E-5
9-111617565-G-A p.Pro216Ser missense ACTL7B 4 81626 4.9004E-5 40813 0 1.27421E-4
9-111617565-G-C p.Pro216Ala missense ACTL7B 1 81626 1.2251E-5 40813 0 NA
9-111617571-C-T p.Val214Met missense ACTL7B 2 81552 2.45242E-5 40776 0 NA
9-111617574-C-T p.Asp213Asn missense ACTL7B 2 81502 2.45393E-5 40751 0 3.18654E-5
9-111617581-G-A p.Ser210Ser synonymous ACTL7B 1 81528 1.22657E-5 40764 0 6.37349E-5
9-111617595-C-T p.Val206Met missense ACTL7B 1 81278 1.23035E-5 40639 0 2.89173E-5
9-111617605-G-A p.Gly202Gly synonymous ACTL7B 16 80644 1.98403E-4 40322 0 3.50586E-4
9-111617606-C-T p.Gly202Asp missense ACTL7B 1 80706 1.23907E-5 40353 0 2.05004E-5
9-111617608-G-C p.His201Gln missense ACTL7B 1 80664 1.23971E-5 40332 0 4.09319E-6
9-111617609-T-C p.His201Arg missense ACTL7B 1 80628 1.24026E-5 40314 0 8.45666E-6
9-111617613-C-T p.Gly200Arg missense ACTL7B 3 80560 3.72393E-5 40280 0 6.37389E-5
9-111617615-C-A p.Ser199Ile missense ACTL7B 1 80454 1.24295E-5 40227 0 1.27421E-4
9-111617622-C-A p.Val197Leu missense ACTL7B 3 80352 3.73357E-5 40176 0 6.37105E-5
9-111617638-C-T p.Lys191Lys synonymous ACTL7B 1 80088 1.24863E-5 40044 0 NA
9-111617646-A-T p.Tyr189Asn missense ACTL7B 1 79830 1.25266E-5 39915 0 NA
9-111617650-G-A p.Tyr187Tyr synonymous ACTL7B 18145 79038 0.229573 39519 2097 0.243202
9-111617653-G-A p.Ile186Ile synonymous ACTL7B 8 79772 1.00286E-4 39886 0 8.35352E-6
9-111617657-G-A p.Ser185Phe missense ACTL7B 1 79728 1.25426E-5 39864 0 NA
9-111617665-C-T p.Ser182Ser synonymous ACTL7B 17 79410 2.14079E-4 39705 0 0.0040282
9-111617666-G-C p.Ser182Trp missense ACTL7B 1 79410 1.25929E-5 39705 0 NA
9-111617671-G-C p.Ser180Ser synonymous ACTL7B 2 79390 2.51921E-5 39695 0 NA
9-111617675-G-T p.Thr179Lys missense ACTL7B 1 79236 1.26205E-5 39618 0 8.35506E-6
9-111617679-C-T p.Val178Met missense ACTL7B 11 79236 1.38826E-4 39618 0 1.60421E-4
9-111617680-G-A p.His177His synonymous ACTL7B 1 79330 1.26056E-5 39665 0 1.67121E-5
9-111617681-T-C p.His177Arg missense ACTL7B 1 79408 1.25932E-5 39704 0 NA
9-111617685-T-C p.Met176Val missense ACTL7B 2 79482 2.51629E-5 39741 0 8.35687E-6
9-111617691-G-A p.Pro174Ser missense ACTL7B 3 79470 3.77501E-5 39735 0 9.55171E-5
9-111617692-G-T p.Ile173Ile synonymous ACTL7B 1 79478 1.25821E-5 39739 0 NA
9-111617698-G-A p.Phe171Phe synonymous ACTL7B 2 79564 2.5137E-5 39782 0 8.36288E-6
9-111617719-C-A p.Ala164Ala synonymous ACTL7B 22 79906 2.75324E-4 39953 0 7.00592E-4
9-111617719-C-T p.Ala164Ala synonymous ACTL7B 7 79906 8.76029E-5 39953 0 9.55353E-5
9-111617734-G-C p.Asn159Lys missense ACTL7B 1 80486 1.24245E-5 40243 0 NA
9-111617738-C-T p.Ser158Asn missense ACTL7B 18 80550 2.23464E-4 40275 0 5.09522E-4
9-111617741-C-G p.Ser157Thr missense ACTL7B 2 80644 2.48004E-5 40322 0 8.36246E-6
9-111617744-G-A p.Pro156Leu missense ACTL7B 2 80706 2.47813E-5 40353 0 3.18451E-5
9-111617746-G-A p.Ser155Ser synonymous ACTL7B 1780 80584 0.0220888 40292 22 0.0221349
9-111617749-G-A p.Leu154Leu synonymous ACTL7B 1 80794 1.23772E-5 40397 0 NA
9-111617757-G-A p.Pro152Ser missense ACTL7B 3 80886 3.70892E-5 40443 0 6.25E-4
9-111617761-G-T p.Ser150Ser synonymous ACTL7B 1 80918 1.23582E-5 40459 0 8.35366E-6
9-111617767-C-T p.Leu148Leu synonymous ACTL7B 1 81090 1.2332E-5 40545 0 1.19849E-5
9-111617775-C-T p.Ala146Thr missense ACTL7B 3 81132 3.69768E-5 40566 0 8.3478E-6
9-111617776-G-T p.His145Gln missense ACTL7B 3 81210 3.69413E-5 40605 0 9.55475E-5
9-111617776-G-A p.His145His synonymous ACTL7B 4 81210 4.9255E-5 40605 0 0.00125
9-111617779-C-T p.Glu144Glu synonymous ACTL7B 3 81250 3.69231E-5 40625 0 2.1696E-4
9-111617780-T-C p.Glu144Gly missense ACTL7B 1 81274 1.23041E-5 40637 0 8.34446E-6
9-111617785-G-A p.Pro142Pro synonymous ACTL7B 1 81376 1.22886E-5 40688 0 8.3446E-5
9-111617787-G-C p.Pro142Ala missense ACTL7B 3 81440 3.68369E-5 40720 0 NA
9-111617788-G-A p.Leu141Leu synonymous ACTL7B 3 81458 3.68288E-5 40729 0 NA
9-111617789-A-T p.Leu141His missense ACTL7B 1 81456 1.22766E-5 40728 0 2.50158E-5
9-111617790-G-A p.Leu141Phe missense ACTL7B 1 81476 1.22736E-5 40738 0 7.97957E-6
9-111617792-A-T p.Ile140Asn missense ACTL7B 1 81510 1.22684E-5 40755 0 NA
9-111617793-T-A p.Ile140Phe missense ACTL7B 1 81552 1.22621E-5 40776 0 3.18898E-5
9-111617794-C-T p.Lys139Lys synonymous ACTL7B 1 81574 1.22588E-5 40787 0 3.98899E-6
9-111617802-C-A p.Ala137Ser missense ACTL7B 1 81520 1.22669E-5 40760 0 NA
9-111617808-G-A p.Arg135Cys missense ACTL7B 2 81674 2.44876E-5 40837 0 1.19659E-5
9-111617815-G-A p.Tyr132Tyr synonymous ACTL7B 1 81926 1.22061E-5 40963 0 NA
9-111617824-G-C p.Ile129Met missense ACTL7B 96 82140 0.00116874 41070 0 0.00100705
9-111617826-T-A p.Ile129Phe missense ACTL7B 6 82176 7.3014E-5 41088 0 3.18593E-5
9-111617827-G-T p.Asp128Glu missense ACTL7B 568 82170 0.0069125 41085 11 0.0138614
9-111617836-G-A p.Cys125Cys synonymous ACTL7B 4 82298 4.86039E-5 41149 0 7.97232E-6
9-111617841-C-G p.Asp124His missense ACTL7B 1 82384 1.21383E-5 41192 0 8.30358E-6
9-111617847-C-T p.Asp122Asn missense ACTL7B 14 82372 1.69961E-4 41186 0 5.03525E-4
9-111617853-C-T p.Val120Met missense ACTL7B 1 82382 1.21386E-5 41191 0 3.18593E-5
9-111617857-G-A p.Gly118Gly synonymous ACTL7B 4 82440 4.85201E-5 41220 0 NA
9-111617862-G-GTACCTTAACCCAAATTCATCAATCTCCAATGCACCAGGCCTCCTTAACCGCCCCAAGAGTTCTTTCCTCC p.His117fs frameshift ACTL7B 1 82398 1.21362E-5 41199 0 NA
9-111617867-A-G p.Leu115Pro missense ACTL7B 1 82392 1.21371E-5 41196 0 NA
9-111617869-C-CG p.Leu115fs frameshift ACTL7B 1 82328 1.21465E-5 41164 0 NA
9-111617869-C-T p.Pro114Pro synonymous ACTL7B 1 82328 1.21465E-5 41164 0 4.97463E-5
9-111617871-G-C p.Pro114Ala missense ACTL7B 1 82338 1.21451E-5 41169 0 3.18552E-5
9-111617873-T-A p.Asn113Ile missense ACTL7B 1 82322 1.21474E-5 41161 0 NA
9-111617882-T-C p.Lys110Arg missense ACTL7B 1 82230 1.2161E-5 41115 0 4.38471E-5
9-111617886-G-A p.Leu109Phe missense ACTL7B 2 82160 2.43427E-5 41080 0 6.37938E-5
9-111617887-A-T p.Pro108Pro synonymous ACTL7B 2 82136 2.43499E-5 41068 0 8.28734E-6
9-111617891-G-A p.Ala107Val missense ACTL7B 1 81984 1.21975E-5 40992 0 3.18654E-5
9-111617893-C-T p.Glu106Glu synonymous ACTL7B 3 82034 3.65702E-5 41017 0 1.19648E-5
9-111617913-G-T p.His100Asn missense ACTL7B 3 81806 3.66721E-5 40903 0 8.28363E-6
9-111617921-A-G p.Leu97Ser missense ACTL7B 3 81792 3.66784E-5 40896 0 1.65653E-5
9-111617926-C-T p.Trp95* stop_gained ACTL7B 1 81790 1.22264E-5 40895 0 NA
9-111617931-T-G p.Lys94Gln missense ACTL7B 2 81742 2.44672E-5 40871 0 NA
9-111617933-C-T p.Arg93His missense ACTL7B 6 81702 7.34376E-5 40851 0 9.55292E-5
9-111617933-CG-C p.Arg93fs frameshift ACTL7B 1 81702 1.22396E-5 40851 0 8.28734E-6
9-111617933-C-A p.Arg93Leu missense ACTL7B 2 81702 2.44792E-5 40851 0 NA
9-111617941-G-T p.Gly90Gly synonymous ACTL7B 1 81690 1.22414E-5 40845 0 NA
9-111617943-C-G p.Gly90Arg missense ACTL7B 1 81742 1.22336E-5 40871 0 NA
9-111617954-G-A p.Ala86Val missense ACTL7B 1 81666 1.2245E-5 40833 0 NA
9-111617958-C-T p.Glu85Lys missense ACTL7B 1 81762 1.22306E-5 40881 0 8.29449E-6
9-111617959-G-A p.Pro84Pro synonymous ACTL7B 1 81730 1.22354E-5 40865 0 2.40645E-5
9-111617965-G-C p.Arg82Arg synonymous ACTL7B 2 81880 2.4426E-5 40940 0 1.65832E-5
9-111617973-C-T p.Gly80Ser missense ACTL7B 1 81974 1.2199E-5 40987 0 NA
9-111617977-G-A p.Thr78Thr synonymous ACTL7B 4 81942 4.8815E-5 40971 0 3.18654E-5
9-111617978-G-T p.Thr78Asn missense ACTL7B 1 81992 1.21963E-5 40996 0 8.04583E-6
9-111617979-TGGA-T p.Ser77del conservative_inframe_deletion ACTL7B 1 81990 1.21966E-5 40995 0 NA
9-111617991-A-G p.Phe74Leu missense ACTL7B 1 82176 1.2169E-5 41088 0 NA
9-111618004-C-T p.Pro69Pro synonymous ACTL7B 2 82248 2.43167E-5 41124 0 8.0973E-6
9-111618005-G-A p.Pro69Leu missense ACTL7B 5 82256 6.07858E-5 41128 0 1.21384E-5
9-111618014-G-A p.Ala66Val missense ACTL7B 1 82414 1.21339E-5 41207 0 3.18573E-5
9-111618016-G-A p.Tyr65Tyr synonymous ACTL7B 2 82458 2.42548E-5 41229 0 NA
9-111618022-G-A p.Cys63Cys synonymous ACTL7B 1 82524 1.21177E-5 41262 0 1.21293E-5
9-111618031-G-C p.Tyr60* stop_gained ACTL7B 1 82598 1.21068E-5 41299 0 NA
9-111618048-C-T p.Asp55Asn missense ACTL7B 1 82530 1.21168E-5 41265 0 NA
9-111618056-A-G p.Val52Ala missense ACTL7B 3 82560 3.63372E-5 41280 0 3.19061E-5
9-111618059-G-A p.Ala51Val missense ACTL7B 1 82546 1.21145E-5 41273 0 8.26474E-6
9-111618064-G-C p.Ile49Met missense ACTL7B 2 82574 2.42207E-5 41287 0 8.26255E-6
9-111618073-C-T p.Val46Val synonymous ACTL7B 1 82486 1.21233E-5 41243 0 NA
9-111618080-C-A p.Arg44Met missense ACTL7B 5 82410 6.06722E-5 41205 0 5.03525E-4
9-111618083-G-C p.Pro43Arg missense ACTL7B 1 82408 1.21347E-5 41204 0 5.78465E-5
9-111618106-C-T p.Ala35Ala synonymous ACTL7B 1569 81864 0.0191659 40932 92 0.0386381
9-111618111-C-T p.Gly34Ser missense ACTL7B 1 81894 1.22109E-5 40947 0 NA
9-111618119-C-T p.Arg31Gln missense ACTL7B 6 81622 7.35096E-5 40811 0 8.30496E-6
9-111618130-G-A p.Asp27Asp synonymous ACTL7B 4 81104 4.93194E-5 40552 0 2.3739E-4
9-111618132-C-G p.Asp27His missense ACTL7B 1 81078 1.23338E-5 40539 0 1.27437E-4
9-111618138-C-A p.Gly25Cys missense ACTL7B 17 80540 2.11075E-4 40270 0 3.50676E-4
9-111618139-G-T p.Pro24Pro synonymous ACTL7B 4 80620 4.96155E-5 40310 0 1.27502E-4
9-111618142-C-A p.Arg23Arg synonymous ACTL7B 44 80334 5.47713E-4 40167 0 5.12967E-4
9-111618143-C-G p.Arg23Pro missense ACTL7B 4 80130 4.99189E-5 40065 0 3.18776E-5
9-111618143-C-T p.Arg23Gln missense ACTL7B 1 80130 1.24797E-5 40065 0 2.52602E-5
9-111618145-T-G p.Thr22Thr synonymous ACTL7B 1 80178 1.24722E-5 40089 0 NA
9-111618154-C-T p.Glu19Glu synonymous ACTL7B 3 80210 3.74018E-5 40105 0 1.21327E-5
9-111618163-G-A p.Asp16Asp synonymous ACTL7B 17479 78772 0.221894 39386 1872 0.239174
9-111618171-G-A p.Gln14* stop_gained ACTL7B 3 79822 3.75836E-5 39911 0 1.64802E-4
9-111618176-G-A p.Thr12Met missense ACTL7B 9 79588 1.13082E-4 39794 0 6.70562E-5
9-111618184-G-A p.Pro9Pro synonymous ACTL7B 1 79572 1.25672E-5 39786 0 8.77285E-6
9-111618192-G-A p.Pro7Ser missense ACTL7B 2 79364 2.52003E-5 39682 0 NA
9-111618205-C-T p.Ala2Ala synonymous ACTL7B 3 79466 3.7752E-5 39733 0 5.03525E-4
9-111618206-G-A p.Ala2Val missense ACTL7B 7 79270 8.83058E-5 39635 0 3.83065E-5
9-111618209-A-G p.Met1? start_lost ACTL7B 7758 78958 0.0982548 39479 358 0.100951
9-111618305-G-A c.-95C>T 5_prime_UTR_premature_start_codon_gain ACTL7B 1 78142 1.27972E-5 39071 0 NA
9-111618339-G-A c.-129C>T 5_prime_UTR_premature_start_codon_gain ACTL7B 1 76144 1.3133E-5 38072 0 NA
9-111618383-C-G c.-173G>C 5_prime_UTR_premature_start_codon_gain ACTL7B 1 70132 1.42588E-5 35066 0 NA
9-111618389-C-T c.-179G>A 5_prime_UTR_premature_start_codon_gain ACTL7B 1 69448 1.43993E-5 34724 0 3.18613E-5
9-111618601-T-C c.-391A>G 5_prime_UTR_premature_start_codon_gain ACTL7B 8 43994 1.81843E-4 21997 0 2.54988E-4
9-111618789-T-C c.-579A>G 5_prime_UTR_premature_start_codon_gain ACTL7B 1 41986 2.38175E-5 20993 0 NA
9-111618819-T-C c.-609A>G 5_prime_UTR_premature_start_codon_gain ACTL7B 2 41986 4.76349E-5 20993 0 3.18593E-5
9-111618883-G-A c.-673C>T 5_prime_UTR_premature_start_codon_gain ACTL7B 6 42002 1.4285E-4 21001 0 3.1841E-5
9-111619074-G-C c.-864C>G 5_prime_UTR_premature_start_codon_gain ACTL7B 1 41826 2.39086E-5 20913 0 NA
9-111619139-T-C c.-929A>G 5_prime_UTR_premature_start_codon_gain ACTL7B 24 41404 5.79654E-4 20702 0 7.65062E-4
9-111619160-G-A c.-950C>T 5_prime_UTR_premature_start_codon_gain ACTL7B 23 41184 5.58469E-4 20592 0 1.2738E-4