Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
3-179280678-C-T c.-203C>T 5_prime_UTR_premature_start_codon_gain ACTL6A 1 67566 1.48003E-5 33783 0 6.27353E-4
3-179280688-G-A c.-193G>A 5_prime_UTR_premature_start_codon_gain ACTL6A 4 69584 5.74845E-5 34792 0 NA
3-179280692-T-C c.-189T>C 5_prime_UTR_premature_start_codon_gain ACTL6A 3 70200 4.2735E-5 35100 0 NA
3-179280702-G-T c.-179G>T 5_prime_UTR_premature_start_codon_gain ACTL6A 16 72052 2.22062E-4 36026 0 6.36902E-5
3-179280743-C-T c.-312C>T 5_prime_UTR_premature_start_codon_gain ACTL6A 8 77014 1.03877E-4 38507 0 6.36983E-5
3-179280746-C-T c.-309C>T 5_prime_UTR_premature_start_codon_gain ACTL6A 2 77278 2.58806E-5 38639 0 NA
3-179280761-G-A c.-102G>A splice_region ACTL6A 1 78218 1.27848E-5 39109 0 NA
3-179280762-G-T c.-102+1G>T splice_donor ACTL6A 5 78222 6.39206E-5 39111 0 3.18492E-5
3-179280781-A-G c.-274A>G 5_prime_UTR_premature_start_codon_gain ACTL6A 1 78948 1.26666E-5 39474 0 NA
3-179280905-GGTGA-G c.25+8_25+11delAGTG splice_region ACTL6A 2 79908 2.50288E-5 39954 0 NA
3-179280908-G-A c.25+3G>A splice_region ACTL6A 5 79860 6.26096E-5 39930 0 8.67236E-5
3-179280947-G-A c.-108G>A 5_prime_UTR_premature_start_codon_gain ACTL6A 10 78724 1.27026E-4 39362 0 6.25E-4
3-179280949-G-A c.-106G>A 5_prime_UTR_premature_start_codon_gain ACTL6A 3 78656 3.81408E-5 39328 0 3.19264E-5
3-179280949-G-C c.-106G>C 5_prime_UTR_premature_start_codon_gain ACTL6A 1 78656 1.27136E-5 39328 0 NA
3-179280961-A-G c.-102+8A>G splice_region ACTL6A 7 77470 9.03576E-5 38735 0 6.47333E-5
3-179287631-T-C p.Val15Val synonymous ACTL6A 1 83368 1.1995E-5 41684 0 9.88549E-5
3-179287646-C-A p.Ser20Ser synonymous ACTL6A 5 83384 5.99635E-5 41692 0 3.29511E-5
3-179287647-T-C p.Tyr21His missense ACTL6A 46 83386 5.51651E-4 41693 0 0.00149672
3-179287653-G-A p.Val23Met missense ACTL6A 1 83396 1.1991E-5 41698 0 3.29506E-5
3-179287682-C-T p.Cys32Cys synonymous ACTL6A 2 83396 2.3982E-5 41698 0 9.55231E-5
3-179287863-T-C p.Phe37Phe synonymous ACTL6A 1 83394 1.19913E-5 41697 0 3.18451E-5
3-179287873-A-G p.Ile41Val missense ACTL6A 5 83382 5.9965E-5 41691 0 2.47402E-5
3-179287886-T-C p.Val3Ala missense ACTL6A 3 83382 3.5979E-5 41691 0 3.9781E-6
3-179287895-A-T p.Asp6Val missense ACTL6A 2 83390 2.39837E-5 41695 0 NA
3-179287899-C-T p.Asp7Asp synonymous ACTL6A 9 83392 1.07924E-4 41696 0 9.56084E-5
3-179287900-G-A p.Gly8Arg missense ACTL6A 1 83396 1.1991E-5 41698 0 2.38639E-5
3-179287926-C-T p.Gly16Gly synonymous ACTL6A 1 83400 1.19904E-5 41700 0 1.64734E-5
3-179287932-A-G p.Lys18Lys synonymous ACTL6A 1 83400 1.19904E-5 41700 0 NA
3-179287945-G-A p.Gly23Ser missense ACTL6A 9 83394 1.07921E-4 41697 0 6.25E-4
3-179287950-C-T p.Pro24Pro synonymous ACTL6A 1 83390 1.19918E-5 41695 0 8.23696E-6
3-179287964-A-C p.Asp29Ala missense ACTL6A 1 83394 1.19913E-5 41697 0 NA
3-179287965-T-C p.Asp29Asp synonymous ACTL6A 1 83392 1.19916E-5 41696 0 4.94218E-5
3-179287981-G-T p.Val35Phe missense ACTL6A 1 83380 1.19933E-5 41690 0 NA
3-179287985-C-T p.Pro36Leu missense ACTL6A 3 83382 3.5979E-5 41691 0 1.19676E-5
3-179287986-G-A p.Pro36Pro synonymous ACTL6A 3 83380 3.59799E-5 41690 0 8.2409E-6
3-179287989-G-A p.Arg37Arg synonymous ACTL6A 4 83380 4.79731E-5 41690 0 3.50385E-4
3-179288022-T-C p.Asn48Asn synonymous ACTL6A 1 83342 1.19988E-5 41671 0 NA
3-179288027-T-C p.Met50Thr missense+splice_region ACTL6A 15 83322 1.80024E-4 41661 0 4.41693E-5
3-179288028-G-A p.Met50Ile missense+splice_region ACTL6A 4 83316 4.801E-5 41658 0 2.81246E-5
3-179288029-G-GTTGAAGACTGGGATA c.151_151+1insTTGAAGACTGGGATA splice_donor ACTL6A 1 83308 1.20036E-5 41654 0 NA
3-179288037-G-A c.151+8G>A splice_region ACTL6A 1 83266 1.20097E-5 41633 0 8.35296E-6
3-179291164-C-G p.Asp53Glu missense ACTL6A 3 82694 3.62783E-5 41347 0 9.57488E-5
3-179291182-T-G p.Ala59Ala synonymous ACTL6A 1 82848 1.20703E-5 41424 0 NA
3-179291183-A-G p.Ile60Val missense ACTL6A 4 82904 4.82486E-5 41452 0 8.60311E-6
3-179291185-T-A p.Ile60Ile synonymous ACTL6A 2 82930 2.41167E-5 41465 0 3.19285E-5
3-179291192-C-G p.His63Asp missense ACTL6A 1 82958 1.20543E-5 41479 0 NA
3-179291193-A-G p.His63Arg missense ACTL6A 14 82962 1.68752E-4 41481 0 2.39278E-4
3-179291214-A-G p.Lys70Arg missense ACTL6A 1 82946 1.2056E-5 41473 0 4.33806E-6
3-179291223-C-T p.Ala73Val missense ACTL6A 1 82878 1.20659E-5 41439 0 NA
3-179291225-A-G p.Ser74Gly missense ACTL6A 9 82858 1.0862E-4 41429 0 4.7662E-5
3-179291235-C-A p.Pro77His missense ACTL6A 1 82752 1.20843E-5 41376 0 NA
3-179291255-C-T p.Pro84Ser missense+splice_region ACTL6A 2 82170 2.43398E-5 41085 0 8.25914E-6
3-179291264-T-G c.252+7T>G splice_region ACTL6A 18 81756 2.20167E-4 40878 0 1.15785E-4
3-179292151-T-G c.253-7T>G splice_region ACTL6A 1 82330 1.21462E-5 41165 0 NA
3-179292154-C-T c.253-4C>T splice_region ACTL6A 4 82428 4.85272E-5 41214 0 NA
3-179292164-A-G p.Thr87Ala missense ACTL6A 3 82658 3.62941E-5 41329 0 2.38914E-5
3-179292165-C-A p.Thr87Asn missense ACTL6A 1 82662 1.20975E-5 41331 0 NA
3-179292202-T-G p.Phe99Leu missense ACTL6A 1 82992 1.20494E-5 41496 0 3.18451E-5
3-179292209-T-C p.Tyr102His missense ACTL6A 4 82992 4.81974E-5 41496 0 NA
3-179292210-A-G p.Tyr102Cys missense ACTL6A 1 82988 1.20499E-5 41494 0 NA
3-179292220-T-C p.Pro105Pro synonymous ACTL6A 4 82966 4.82125E-5 41483 0 3.97877E-6
3-179292228-T-A p.Phe108Tyr missense ACTL6A 2 82846 2.41412E-5 41423 0 NA
3-179292255-C-CATTTGCTAATG c.350_350+1insATTTGCTAATG splice_donor ACTL6A 1 82482 1.21239E-5 41241 0 NA
3-179292257-T-TCGTTCTACTGGGCTG c.350+2_350+3insCGTTCTACTGGGCTG splice_region ACTL6A 1 82466 1.21262E-5 41233 0 NA
3-179292257-TA-T c.350+3delA splice_region ACTL6A 1 82466 1.21262E-5 41233 0 NA
3-179292257-T-TCGTTCTACTGGGCTGATTTTGGACAGTGGAGCC c.350+2_350+3insCGTTCTACTGGGCTGATTTTGGACAGTGGAGCC splice_region ACTL6A 1 82468 1.21259E-5 41234 0 NA
3-179292287-G-T n.534G>T splice_region ACTL6A 1 81560 1.22609E-5 40780 0 3.29495E-5
3-179292292-A-T n.536+3A>T splice_region ACTL6A 2 81314 2.4596E-5 40657 0 8.23723E-6
3-179293184-T-C n.537-7T>C splice_region ACTL6A 4 51318 7.79454E-5 25659 0 5.94663E-4
3-179293185-T-C n.537-6T>C splice_region ACTL6A 1 51320 1.94856E-5 25660 0 NA
3-179293187-A-G n.537-4A>G splice_region ACTL6A 2 51322 3.89696E-5 25661 0 1.6276E-4
3-179293198-C-T p.His156Tyr missense ACTL6A 1 51324 1.94841E-5 25662 0 1.6276E-4
3-179293204-C-T p.Leu158Leu synonymous ACTL6A 2 51322 3.89696E-5 25661 0 8.13405E-5
3-179293211-A-G p.His160Arg missense ACTL6A 1 51324 1.94841E-5 25662 0 1.48648E-5
3-179293214-A-G p.Ter161Ter stop_retained ACTL6A 5 51322 9.74241E-5 25661 0 6.68966E-5
3-179293298-C-T n.495+6C>T splice_region ACTL6A 1 51230 1.95198E-5 25615 0 NA
3-179293300-G-T n.495+8G>T splice_region ACTL6A 1 51222 1.95229E-5 25611 0 NA
3-179294018-C-T p.Arg122Cys missense ACTL6A 1 83368 1.1995E-5 41684 0 NA
3-179294023-T-C p.Ser123Ser synonymous ACTL6A 1 83384 1.19927E-5 41692 0 3.98099E-6
3-179294029-G-C p.Gly125Gly synonymous ACTL6A 1 83384 1.19927E-5 41692 0 3.98476E-6
3-179294052-C-T p.Thr133Ile missense ACTL6A 6 83382 7.1958E-5 41691 0 6.3674E-5
3-179294077-C-T p.His141His synonymous ACTL6A 2 83368 2.399E-5 41684 0 2.22987E-4
3-179294079-A-G p.Asp142Gly missense ACTL6A 1 83364 1.19956E-5 41682 0 NA
3-179294095-A-G p.Gln147Gln synonymous ACTL6A 1 83336 1.19996E-5 41668 0 4.27577E-5
3-179294400-T-C c.446-8T>C splice_region ACTL6A 9 83026 1.084E-4 41513 0 5.81956E-5
3-179294404-A-G c.446-4A>G splice_region ACTL6A 1 83064 1.20389E-5 41532 0 6.36821E-5
3-179294405-T-C c.446-3T>C splice_region ACTL6A 3 83066 3.61159E-5 41533 0 7.5986E-5
3-179294409-C-T p.Gly149Gly splice_region+synonymous ACTL6A 2 83094 2.40691E-5 41547 0 NA
3-179294481-T-C p.Ile173Ile synonymous ACTL6A 1 83210 1.20178E-5 41605 0 NA
3-179294488-G-A p.Val176Ile missense ACTL6A 81 83180 9.73792E-4 41590 0 0.00503525
3-179294495-C-T p.Pro178Leu missense ACTL6A 2 83194 2.40402E-5 41597 0 0.00125
3-179294496-A-C p.Pro178Pro synonymous ACTL6A 1 83188 1.2021E-5 41594 0 NA
3-179294500-A-G p.Met180Val missense ACTL6A 1 83190 1.20207E-5 41595 0 1.6512E-5
3-179294505-T-A p.Ile181Ile synonymous ACTL6A 1 83184 1.20215E-5 41592 0 NA
3-179294509-T-A p.Ser183Thr missense ACTL6A 1037 83172 0.0124681 41586 14 0.020141
3-179294514-AGTAAGTAATTATTGAATTTTCTTTGTAGAACTTACTTCTAGCTCCCCCACCCCTATGAAGTGAACTCCATTAACCTAGCATCTCTTGGTACTCTCAG-A c.552+1_553-1delGTAAGTAATTATTGAATTTTCTTTGTAGAACTTACTTCTAGCTCCCCCACCCCTATGAAGTGAACTCCATTAACCTAGCATCTCTTGGTACTCTCAG splice_acceptor ACTL6A 13 83180 1.56288E-4 41590 6 NA
3-179294604-A-G c.553-8A>G splice_region ACTL6A 1 83244 1.20129E-5 41622 0 NA
3-179294609-C-G c.553-3C>G splice_region ACTL6A 2 83240 2.40269E-5 41620 0 NA
3-179294630-T-A p.Ser191Thr missense ACTL6A 2 83248 2.40246E-5 41624 0 NA
3-179294634-C-T p.Pro192Leu missense ACTL6A 1 83238 1.20137E-5 41619 0 1.59155E-5
3-179294650-A-G p.Arg197Arg synonymous ACTL6A 1 83212 1.20175E-5 41606 0 1.64804E-5
3-179294655-A-G p.Glu199Gly missense ACTL6A 1 83202 1.20189E-5 41601 0 NA
3-179294673-C-T p.Thr205Met missense ACTL6A 1 83146 1.2027E-5 41573 0 3.2969E-5
3-179294684-C-T p.His209Tyr missense ACTL6A 1 83056 1.20401E-5 41528 0 8.24715E-6
3-179294686-C-T p.His209His synonymous ACTL6A 1 83044 1.20418E-5 41522 0 3.18674E-5
3-179294694-T-A p.Met212Lys missense ACTL6A 1 82974 1.2052E-5 41487 0 NA
3-179294701-T-TTGTGTTATCCAGGATTTTCAAGCTTCG c.642_642+1insTGTGTTATCCAGGATTTTCAAGCTTCG splice_donor ACTL6A 6 82830 7.24375E-5 41415 3 NA
3-179298453-C-T p.Ser223Leu missense ACTL6A 2 82950 2.41109E-5 41475 0 1.21266E-5
3-179298454-G-A p.Ser223Ser synonymous ACTL6A 6 82950 7.23327E-5 41475 0 3.19142E-5
3-179298476-A-G p.Thr231Ala missense ACTL6A 2 82932 2.41161E-5 41466 0 NA
3-179298481-T-C p.Tyr232Tyr synonymous ACTL6A 23 82930 2.77342E-4 41465 0 0.00120912
3-179298703-T-C p.Thr242Thr synonymous ACTL6A 1 82494 1.21221E-5 41247 0 4.47812E-6
3-179298710-T-C p.Tyr245His missense ACTL6A 1 82438 1.21303E-5 41219 0 NA
3-179298723-A-G p.Asn249Ser missense ACTL6A 1 82410 1.21345E-5 41205 0 3.18512E-5
3-179298753-G-A p.Arg259Gln missense ACTL6A 1 82514 1.21192E-5 41257 0 NA
3-179298757-A-T p.Leu260Leu synonymous ACTL6A 1 82604 1.2106E-5 41302 0 NA
3-179298757-A-G p.Leu260Leu synonymous ACTL6A 2 82604 2.42119E-5 41302 0 2.47611E-5
3-179298763-T-G p.Ile262Met missense ACTL6A 2 82678 2.41902E-5 41339 0 NA
3-179298782-C-T p.Pro269Ser missense ACTL6A 1 82818 1.20747E-5 41409 0 4.42537E-6
3-179298791-G-A p.Val272Ile missense ACTL6A 1 82912 1.2061E-5 41456 0 4.32111E-6
3-179298958-A-G p.Ser284Gly missense ACTL6A 12 83274 1.44103E-4 41637 0 4.14092E-4
3-179298962-ATGT-A p.Val287del disruptive_inframe_deletion ACTL6A 1 83276 1.20083E-5 41638 0 NA
3-179298975-A-G p.Thr289Thr synonymous ACTL6A 16 83278 1.92128E-4 41639 0 0.0020141
3-179298984-G-A p.Gly292Gly synonymous ACTL6A 1 83280 1.20077E-5 41640 0 NA
3-179298993-T-C p.Asp295Asp synonymous ACTL6A 1 83272 1.20088E-5 41636 0 NA
3-179298995-T-C p.Ile296Thr missense ACTL6A 1 83272 1.20088E-5 41636 0 1.31787E-4
3-179298999-C-T p.Asp297Asp synonymous ACTL6A 52290 82014 0.637574 41007 16798 0.7275
3-179301141-G-A p.Gly301Ser missense+splice_region ACTL6A 1 83176 1.20227E-5 41588 0 NA
3-179301144-C-T p.Leu302Phe missense ACTL6A 1 83188 1.2021E-5 41594 0 NA
3-179301159-A-G p.Ile307Val missense ACTL6A 3 83220 3.6049E-5 41610 0 NA
3-179301165-G-A p.Ala309Thr missense ACTL6A 1 83226 1.20155E-5 41613 0 NA
3-179301167-A-AGGG p.Gly310dup disruptive_inframe_insertion ACTL6A 1 83216 1.20169E-5 41608 0 3.98248E-6
3-179301170-A-G p.Gly310Gly synonymous ACTL6A 1 82990 1.20496E-5 41495 0 0.0314402
3-179301173-A-G p.Gly311Gly synonymous ACTL6A 3 83032 3.61306E-5 41516 0 0.0145139
3-179301179-A-T p.Thr313Thr synonymous ACTL6A 24 83198 2.88468E-4 41599 0 2.54842E-4
3-179301179-A-C p.Thr313Thr synonymous ACTL6A 1 83198 1.20195E-5 41599 0 3.98089E-6
3-179301194-T-C p.Phe318Phe synonymous ACTL6A 1064 83162 0.0127943 41581 8 0.0127647
3-179301221-T-C p.Ser327Ser synonymous ACTL6A 1 83156 1.20256E-5 41578 0 NA
3-179301236-A-G p.Pro332Pro splice_region+synonymous ACTL6A 1 83120 1.20308E-5 41560 0 NA
3-179301242-T-C c.996+6T>C splice_region ACTL6A 1 83070 1.2038E-5 41535 0 3.18593E-5
3-179304349-T-G p.Leu338Val missense ACTL6A 190 82842 0.00229352 41421 0 0.00423756
3-179304363-T-C p.Asn342Asn synonymous ACTL6A 1 82946 1.2056E-5 41473 0 1.65145E-5
3-179304366-A-C p.Thr343Thr synonymous ACTL6A 1 82962 1.20537E-5 41481 0 8.25641E-6
3-179304373-G-T p.Glu346* stop_gained ACTL6A 1 82980 1.20511E-5 41490 0 NA
3-179304399-C-T p.Gly354Gly synonymous ACTL6A 2 82942 2.41132E-5 41471 0 3.18634E-5
3-179304496-C-T n.316C>T splice_region ACTL6A 1 79342 1.26037E-5 39671 0 NA
3-179305713-T-A c.1084-5T>A splice_region ACTL6A 1 81996 1.21957E-5 40998 0 NA
3-179305778-G-A p.Val382Ile missense ACTL6A 1 83052 1.20406E-5 41526 0 8.3478E-6
3-179305797-G-A p.Ter388Ter stop_retained ACTL6A 1 83088 1.20354E-5 41544 0 NA
3-179306186-C-T c.*388C>T splice_region ACTL6A 1 43696 2.28854E-5 21848 0 3.18613E-5
3-179306196-T-C c.*398T>C splice_region ACTL6A 1 43318 2.30851E-5 21659 0 NA