Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-79476998-T-C c.*718A>G splice_region ACTG1 1 51772 1.93155E-5 25886 0 1.22357E-5
17-79477015-T-C c.*701A>G splice_region ACTG1 1 52026 1.92212E-5 26013 0 NA
17-79477017-A-AT n.1958dupA splice_region ACTG1 1 52008 1.92278E-5 26004 0 NA
17-79477027-A-C n.1676T>G splice_region ACTG1 43 52116 8.25083E-4 26058 0 0.00178503
17-79477041-T-G c.*526A>C splice_region ACTG1 42 52444 8.00854E-4 26222 0 0.00191095
17-79477353-A-AC c.*213dupG splice_region ACTG1 1 58986 1.69532E-5 29493 0 9.86368E-6
17-79477356-C-T c.*212-1G>A splice_acceptor ACTG1 1260 59130 0.021309 29565 20 0.0220774
17-79477498-C-G c.*211+7G>C splice_region ACTG1 4 69984 5.71559E-5 34992 0 3.18532E-5
17-79477500-A-G c.*211+5T>C splice_region ACTG1 6 70224 8.54409E-5 35112 0 3.1835E-5
17-79477502-T-TACCAAGGGG c.*205_*211+2dupCCCCTTGGT splice_donor ACTG1 1 70472 1.419E-5 35236 0 NA
17-79477504-C-T c.*211+1G>A splice_donor ACTG1 1 70712 1.41419E-5 35356 0 2.84904E-5
17-79477716-T-C p.Ter376Ter stop_retained ACTG1 2443 83092 0.0294011 41546 63 0.0361239
17-79477721-A-G p.Phe375Leu missense ACTG1 1 83164 1.20244E-5 41582 0 NA
17-79477722-G-A p.Cys374Cys synonymous ACTG1 1 83168 1.20239E-5 41584 0 NA
17-79477725-T-C p.Lys373Lys synonymous ACTG1 1 83180 1.20221E-5 41590 0 3.97741E-6
17-79477728-G-A p.Arg372Arg synonymous ACTG1 1 83180 1.20221E-5 41590 0 7.95488E-6
17-79477731-G-A p.His371His synonymous ACTG1 16 83184 1.92345E-4 41592 0 6.80148E-4
17-79477734-G-T p.Val370Val synonymous ACTG1 3 83200 3.60577E-5 41600 0 0.00101317
17-79477737-G-A p.Ile369Ile synonymous ACTG1 25 83206 3.00459E-4 41603 0 0.0020202
17-79477740-G-A p.Ser368Ser synonymous ACTG1 2 83218 2.40333E-5 41609 0 NA
17-79477742-A-AG p.Ser368fs frameshift ACTG1 1 83220 1.20163E-5 41610 0 NA
17-79477749-C-T p.Ser365Ser synonymous ACTG1 6 83218 7.20998E-5 41609 0 1.3214E-4
17-79477752-CTCG-C p.Asp363del disruptive_inframe_deletion ACTG1 2 83220 2.40327E-5 41610 0 NA
17-79477755-G-A p.Asp363Asp synonymous ACTG1 5 83208 6.00904E-5 41604 0 8.25777E-6
17-79477758-G-A p.Tyr362Tyr synonymous ACTG1 10 83206 1.20184E-4 41603 0 1.7339E-4
17-79477791-G-A p.Thr351Thr synonymous ACTG1 5 83200 6.00962E-5 41600 0 6.6048E-5
17-79477791-G-C p.Thr351Thr synonymous ACTG1 1 83200 1.20192E-5 41600 0 NA
17-79477794-G-A p.Ser350Ser synonymous ACTG1 4 83194 4.80804E-5 41597 0 7.95665E-6
17-79477797-C-T p.Leu349Leu synonymous ACTG1 2 83194 2.40402E-5 41597 0 NA
17-79477800-T-A p.Ser348Ser synonymous ACTG1 1 83186 1.20213E-5 41593 0 2.47705E-5
17-79477803-G-C p.Ala347Ala synonymous ACTG1 3 83192 3.60612E-5 41596 0 1.28824E-4
17-79477808-G-A p.Leu346Leu synonymous ACTG1 1 83180 1.20221E-5 41590 0 5.07099E-4
17-79477815-G-A p.Gly343Gly synonymous ACTG1 100 83156 0.00120256 41578 0 0.00125
17-79477818-A-G p.Gly342Gly synonymous ACTG1 2431 83080 0.029261 41540 68 0.0363134
17-79477821-G-A p.Ile341Ile synonymous ACTG1 1 83182 1.20218E-5 41591 0 1.59158E-5
17-79477826-A-G p.Trp340Arg missense ACTG1 1 83178 1.20224E-5 41589 0 NA
17-79477827-C-G p.Val339Val synonymous ACTG1 61 83182 7.33332E-4 41591 0 0.00202429
17-79477830-C-T p.Ser338Ser synonymous ACTG1 2446 83122 0.0294266 41561 67 0.0361811
17-79477848-G-C p.Pro332Pro synonymous ACTG1 2 83138 2.40564E-5 41569 0 3.18674E-5
17-79477848-G-T p.Pro332Pro synonymous ACTG1 8 83138 9.62256E-5 41569 0 1.15385E-4
17-79477851-T-C p.Ala331Ala synonymous ACTG1 1 83124 1.20302E-5 41562 0 3.97905E-6
17-79477854-G-A p.Ile330Ile synonymous ACTG1 8 83134 9.62302E-5 41567 0 3.18756E-5
17-79477854-G-T p.Ile330Ile synonymous ACTG1 3 83134 3.60863E-5 41567 0 3.18756E-5
17-79477857-G-A p.Ile329Ile splice_region+synonymous ACTG1 1 83140 1.20279E-5 41570 0 7.95811E-6
17-79477859-TCTGCAAAGACAGCCAGGCACGGCTTCAGCTCACAGAGCGCCCCCCAGTCAGCTCTCCCGAGCCAGGCAGAGGGCCACCAACCCCTCGACTCAC-T c.984+1_985-1delGTGAGTCGAGGGGTTGGTGGCCCTCTGCCTGGCTCGGGAGAGCTGACTGGGGGGCGCTCTGTGAGCTGAAGCCGTGCCTGGCTGTCTTTGCAG splice_acceptor ACTG1 13 83134 1.56374E-4 41567 6 3.18756E-5
17-79477861-T-TGCAA c.985-3_985-2insTTGC splice_region ACTG1 1 83130 1.20294E-5 41565 0 8.25818E-6
17-79477863-C-CA c.985-5_985-4insT splice_region ACTG1 12 83126 1.44359E-4 41563 0 8.35681E-5
17-79477864-A-G c.985-5T>C splice_region ACTG1 33 83126 3.96988E-4 41563 0 0.00175708
17-79477867-G-A c.985-8C>T splice_region ACTG1 2 83112 2.40639E-5 41556 0 NA
17-79477945-C-T c.984+8G>A splice_region ACTG1 3 83024 3.61341E-5 41512 0 7.96394E-6
17-79477945-C-CGA c.984+7_984+8insTC splice_region ACTG1 1 83024 1.20447E-5 41512 0 8.2776E-6
17-79477946-G-A c.984+7C>T splice_region ACTG1 3 83008 3.61411E-5 41504 0 1.91168E-4
17-79477956-G-T p.Ile327Ile synonymous ACTG1 3 83082 3.61089E-5 41541 0 2.48172E-5
17-79477959-C-T p.Lys326Lys synonymous ACTG1 10 83094 1.20346E-4 41547 0 9.55536E-5
17-79477965-G-A p.Thr324Thr synonymous ACTG1 2 83082 2.40726E-5 41541 0 3.98057E-6
17-79477971-G-A p.Pro322Pro synonymous ACTG1 1 83088 1.20354E-5 41544 0 8.26815E-6
17-79477974-C-T p.Ala321Ala synonymous ACTG1 2 83076 2.40743E-5 41538 0 8.26774E-6
17-79477977-C-G p.Leu320Leu synonymous ACTG1 3 83100 3.61011E-5 41550 0 8.26706E-6
17-79477983-G-A p.Thr318Thr synonymous ACTG1 9 83094 1.08311E-4 41547 0 6.25E-4
17-79478007-G-A p.Ala310Ala synonymous ACTG1 26895 82880 0.324505 41440 4646 0.319401
17-79478019-G-A p.Tyr306Tyr synonymous ACTG1 65102 82966 0.784683 41483 25699 0.790218
17-79478028-G-A p.Thr303Thr synonymous ACTG1 15 83166 1.80362E-4 41583 0 2.82479E-4
17-79478031-G-A p.Gly302Gly synonymous ACTG1 2 83154 2.40518E-5 41577 0 NA
17-79478031-G-C p.Gly302Gly synonymous ACTG1 1 83154 1.20259E-5 41577 0 NA
17-79478037-C-T p.Ser300Ser synonymous ACTG1 2 83178 2.40448E-5 41589 0 3.30213E-5
17-79478042-G-A p.Leu299Leu synonymous ACTG1 2 83176 2.40454E-5 41588 0 8.25464E-6
17-79478049-G-A p.Asn296Asn synonymous ACTG1 1 83192 1.20204E-5 41596 0 1.65104E-5
17-79478060-G-A p.Leu293Leu synonymous ACTG1 37 83196 4.44733E-4 41598 0 0.00100806
17-79478061-G-A p.Asp292Asp synonymous ACTG1 1 83190 1.20207E-5 41595 0 8.25532E-6
17-79478067-G-A p.Arg290Arg synonymous ACTG1 4 83194 4.80804E-5 41597 0 1.89882E-4
17-79478070-G-T p.Ile289Ile synonymous ACTG1 1 83190 1.20207E-5 41595 0 NA
17-79478076-C-T p.Val287Val synonymous ACTG1 1 83206 1.20184E-5 41603 0 9.54677E-5
17-79478079-G-A p.Asp286Asp synonymous ACTG1 3 83188 3.60629E-5 41594 0 1.27421E-4
17-79478082-A-G p.Cys285Cys synonymous ACTG1 1 83202 1.20189E-5 41601 0 3.97779E-6
17-79478091-G-A p.Ile282Ile synonymous ACTG1 1 83228 1.20152E-5 41614 0 NA
17-79478094-G-A p.Ser281Ser synonymous ACTG1 3 83220 3.6049E-5 41610 0 NA
17-79478100-G-A p.Phe279Phe synonymous ACTG1 5 83224 6.00788E-5 41612 0 1.27372E-4
17-79478112-G-A n.1023C>T splice_region ACTG1 9 83224 1.08142E-4 41612 0 1.27445E-4
17-79478112-G-C p.His275Gln missense ACTG1 2 83224 2.40315E-5 41612 0 NA
17-79478121-G-A p.Cys272Cys synonymous ACTG1 5 83208 6.00904E-5 41604 0 6.36983E-5
17-79478124-A-G p.Ser271Ser synonymous ACTG1 6 83212 7.2105E-5 41606 0 8.26105E-6
17-79478137-A-G c.803-3T>C splice_region ACTG1 8 83198 9.61562E-5 41599 0 1.27429E-4
17-79478139-G-A c.803-5C>T splice_region ACTG1 2 83200 2.40385E-5 41600 0 4.1336E-5
17-79478140-G-A c.803-6C>T splice_region ACTG1 65 83190 7.81344E-4 41595 0 0.00168908
17-79478141-G-A c.803-7C>T splice_region ACTG1 9 83198 1.08176E-4 41599 0 9.5584E-5
17-79478141-G-T c.803-7C>A splice_region ACTG1 1 83198 1.20195E-5 41599 0 6.37227E-5
17-79478206-A-C c.802+8T>G splice_region ACTG1 3 82902 3.61873E-5 41451 0 3.9853E-6
17-79478207-C-T c.802+7G>A splice_region ACTG1 1 82904 1.20621E-5 41452 0 NA
17-79478217-G-A p.Leu267Leu synonymous ACTG1 3 82912 3.61829E-5 41456 0 1.59464E-5
17-79478218-G-A p.Phe266Phe synonymous ACTG1 2 82904 2.41243E-5 41452 0 2.50004E-5
17-79478221-G-A p.Ser265Ser synonymous ACTG1 4 82940 4.82276E-5 41470 0 9.55536E-5
17-79478236-C-T p.Ala260Ala synonymous ACTG1 65 82936 7.83737E-4 41468 0 0.00484046
17-79478242-C-T p.Pro258Pro synonymous ACTG1 100 82974 0.0012052 41487 1 7.09933E-4
17-79478257-C-T p.Glu253Glu synonymous ACTG1 1 83006 1.20473E-5 41503 0 2.79109E-5
17-79478278-C-T p.Gln246Gln synonymous ACTG1 1 83000 1.20482E-5 41500 0 3.18451E-5
17-79478284-A-G p.Asp244Asp synonymous ACTG1 1 83024 1.20447E-5 41512 0 1.673E-5
17-79478287-G-A p.Pro243Pro synonymous ACTG1 1532 83000 0.0184578 41500 23 0.0312185
17-79478296-G-A p.Tyr240Tyr synonymous ACTG1 4 83044 4.81672E-5 41522 0 4.1862E-5
17-79478299-G-A p.Ser239Ser synonymous ACTG1 1 83058 1.20398E-5 41529 0 NA
17-79478302-C-T p.Lys238Lys synonymous ACTG1 117 83058 0.00140865 41529 1 0.00289754
17-79478310-G-A p.Leu236Leu synonymous ACTG1 1 83082 1.20363E-5 41541 0 NA
17-79478314-AGAG-A p.Ser234del disruptive_inframe_deletion ACTG1 2 83066 2.40772E-5 41533 0 3.99396E-6
17-79478317-G-A p.Ser233Ser synonymous ACTG1 4 83072 4.8151E-5 41536 0 3.35267E-5
17-79478318-G-A p.Ser233Phe missense ACTG1 2 83064 2.40778E-5 41532 0 3.1841E-5
17-79478320-G-A p.Ser232Ser synonymous ACTG1 20 83060 2.4079E-4 41530 0 2.11798E-4
17-79478320-G-T p.Ser232Ser synonymous ACTG1 1 83060 1.20395E-5 41530 0 1.67802E-5
17-79478320-G-C p.Ser232Ser synonymous ACTG1 3 83060 3.61185E-5 41530 0 8.39011E-6
17-79478321-G-A p.Ser232Phe missense ACTG1 1 83054 1.20404E-5 41527 0 3.99549E-6
17-79478323-T-A p.Ala231Ala synonymous ACTG1 3 83050 3.61228E-5 41525 0 3.99588E-6
17-79478323-T-C p.Ala231Ala synonymous ACTG1 16 83050 1.92655E-4 41525 0 0.001875
17-79478324-G-A p.Ala231Val missense ACTG1 2 83052 2.40813E-5 41526 0 5.19655E-5
17-79478326-G-A p.Ala230Ala synonymous ACTG1 3 83032 3.61306E-5 41516 0 0.00125
17-79478327-G-T p.Ala230Asp missense ACTG1 1 83014 1.20462E-5 41507 0 8.39349E-6
17-79478329-G-A p.Thr229Thr synonymous ACTG1 10 83026 1.20444E-4 41513 0 4.19456E-5
17-79478332-G-A p.Ala228Ala synonymous ACTG1 133 82956 0.00160326 41478 1 0.00253254
17-79478342-T-C p.Gln225Arg missense ACTG1 1 82978 1.20514E-5 41489 0 NA
17-79478347-G-A p.Phe223Phe synonymous ACTG1 3 83016 3.61376E-5 41508 0 9.22014E-5
17-79478350-G-A p.Asp222Asp synonymous ACTG1 2 83056 2.40801E-5 41528 0 1.67566E-5
17-79478358-C-T p.Ala220Thr missense ACTG1 1 83058 1.20398E-5 41529 0 3.18634E-5
17-79478359-G-A p.Val219Val synonymous ACTG1 6 83068 7.223E-5 41534 0 5.02235E-5
17-79478362-G-A p.Tyr218Tyr synonymous ACTG1 30 83092 3.61046E-4 41546 0 5.28541E-4
17-79478368-C-T p.Leu216Leu synonymous ACTG1 2 83124 2.40604E-5 41562 0 NA
17-79478371-C-T p.Lys215Lys synonymous ACTG1 1 83124 1.20302E-5 41562 0 1.67135E-5
17-79478374-C-T p.Glu214Glu splice_region+synonymous ACTG1 4 83122 4.8122E-5 41561 0 1.59382E-5
17-79478377-C-T p.Lys213Lys synonymous ACTG1 2 83132 2.40581E-5 41566 0 NA
17-79478380-G-T p.Ile212Ile synonymous ACTG1 1 83126 1.20299E-5 41563 0 3.18492E-5
17-79478383-G-A p.Asp211Asp synonymous ACTG1 1 83114 1.20317E-5 41557 0 8.35199E-6
17-79478386-G-A p.Arg210Arg synonymous ACTG1 4 83120 4.81232E-5 41560 0 3.18573E-5
17-79478389-C-T p.Val209Val synonymous ACTG1 1 83122 1.20305E-5 41561 0 3.18471E-5
17-79478392-G-A p.Ile208Ile synonymous ACTG1 6 83134 7.21726E-5 41567 0 1.00197E-4
17-79478398-C-T p.Arg206Arg synonymous ACTG1 2 83144 2.40547E-5 41572 0 2.50551E-5
17-79478404-G-A p.Ala204Ala synonymous ACTG1 6 83132 7.21744E-5 41566 0 1.91058E-4
17-79478407-C-T p.Thr203Thr synonymous ACTG1 12 83122 1.44366E-4 41561 0 9.1855E-5
17-79478425-G-A p.Gly197Gly synonymous ACTG1 1 83114 1.20317E-5 41557 0 8.34265E-6
17-79478428-T-A p.Arg196Arg synonymous ACTG1 1 83114 1.20317E-5 41557 0 NA
17-79478437-G-A p.Leu193Leu synonymous ACTG1 1 83086 1.20357E-5 41543 0 8.34168E-6
17-79478440-G-A p.Ile192Ile synonymous ACTG1 6 83086 7.22143E-5 41543 0 6.37562E-5
17-79478442-T-C p.Ile192Val missense ACTG1 1 83078 1.20369E-5 41539 0 NA
17-79478452-G-A p.Tyr188Tyr synonymous ACTG1 20 83034 2.40865E-4 41517 0 1.91961E-4
17-79478455-G-A p.Asp187Asp synonymous ACTG1 2 83024 2.40894E-5 41512 0 3.98854E-5
17-79478458-G-A p.Thr186Thr synonymous ACTG1 157 83008 0.00189138 41504 2 0.00442986
17-79478458-G-C p.Thr186Thr synonymous ACTG1 1 83010 1.20467E-5 41505 0 6.37389E-5
17-79478467-C-G p.Gly197Ala missense ACTG1 1 82948 1.20557E-5 41474 0 3.18532E-5
17-79478470-G-A p.Ala196Val missense ACTG1 66 82896 7.96178E-4 41448 2 0.0132135
17-79478478-G-A p.Leu180Leu synonymous ACTG1 3 82876 3.61987E-5 41438 0 1.67311E-5
17-79478485-A-G p.Val191Ala missense ACTG1 113 82824 0.00136434 41412 0 0.00158562
17-79478490-G-A p.Leu176Leu synonymous ACTG1 3 82776 3.62424E-5 41388 0 3.18451E-5
17-79478491-G-A p.Ser189Phe missense ACTG1 5 82776 6.0404E-5 41388 0 1.67378E-5
17-79478491-G-T p.Ser189Tyr missense ACTG1 2 82776 2.41616E-5 41388 0 3.99607E-6
17-79478503-G-T p.Ser185Tyr missense ACTG1 4 82550 4.84555E-5 41275 0 NA
17-79478506-G-A p.Pro184Leu missense ACTG1 5 82486 6.06163E-5 41243 0 8.36246E-6
17-79478518-G-A p.Thr180Met missense ACTG1 4 82230 4.8644E-5 41115 0 4.39104E-5
17-79478530-C-T p.Arg176Gln missense ACTG1 15 81904 1.83141E-4 40952 0 0.001875
17-79478530-C-A p.Arg176Leu missense ACTG1 1 81918 1.22073E-5 40959 0 NA
17-79478533-G-A p.Thr175Ile missense ACTG1 1 81896 1.22106E-5 40948 0 1.67012E-5
17-79478536-G-T p.Pro174His missense ACTG1 1 81864 1.22154E-5 40932 0 NA
17-79478545-G-A p.Thr171Met missense ACTG1 316 81818 0.00386223 40909 2 0.00354251
17-79478548-T-C p.Glu170Gly missense ACTG1 2 81842 2.44373E-5 40921 0 7.98085E-6
17-79478551-A-G p.Leu169Pro missense ACTG1 1 81866 1.22151E-5 40933 0 8.34822E-6
17-79478560-G-A p.Ser166Leu missense ACTG1 1 81840 1.2219E-5 40920 0 8.35087E-6
17-79478566-G-A p.Ala164Val missense ACTG1 2 81854 2.44337E-5 40927 0 1.67059E-5
17-79478584-G-A p.Pro158Leu missense ACTG1 12 81926 1.46474E-4 40963 0 1.17118E-4
17-79478584-G-C p.Pro158Arg missense ACTG1 1 81926 1.22061E-5 40963 0 3.18431E-5
17-79478587-G-A p.Thr157Met missense ACTG1 3 81952 3.66068E-5 40976 0 0.00125
17-79478593-G-A p.Pro155Leu missense ACTG1 2 82066 2.43706E-5 41033 0 2.51105E-5
17-79478596-C-T p.Cys154Tyr missense ACTG1 4 82122 4.8708E-5 41061 0 1.99588E-5
17-79478602-G-A p.Pro152Leu missense ACTG1 93 82252 0.00113067 41126 2 0.0115811
17-79478602-G-T p.Pro152Gln missense ACTG1 1 82256 1.21572E-5 41128 0 4.39195E-5
17-79478611-G-A p.Pro149Leu missense ACTG1 2 82482 2.42477E-5 41241 0 4.79164E-5
17-79478614-C-G p.Trp148Ser missense ACTG1 1 82534 1.21162E-5 41267 0 NA
17-79478617-G-A p.Thr147Met missense ACTG1 1509 82512 0.0182882 41256 22 0.030715
17-79478623-G-A p.Pro145Leu missense ACTG1 1 82658 1.2098E-5 41329 0 3.99667E-5
17-79478631-T-C p.Thr129Ala missense ACTG1 1 82750 1.20846E-5 41375 0 NA
17-79478650-A-G p.Leu136Ser missense+splice_region ACTG1 2 82868 2.41348E-5 41434 0 6.25E-4
17-79478657-G-A c.364-5C>T splice_region ACTG1 1 82780 1.20802E-5 41390 0 5.99777E-5
17-79478658-A-T c.364-6T>A splice_region ACTG1 1 82744 1.20855E-5 41372 0 4.03206E-6
17-79478660-G-A c.364-8C>T splice_region ACTG1 26 82728 3.14283E-4 41364 0 8.06959E-5
17-79478782-G-A c.404+7C>T splice_region ACTG1 1 81970 1.21996E-5 40985 0 1.07377E-5
17-79478784-G-A c.404+5C>T splice_region ACTG1 3 82006 3.65827E-5 41003 0 5.35504E-5
17-79478792-G-A p.Ser134Phe missense ACTG1 2 82224 2.43238E-5 41112 0 1.06528E-5
17-79478794-G-A p.Ala133Ala synonymous ACTG1 3 82282 3.646E-5 41141 0 2.90304E-5
17-79478795-G-A p.Ala133Val missense ACTG1 3 82270 3.64653E-5 41135 0 9.5511E-5
17-79478799-C-CAG p.Glu132fs frameshift ACTG1 1 82428 1.21318E-5 41214 0 NA
17-79478801-G-A p.Pro131Leu missense ACTG1 6 82494 7.27326E-5 41247 0 9.55414E-5
17-79478802-G-A p.Pro131Ser missense ACTG1 185 82500 0.00224242 41250 0 0.00396343
17-79478803-G-A p.Leu130Leu synonymous ACTG1 3 82510 3.63592E-5 41255 0 8.37225E-5
17-79478805-G-A p.Leu130Phe missense ACTG1 8 82562 9.68969E-5 41281 0 2.22859E-4
17-79478806-G-T p.Phe129Leu missense ACTG1 1654 82494 0.0200499 41247 26 0.023125
17-79478806-G-A p.Phe129Phe synonymous ACTG1 5 82574 6.05517E-5 41287 0 2.07827E-5
17-79478807-A-T p.Phe129Tyr missense ACTG1 1 82574 1.21103E-5 41287 0 NA
17-79478811-G-A p.His128Tyr missense ACTG1 4 82610 4.84203E-5 41305 0 2.27838E-5
17-79478813-C-T p.Arg127Gln missense ACTG1 2 82608 2.42107E-5 41304 0 3.18451E-5
17-79478814-G-A p.Arg127Trp missense ACTG1 3 82634 3.63047E-5 41317 0 1.32751E-4
17-79478814-G-T p.Arg127Arg synonymous ACTG1 2 82634 2.42031E-5 41317 0 2.65501E-4
17-79478815-G-A p.Ser126Ser synonymous ACTG1 2 82648 2.4199E-5 41324 0 3.18431E-5
17-79478817-A-C p.Ser126Ala missense ACTG1 1 82666 1.20969E-5 41333 0 1.00804E-5
17-79478818-G-A p.Leu125Leu synonymous ACTG1 1 82694 1.20928E-5 41347 0 1.30758E-4
17-79478819-AG-A p.Leu125fs frameshift ACTG1 6 82734 7.25216E-5 41367 0 1.59215E-4
17-79478820-G-A p.Leu125Phe missense ACTG1 3 82746 3.62555E-5 41373 0 3.99872E-5
17-79478821-G-A p.Phe124Phe synonymous ACTG1 4 82750 4.83384E-5 41375 0 6.25E-4
17-79478821-G-C p.Phe124Leu missense ACTG1 2 82750 2.41692E-5 41375 0 9.96552E-6
17-79478822-AAC-A p.Phe124fs frameshift ACTG1 8 82736 9.66931E-5 41368 0 2.38194E-4
17-79478824-CAG-C p.Leu123fs frameshift ACTG1 1 82770 1.20817E-5 41385 0 3.18431E-5
17-79478824-C-G p.Leu123Leu synonymous ACTG1 1 82770 1.20817E-5 41385 0 4.28927E-6
17-79478826-G-C p.Leu123Val missense ACTG1 1 82792 1.20785E-5 41396 0 1.27317E-5
17-79478828-G-A p.Ala122Val missense+splice_region ACTG1 2 82802 2.4154E-5 41401 0 1.95354E-5
17-79478833-G-C c.364-4C>G splice_region ACTG1 2 82856 2.41383E-5 41428 0 4.16688E-6
17-79478833-G-A c.364-4C>T splice_region ACTG1 2 82856 2.41383E-5 41428 0 3.1841E-5
17-79478836-C-T c.364-7G>A splice_region ACTG1 1 82862 1.20683E-5 41431 0 9.40345E-6
17-79478922-G-C c.363+7C>G splice_region ACTG1 5 82922 6.02976E-5 41461 0 5.06611E-4
17-79478924-C-T c.363+5G>A splice_region ACTG1 20 82944 2.41127E-4 41472 0 6.05057E-4
17-79478926-C-T c.363+3G>A splice_region ACTG1 2 82952 2.41103E-5 41476 0 4.79252E-5
17-79478927-ACCT-A p.Gln121fs frameshift ACTG1 1 82942 1.20566E-5 41471 0 NA
17-79478931-GA-G p.Gln121fs frameshift ACTG1 1 82976 1.20517E-5 41488 0 NA
17-79478933-GTCATCT-G p.Lys118_Met119del disruptive_inframe_deletion ACTG1 1 82984 1.20505E-5 41492 0 NA
17-79478941-C-T p.Glu117Glu synonymous ACTG1 6 83020 7.22717E-5 41510 0 5.59007E-5
17-79478947-G-A c.339+6C>T splice_region ACTG1 53 83012 6.38462E-4 41506 0 3.11459E-4
17-79478953-C-T p.Lys113Lys splice_region+synonymous ACTG1 2 83006 2.40946E-5 41503 0 NA
17-79478956-G-A p.Pro112Pro synonymous ACTG1 3 83002 3.61437E-5 41501 0 2.39653E-5
17-79478956-G-C p.Pro112Pro synonymous ACTG1 2 83002 2.40958E-5 41501 0 2.49269E-5
17-79478959-G-A p.Asn111Asn synonymous ACTG1 4 83010 4.8187E-5 41505 0 8.30813E-6
17-79478974-G-C p.Thr106Thr synonymous ACTG1 7 83018 8.43191E-5 41509 0 2.49302E-5
17-79478977-C-T p.Leu105Leu synonymous ACTG1 16 83026 1.92711E-4 41513 0 2.87228E-4
17-79478983-C-T p.Val103Val synonymous ACTG1 1 83030 1.20438E-5 41515 0 0.00158562
17-79478984-A-T p.Val103Glu missense ACTG1 1 83032 1.20435E-5 41516 0 NA
17-79478992-C-T p.Glu100Glu synonymous ACTG1 1 83044 1.20418E-5 41522 0 3.18431E-5
17-79478998-C-T p.Pro98Pro synonymous ACTG1 2 83036 2.40859E-5 41518 0 1.19604E-5
17-79479007-G-A p.Arg95Arg synonymous ACTG1 1 83086 1.20357E-5 41543 0 8.29022E-6
17-79479016-G-A p.Asn92Asn synonymous ACTG1 12 83124 1.44363E-4 41562 0 1.59256E-4
17-79479022-G-A p.Phe90Phe synonymous ACTG1 1 83120 1.20308E-5 41560 0 3.98023E-6
17-79479025-G-A p.Thr89Thr synonymous ACTG1 5 83110 6.01612E-5 41555 0 6.76601E-5
17-79479028-G-A p.His88His synonymous ACTG1 1 83102 1.20334E-5 41551 0 NA
17-79479031-G-A p.His87His synonymous ACTG1 1 83106 1.20328E-5 41553 0 6.36796E-5
17-79479037-G-A p.Ile85Ile synonymous ACTG1 5 83094 6.01728E-5 41547 0 4.14099E-5
17-79479037-G-T p.Ile85Ile synonymous ACTG1 1 83094 1.20346E-5 41547 0 NA
17-79479049-G-A p.Asp81Asp synonymous ACTG1 3 83046 3.61246E-5 41523 0 6.62833E-5
17-79479058-G-A p.Asn78Asn synonymous ACTG1 4 83000 4.81928E-5 41500 0 1.16004E-4
17-79479061-G-A p.Thr77Thr synonymous ACTG1 19 83000 2.28916E-4 41500 0 6.25E-4
17-79479064-G-A p.Val76Val synonymous ACTG1 22 82990 2.65092E-4 41495 0 0.00100705
17-79479067-G-A p.Ile75Ile synonymous ACTG1 5 82958 6.02715E-5 41479 0 9.56023E-5
17-79479070-G-A p.Gly74Gly synonymous ACTG1 3 82942 3.61699E-5 41471 0 9.12061E-5
17-79479073-A-T p.His73Gln missense ACTG1 1 82938 1.20572E-5 41469 0 3.98064E-6
17-79479076-C-T p.Glu72Glu synonymous ACTG1 1 82904 1.20621E-5 41452 0 8.29339E-6
17-79479082-G-A p.Pro70Pro synonymous ACTG1 11 82850 1.3277E-4 41425 0 2.2293E-4
17-79479091-C-G p.Leu67Leu synonymous ACTG1 9 82744 1.08769E-4 41372 1 3.18568E-5
17-79479094-G-A p.Thr66Thr synonymous ACTG1 2 82716 2.41791E-5 41358 0 2.3893E-5
17-79479094-G-C p.Thr66Thr synonymous ACTG1 2 82716 2.41791E-5 41358 0 8.29972E-6
17-79479097-C-G p.Leu65Leu synonymous ACTG1 1 82692 1.20931E-5 41346 0 NA
17-79479100-G-T p.Ile64Ile synonymous ACTG1 1 82664 1.20972E-5 41332 0 2.49049E-5
17-79479100-G-A p.Ile64Ile synonymous ACTG1 1 82664 1.20972E-5 41332 0 NA
17-79479103-G-A p.Gly63Gly synonymous ACTG1 2 82634 2.42031E-5 41317 0 1.99164E-5
17-79479112-G-A p.Ser60Ser synonymous ACTG1 30 82614 3.63135E-4 41307 0 2.54874E-4
17-79479115-C-T p.Gln59Gln synonymous ACTG1 1214 82596 0.014698 41298 14 0.0235477
17-79479118-G-A p.Ala58Ala synonymous ACTG1 1 82608 1.21054E-5 41304 0 3.18804E-5
17-79479121-C-T p.Glu57Glu synonymous ACTG1 2 82612 2.42096E-5 41306 0 8.3102E-6
17-79479124-G-A p.Asp56Asp synonymous ACTG1 3 82536 3.63478E-5 41268 0 5.03525E-4
17-79479127-G-A p.Gly55Gly synonymous ACTG1 20 82498 2.4243E-4 41249 0 3.30883E-4
17-79479133-G-A p.Tyr53Tyr synonymous ACTG1 13 82514 1.57549E-4 41257 0 1.9129E-4
17-79479136-G-A p.Ser52Ser synonymous ACTG1 1 82552 1.21136E-5 41276 0 1.66356E-5
17-79479139-G-A p.Asp42Asp splice_region+synonymous ACTG1 2 82546 2.42289E-5 41273 0 0.00151057
17-79479154-G-A p.Gly46Gly synonymous ACTG1 4 82534 4.84649E-5 41267 0 3.18992E-5
17-79479166-G-A p.Gly42Gly splice_region+synonymous ACTG1 16 82506 1.93925E-4 41253 0 4.14567E-4
17-79479167-CCCTGCAGGGGACGACCCGTCAGCCTCGCCGGCGACACCGAACCCACCCCGCAACGCAGAACCCAGGAGCCCCGCGGCGCCATCCACTCA-C p.Gly42fs frameshift ACTG1 16 82512 1.93911E-4 41256 8 NA
17-79479172-C-T c.124-4G>A splice_region ACTG1 1 82494 1.21221E-5 41247 0 NA
17-79479173-A-C c.124-5T>G splice_region ACTG1 1 82498 1.21215E-5 41249 0 8.32792E-6
17-79479174-G-A c.124-6C>T splice_region ACTG1 2 82490 2.42454E-5 41245 0 1.1966E-5
17-79479175-G-A c.124-7C>T splice_region ACTG1 1 82460 1.21271E-5 41230 0 3.33183E-5
17-79479176-G-A c.124-8C>T splice_region ACTG1 18 82458 2.18293E-4 41229 0 0.00125
17-79479250-CCACT-C c.123+4_123+7delAGTG splice_region ACTG1 2 82552 2.42272E-5 41276 0 NA
17-79479252-A-C c.123+6T>G splice_region ACTG1 1 82544 1.21148E-5 41272 0 3.9968E-6
17-79479253-C-G c.123+5G>C splice_region ACTG1 3 82574 3.63311E-5 41287 0 8.34752E-6
17-79479261-G-A p.His40His synonymous ACTG1 1 82682 1.20945E-5 41341 0 NA
17-79479276-G-A p.Val35Val synonymous ACTG1 30 82806 3.62293E-4 41403 0 6.37592E-4
17-79479282-G-A p.Ser33Ser synonymous ACTG1 1 82898 1.2063E-5 41449 0 3.31691E-5
17-79479297-T-C p.Arg28Arg synonymous ACTG1 1 82868 1.20674E-5 41434 0 NA
17-79479300-G-A p.Pro27Pro synonymous ACTG1 5 82890 6.03209E-5 41445 0 3.22906E-4
17-79479306-G-A p.Asp25Asp synonymous ACTG1 2 82862 2.41365E-5 41431 0 1.59264E-5
17-79479309-G-A p.Asp24Asp synonymous ACTG1 41 82896 4.94596E-4 41448 0 0.0020141
17-79479315-A-C p.Ala22Ala synonymous ACTG1 20 82994 2.40981E-4 41497 0 4.46286E-4
17-79479330-G-A p.Cys17Cys synonymous ACTG1 3 83008 3.61411E-5 41504 0 9.15153E-5
17-79479336-G-A p.Gly15Gly synonymous ACTG1 11 82994 1.3254E-4 41497 0 0.00151057
17-79479337-C-T p.Gly15Asp missense ACTG1 1 83000 1.20482E-5 41500 0 NA
17-79479339-G-A p.Ser14Ser synonymous ACTG1 4 83012 4.81858E-5 41506 0 3.97855E-5
17-79479342-G-A p.Gly13Gly synonymous ACTG1 51 83028 6.14251E-4 41514 0 0.00375
17-79479345-A-G p.Asn12Asn synonymous ACTG1 1 83044 1.20418E-5 41522 0 6.37511E-5
17-79479353-T-C p.Ile10Val missense ACTG1 1 83046 1.20415E-5 41523 0 NA
17-79479354-G-C p.Val9Val synonymous ACTG1 1 83036 1.2043E-5 41518 0 3.97833E-6
17-79479357-C-A p.Leu8Leu synonymous ACTG1 1 83020 1.20453E-5 41510 0 NA
17-79479357-C-G p.Leu8Leu synonymous ACTG1 2 83018 2.40912E-5 41509 0 NA
17-79479359-G-A p.Leu8Leu synonymous ACTG1 4 83012 4.81858E-5 41506 0 3.18654E-5
17-79479360-C-G p.Ala7Ala synonymous ACTG1 3 82988 3.61498E-5 41494 0 3.97836E-6
17-79479363-G-A p.Ala6Ala synonymous ACTG1 91 82980 0.00109665 41490 1 0.0015619
17-79479366-G-A p.Ile5Ile synonymous ACTG1 42 82988 5.06097E-4 41494 1 0.0017505
17-79479366-G-T p.Ile5Ile synonymous ACTG1 1 82990 1.20496E-5 41495 0 1.90957E-4
17-79479371-C-G p.Glu4Gln missense ACTG1 1 82974 1.2052E-5 41487 0 NA
17-79479372-T-C p.Glu3Glu synonymous ACTG1 2 82976 2.41034E-5 41488 0 4.12916E-5
17-79479380-T-C p.Met1? start_lost ACTG1 1 82912 1.2061E-5 41456 0 8.259E-6
17-79479384-G-A c.-4C>T 5_prime_UTR_premature_start_codon_gain ACTG1 1 82880 1.20656E-5 41440 0 3.18898E-5
17-79479387-C-CGGCAGAGAAACGCGACGGCGGAGCGGCGGAAGAACAGAG c.-6-2_-6-1insCTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCTGCC splice_acceptor ACTG1 1 82868 1.20674E-5 41434 0 NA
17-79479389-G-A c.-6-3C>T splice_region ACTG1 392 82832 0.00473247 41416 1 0.008125
17-79479390-C-CAGAGAAA c.-6-5_-6-4insTTTCTCT splice_region ACTG1 1 82818 1.20747E-5 41409 0 NA
17-79479391-C-T c.-6-5G>A splice_region ACTG1 2 82826 2.4147E-5 41413 0 NA
17-79479393-G-A c.-13C>T 5_prime_UTR_premature_start_codon_gain ACTG1 9 82814 1.08677E-4 41407 0 3.82507E-4
17-79479394-G-C c.-14C>G 5_prime_UTR_premature_start_codon_gain ACTG1 1 82814 1.20753E-5 41407 0 3.98007E-6
17-79479394-G-A c.-6-8C>T splice_region ACTG1 1 82814 1.20753E-5 41407 0 2.78605E-5
17-79479400-G-C c.-20C>G 5_prime_UTR_premature_start_codon_gain ACTG1 5 82788 6.03952E-5 41394 0 8.75768E-5
17-79479419-G-A c.-39C>T 5_prime_UTR_premature_start_codon_gain ACTG1 6 82202 7.29909E-5 41101 0 1.32378E-4
17-79479443-C-A c.-63G>T 5_prime_UTR_premature_start_codon_gain ACTG1 10 80930 1.23564E-4 40465 0 NA
17-79479450-C-A c.-70G>T 5_prime_UTR_premature_start_codon_gain ACTG1 3 80458 3.72865E-5 40229 0 6.37186E-5
17-79479469-A-C c.-89T>G 5_prime_UTR_premature_start_codon_gain ACTG1 24704 59030 0.418499 29515 3268 0.539576
17-79479476-G-A c.-96C>T 5_prime_UTR_premature_start_codon_gain ACTG1 1 76778 1.30246E-5 38389 0 NA
17-79479482-G-GCCCCAA c.-7+2_-7+7dupTTGGGG splice_region ACTG1 1 75574 1.32321E-5 37787 0 NA
17-79479487-A-C c.-7+3T>G splice_region ACTG1 1 75084 1.33184E-5 37542 0 NA
17-79479489-C-T c.-7+1G>A splice_donor ACTG1 2 75106 2.6629E-5 37553 0 NA
17-79479490-C-G c.-7G>C splice_region ACTG1 1 75004 1.33326E-5 37502 0 NA
17-79479491-C-A c.-8G>T splice_region ACTG1 4 74830 5.34545E-5 37415 0 NA
17-79479537-C-A c.-54G>T 5_prime_UTR_premature_start_codon_gain ACTG1 1 59444 1.68226E-5 29722 0 NA
17-79479538-G-A c.-55C>T 5_prime_UTR_premature_start_codon_gain ACTG1 28 58994 4.74625E-4 29497 0 6.06061E-4
17-79479549-G-A c.-66C>T 5_prime_UTR_premature_start_codon_gain ACTG1 1 53116 1.88267E-5 26558 0 6.38162E-5
17-79479554-G-A c.-71C>T 5_prime_UTR_premature_start_codon_gain ACTG1 4 50410 7.93493E-5 25205 0 5.10627E-4
17-79479560-G-A c.-77C>T 5_prime_UTR_premature_start_codon_gain ACTG1 4 46582 8.58701E-5 23291 0 NA
17-79479565-G-A c.-82C>T 5_prime_UTR_premature_start_codon_gain ACTG1 3 43830 6.84463E-5 21915 0 9.57365E-5
17-79479576-C-T c.-93G>A 5_prime_UTR_premature_start_codon_gain ACTG1 2 38956 5.134E-5 19478 0 3.19061E-5
17-79479584-G-A c.-101C>T 5_prime_UTR_premature_start_codon_gain ACTG1 2 34474 5.80147E-5 17237 0 3.19734E-5
17-79479590-C-A c.-107G>T 5_prime_UTR_premature_start_codon_gain ACTG1 1 32362 3.09004E-5 16181 0 3.19326E-5
17-79479604-G-A c.-121C>T 5_prime_UTR_premature_start_codon_gain ACTG1 22 27908 7.88304E-4 13954 0 6.4082E-5
17-79479614-C-A c.-131G>T 5_prime_UTR_premature_start_codon_gain ACTG1 1 26256 3.80865E-5 13128 0 NA
17-79479621-G-A c.-138C>T 5_prime_UTR_premature_start_codon_gain ACTG1 1 24622 4.06141E-5 12311 0 6.41272E-5
17-79479625-G-A c.-7+7C>T splice_region ACTG1 4609 21568 0.213696 10784 139 0.28136
17-79479629-G-C c.-7+3C>G splice_region ACTG1 22 23514 9.35613E-4 11757 0 1.28148E-4
17-79479668-G-A c.-185C>T 5_prime_UTR_premature_start_codon_gain ACTG1 2 19370 1.03252E-4 9685 0 NA
17-79479671-G-A c.-188C>T 5_prime_UTR_premature_start_codon_gain ACTG1 2 18982 1.05363E-4 9491 0 6.40533E-5
17-79479701-C-A c.-218G>T 5_prime_UTR_premature_start_codon_gain ACTG1 1 15108 6.61901E-5 7554 0 NA
17-79479702-G-A c.-219C>T 5_prime_UTR_premature_start_codon_gain ACTG1 2 15016 1.33191E-4 7508 0 NA
17-79479718-G-A c.-235C>T 5_prime_UTR_premature_start_codon_gain ACTG1 1 13262 7.54034E-5 6631 0 1.87892E-5
17-79479725-G-A c.-242C>T 5_prime_UTR_premature_start_codon_gain ACTG1 1 12530 7.98085E-5 6265 0 3.20431E-5
17-79479728-G-A c.-245C>T 5_prime_UTR_premature_start_codon_gain ACTG1 103 12112 0.00850396 6056 2 0.0180997
17-79479738-G-A c.-255C>T 5_prime_UTR_premature_start_codon_gain ACTG1 1 11476 8.71384E-5 5738 0 NA
17-79479777-G-A c.-24C>T 5_prime_UTR_premature_start_codon_gain ACTG1 19 9064 0.0020962 4532 0 0.00434895
17-79479780-G-A c.-27C>T 5_prime_UTR_premature_start_codon_gain ACTG1 6 8956 6.69942E-4 4478 0 8.70294E-4
17-79479785-G-A c.-32C>T 5_prime_UTR_premature_start_codon_gain ACTG1 5 8748 5.71559E-4 4374 0 0.00136715
17-79479792-G-C c.-39C>G 5_prime_UTR_premature_start_codon_gain ACTG1 1 8606 1.16198E-4 4303 0 NA
17-79479797-G-A c.-44C>T 5_prime_UTR_premature_start_codon_gain ACTG1 2 8508 2.35073E-4 4254 0 5.70633E-5
17-79479797-G-C c.-44C>G 5_prime_UTR_premature_start_codon_gain ACTG1 3 8508 3.52609E-4 4254 0 2.20264E-4
17-79479803-G-A c.-50C>T 5_prime_UTR_premature_start_codon_gain ACTG1 1 8406 1.18963E-4 4203 0 2.28013E-4
17-79479814-G-A c.-61C>T 5_prime_UTR_premature_start_codon_gain ACTG1 1 8224 1.21595E-4 4112 0 6.59935E-5
17-79479816-G-A c.-63C>T 5_prime_UTR_premature_start_codon_gain ACTG1 13 8210 0.00158343 4105 0 0.00710461
17-79479819-G-A c.-66C>T 5_prime_UTR_premature_start_codon_gain ACTG1 1 8184 1.2219E-4 4092 0 1.33289E-4
17-79479829-G-A c.-76C>T 5_prime_UTR_premature_start_codon_gain ACTG1 3 8054 3.72486E-4 4027 1 1.00746E-4
17-79479844-C-A c.-91G>T 5_prime_UTR_premature_start_codon_gain ACTG1 1 7988 1.25188E-4 3994 0 3.23164E-5