Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
7-5566787-A-G c.*1383T>C splice_region ACTB 1 44628 2.24075E-5 22314 0 NA
7-5567249-C-T n.255-7G>A splice_region ACTB 1 77700 1.287E-5 38850 0 NA
7-5567355-T-TA n.254+8dupT splice_region ACTB 2 81152 2.46451E-5 40576 0 NA
7-5567357-A-C n.254+7T>G splice_region ACTB 2 81210 2.46275E-5 40605 0 NA
7-5567358-C-T n.254+6G>A splice_region ACTB 1 81130 1.23259E-5 40565 0 1.98888E-5
7-5567359-G-A n.254+5C>T splice_region ACTB 8 81134 9.86023E-5 40567 0 8.75086E-5
7-5567361-A-G n.254+3T>C splice_region ACTB 7 81322 8.60776E-5 40661 0 0.001875
7-5567382-G-A p.Phe375Phe synonymous ACTB 1 81868 1.22148E-5 40934 0 8.24076E-6
7-5567391-G-A p.Arg372Arg synonymous ACTB 1 82136 1.21749E-5 41068 0 NA
7-5567400-G-A p.Ile369Ile synonymous ACTB 36 82418 4.36798E-4 41209 0 5.05051E-4
7-5567406-G-A p.Pro367Pro synonymous ACTB 1 82590 1.2108E-5 41295 0 NA
7-5567412-G-A p.Ser365Ser synonymous ACTB 2 82704 2.41826E-5 41352 0 4.9447E-5
7-5567413-G-C p.Ser365Cys missense ACTB 1 82716 1.20896E-5 41358 0 NA
7-5567418-G-A p.Asp363Asp synonymous ACTB 13 82778 1.57047E-4 41389 0 2.23214E-4
7-5567434-C-A p.Ser358Ile missense ACTB 1 83012 1.20465E-5 41506 0 NA
7-5567451-G-A p.Phe352Phe synonymous ACTB 5 83156 6.0128E-5 41578 0 6.25E-4
7-5567463-C-T p.Ser348Ser synonymous ACTB 30 83120 3.60924E-4 41560 0 0.00120566
7-5567466-G-A p.Ala347Ala synonymous ACTB 1 83158 1.20253E-5 41579 0 2.06213E-4
7-5567481-G-A p.Gly342Gly synonymous ACTB 4 83238 4.8055E-5 41619 0 4.37574E-5
7-5567484-G-A p.Ile341Ile synonymous ACTB 380 83246 0.00456478 41623 8 0.010023
7-5567490-C-G p.Val339Val synonymous ACTB 3 83262 3.60308E-5 41631 0 9.94376E-5
7-5567493-G-T p.Ser338Ser synonymous ACTB 2 83254 2.40229E-5 41627 0 NA
7-5567493-G-A p.Ser338Ser synonymous ACTB 1 83254 1.20114E-5 41627 0 2.78421E-5
7-5567496-G-A p.Tyr337Tyr synonymous ACTB 7 83254 8.408E-5 41627 0 6.37308E-5
7-5567522-TCTGAGGAGGGAAGGGGACAGGCAGTGAGGACCCTGGATGTGACAGCTCCCCACACACCACAGGACCCCACAGCCGACCTGCCCAGGTCAGCTCAGGCAGGAAAGACACCCAC-T c.984+1_985-1del splice_acceptor ACTB 7 83232 8.41023E-5 41616 0 5.76996E-5
7-5567528-G-A c.985-6C>T splice_region ACTB 80 83230 9.61192E-4 41615 1 0.00232692
7-5567530-G-A c.985-8C>T splice_region ACTB 1 83242 1.20132E-5 41621 0 1.98929E-5
7-5567652-T-C p.Ser323Gly missense ACTB 1 83296 1.20054E-5 41648 0 NA
7-5567661-G-A p.Leu320Leu synonymous ACTB 1 83300 1.20048E-5 41650 0 3.97659E-6
7-5567662-G-A p.Ala319Ala synonymous ACTB 2 83304 2.40085E-5 41652 0 3.97659E-6
7-5567668-G-A p.Ile317Ile synonymous ACTB 90 83296 0.00108048 41648 0 0.00315307
7-5567677-C-T p.Gln314Gln synonymous ACTB 2876 83238 0.0345515 41619 61 0.0458207
7-5567688-C-T p.Asp311Asn missense ACTB 1 83310 1.20034E-5 41655 0 NA
7-5567689-G-A p.Ala310Ala synonymous ACTB 4 83308 4.80146E-5 41654 0 6.36943E-5
7-5567710-G-A p.Thr303Thr synonymous ACTB 2 83296 2.40108E-5 41648 0 NA
7-5567713-G-A p.Gly302Gly synonymous ACTB 1 83286 1.20068E-5 41643 0 3.97674E-6
7-5567716-G-A p.Gly301Gly synonymous ACTB 3 83290 3.60187E-5 41645 0 2.50533E-4
7-5567729-G-A p.Thr297Ile missense ACTB 1 83288 1.20065E-5 41644 0 1.19299E-5
7-5567737-G-A p.Tyr294Tyr synonymous ACTB 7 83288 8.40457E-5 41644 0 1.19298E-5
7-5567755-G-A p.Asp288Asp synonymous ACTB 1 83276 1.20083E-5 41638 0 3.18431E-5
7-5567761-G-A p.Asp286Asp synonymous ACTB 4 83258 4.80434E-5 41629 0 5.03525E-4
7-5567777-G-A p.Ser281Phe missense ACTB 1 83182 1.20218E-5 41591 0 NA
7-5567785-G-T p.Thr278Thr synonymous ACTB 1 83104 1.20331E-5 41552 0 1.9884E-5
7-5567791-T-C p.Glu276Glu synonymous ACTB 2 82960 2.4108E-5 41480 0 NA
7-5567794-G-A p.His275His synonymous ACTB 5 82860 6.03427E-5 41430 0 3.1841E-5
7-5567797-G-T p.Ile274Ile synonymous ACTB 9 82772 1.08732E-4 41386 0 2.86588E-4
7-5567800-G-A p.Gly273Gly synonymous ACTB 1 82694 1.20928E-5 41347 0 3.57927E-5
7-5567806-G-A p.Ser271Ser synonymous ACTB 1 82458 1.21274E-5 41229 0 3.18492E-5
7-5567815-G-A p.Gly268Gly splice_region+synonymous ACTB 4 82150 4.86914E-5 41075 0 8.24035E-6
7-5567820-A-C c.803-4T>G splice_region ACTB 1 81884 1.22124E-5 40942 0 NA
7-5567823-G-A c.803-7C>T splice_region ACTB 3 81784 3.6682E-5 40892 0 8.24049E-6
7-5567824-G-A c.803-8C>T splice_region ACTB 2 81724 2.44726E-5 40862 0 8.24049E-6
7-5567916-G-A p.Phe266Phe synonymous ACTB 1 82568 1.21112E-5 41284 0 1.64891E-5
7-5567919-G-A p.Ser265Ser synonymous ACTB 2 82648 2.4199E-5 41324 1 1.98897E-5
7-5567931-G-T p.Leu261Leu synonymous ACTB 1 82864 1.2068E-5 41432 0 NA
7-5567934-T-C p.Ala260Ala synonymous ACTB 1 82908 1.20616E-5 41454 0 NA
7-5567946-G-A p.Arg256Arg synonymous ACTB 1 83022 1.2045E-5 41511 0 NA
7-5567949-G-A p.Phe255Phe synonymous ACTB 1 83056 1.20401E-5 41528 0 8.24674E-6
7-5567952-C-G p.Arg254Arg synonymous ACTB 42 83080 5.05537E-4 41540 0 8.59708E-4
7-5567958-A-G p.Asn252Asn synonymous ACTB 4 83096 4.81371E-5 41548 0 3.1841E-5
7-5567967-G-T p.Thr249Thr synonymous ACTB 1 83116 1.20314E-5 41558 0 NA
7-5567970-G-A p.Ile248Ile synonymous ACTB 1 83122 1.20305E-5 41561 0 3.97801E-6
7-5567976-C-T p.Gln246Gln synonymous ACTB 1 83126 1.20299E-5 41563 0 3.18431E-5
7-5567982-G-A p.Asp244Asp synonymous ACTB 4 83128 4.81186E-5 41564 0 7.5593E-5
7-5567994-G-A p.Tyr240Tyr synonymous ACTB 3 83104 3.60993E-5 41552 0 1.23899E-4
7-5568008-G-A p.Leu236Leu synonymous ACTB 1 83112 1.2032E-5 41556 0 3.18471E-5
7-5568012-G-A p.Ser234Ser synonymous ACTB 3 83114 3.6095E-5 41557 0 7.16292E-5
7-5568024-A-G p.Ala230Ala synonymous ACTB 1 83100 1.20337E-5 41550 0 NA
7-5568027-C-T p.Thr229Thr synonymous ACTB 31 83092 3.7308E-4 41546 0 0.00105082
7-5568027-C-A p.Thr229Thr synonymous ACTB 1 83092 1.20349E-5 41546 0 8.27061E-6
7-5568048-G-A p.Asp222Asp synonymous ACTB 1 83120 1.20308E-5 41560 0 NA
7-5568053-G-A p.Leu221Leu synonymous ACTB 1 83124 1.20302E-5 41562 0 NA
7-5568057-G-A p.Val219Val synonymous ACTB 5 83124 6.01511E-5 41562 0 1.99032E-5
7-5568069-C-T p.Lys215Lys synonymous ACTB 10 83142 1.20276E-4 41571 0 1.07644E-4
7-5568072-C-T p.Glu214Glu synonymous ACTB 5 83162 6.01236E-5 41581 0 1.73913E-4
7-5568090-G-A p.Ile208Ile synonymous ACTB 6 83172 7.21397E-5 41586 0 6.3678E-5
7-5568093-T-C p.Glu207Glu synonymous ACTB 1 83180 1.20221E-5 41590 0 NA
7-5568105-C-G p.Thr203Thr synonymous ACTB 41 83166 4.9299E-4 41583 1 0.00101943
7-5568105-C-T p.Thr203Thr synonymous ACTB 6 83164 7.21466E-5 41582 0 7.56906E-5
7-5568117-G-A p.Ser199Ser synonymous ACTB 1 83174 1.2023E-5 41587 0 NA
7-5568126-G-A p.Arg196Arg synonymous ACTB 3 83162 3.60742E-5 41581 0 7.96825E-6
7-5568132-G-A p.Thr194Thr synonymous ACTB 16 83148 1.92428E-4 41574 0 0.00105708
7-5568135-G-T p.Leu193Leu synonymous ACTB 1 83160 1.2025E-5 41580 0 2.78838E-5
7-5568146-T-C p.Met190Val missense ACTB 1 83128 1.20296E-5 41564 0 NA
7-5568153-G-A p.Asp187Asp synonymous ACTB 2 83116 2.40628E-5 41558 0 6.37024E-5
7-5568174-C-G p.Leu180Leu synonymous ACTB 2 83080 2.40732E-5 41540 0 NA
7-5568177-G-A p.Asp179Asp synonymous ACTB 2 83086 2.40714E-5 41543 0 NA
7-5568182-G-A p.Leu178Leu synonymous ACTB 1 83076 1.20372E-5 41538 0 1.59333E-5
7-5568188-G-A p.Leu176Leu synonymous ACTB 4 83062 4.81568E-5 41531 0 1.6608E-5
7-5568189-G-T p.Ile175Ile synonymous ACTB 1 83054 1.20404E-5 41527 0 NA
7-5568195-A-G p.His173His synonymous ACTB 1 83032 1.20435E-5 41516 0 3.98191E-6
7-5568198-G-A p.Pro172Pro synonymous ACTB 1 83006 1.20473E-5 41503 0 8.30041E-6
7-5568204-G-A p.Ala170Ala synonymous ACTB 1 83032 1.20435E-5 41516 0 NA
7-5568210-C-G p.Gly168Gly synonymous ACTB 1 83020 1.20453E-5 41510 0 NA
7-5568234-G-A p.Thr160Thr synonymous ACTB 1 83008 1.2047E-5 41504 0 NA
7-5568240-C-T p.Gly158Gly synonymous ACTB 1 82982 1.20508E-5 41491 0 3.18695E-5
7-5568243-G-A p.Asp157Asp synonymous ACTB 4 82978 4.82055E-5 41489 0 2.48641E-5
7-5568246-A-T p.Gly156Gly synonymous ACTB 1 82984 1.20505E-5 41492 0 NA
7-5568249-G-A p.Ser155Ser synonymous ACTB 3 83020 3.61359E-5 41510 0 1.59223E-5
7-5568261-G-A p.Ile151Ile synonymous ACTB 9 83046 1.08374E-4 41523 0 2.66673E-4
7-5568261-G-T p.Ile151Ile synonymous ACTB 1 83060 1.20395E-5 41530 0 NA
7-5568267-A-T p.Thr149Thr synonymous ACTB 1 83074 1.20375E-5 41537 0 NA
7-5568276-G-A p.Gly146Gly synonymous ACTB 1 83064 1.20389E-5 41532 0 NA
7-5568282-G-A p.Ala144Ala synonymous ACTB 2 83076 2.40743E-5 41538 0 3.97956E-6
7-5568285-G-A p.Tyr143Tyr synonymous ACTB 7 83062 8.42744E-5 41531 0 0.0015121
7-5568288-C-A p.Leu142Leu synonymous ACTB 524 83058 0.00630884 41529 3 0.0046283
7-5568294-T-C p.Leu140Leu synonymous ACTB 48 83048 5.77979E-4 41524 0 0.00121112
7-5568326-G-A p.Pro130Ser missense ACTB 1 82882 1.20653E-5 41441 0 NA
7-5568327-G-A p.Thr129Thr synonymous ACTB 2 82870 2.41342E-5 41435 0 1.66008E-5
7-5568348-G-T p.Ile122Ile splice_region+synonymous ACTB 3 82488 3.63689E-5 41244 0 NA
7-5568354-T-C c.364-4A>G splice_region ACTB 3 82280 3.64609E-5 41140 0 2.8677E-4
7-5568355-A-C c.364-5T>G splice_region ACTB 1 82250 1.21581E-5 41125 0 NA
7-5568357-G-T c.364-7C>A splice_region ACTB 1 82206 1.21646E-5 41103 0 3.99636E-6
7-5568357-G-A c.364-7C>T splice_region ACTB 3 82206 3.64937E-5 41103 0 8.33014E-6
7-5568652-G-A c.*24C>T splice_region ACTB 37 79030 4.68177E-4 39515 0 1.91022E-4
7-5568679-G-A p.Leu125Leu synonymous ACTB 3 80794 3.71315E-5 40397 0 1.40904E-4
7-5568684-G-A p.Leu124Phe missense ACTB 1 80962 1.23515E-5 40481 0 3.18431E-5
7-5568685-A-G p.Ser123Ser synonymous ACTB 1 80994 1.23466E-5 40497 0 6.37024E-5
7-5568686-G-C p.Ser123Cys missense ACTB 12 81016 1.48119E-4 40508 0 1.08386E-4
7-5568694-C-T c.364-4G>A splice_region ACTB 1 81178 1.23186E-5 40589 0 NA
7-5568694-C-G c.364-4G>C splice_region ACTB 1 81178 1.23186E-5 40589 0 1.69877E-5
7-5568696-G-A c.364-6C>T splice_region ACTB 2 81242 2.46178E-5 40621 0 4.00667E-6
7-5568804-C-T p.Glu117Glu synonymous ACTB 1 82778 1.20805E-5 41389 0 4.13887E-5
7-5568828-G-A p.Pro109Pro synonymous ACTB 1 82894 1.20636E-5 41447 0 3.18552E-5
7-5568837-G-C p.Thr106Thr synonymous ACTB 4 82906 4.82474E-5 41453 0 0.00105708
7-5568840-C-G p.Leu105Leu synonymous ACTB 5 82916 6.0302E-5 41458 0 1.27421E-4
7-5568843-C-T p.Leu104Leu synonymous ACTB 1 82934 1.20578E-5 41467 0 3.18471E-5
7-5568846-C-G p.Val103Val synonymous ACTB 1 82946 1.2056E-5 41473 0 NA
7-5568858-C-T p.Glu99Glu synonymous ACTB 1 82958 1.20543E-5 41479 0 3.98004E-6
7-5568868-A-G p.Val99Ala missense+splice_region ACTB 1 82984 1.20505E-5 41492 0 NA
7-5568875-G-C p.Leu94Val missense ACTB 1 82976 1.20517E-5 41488 0 NA
7-5568875-G-A p.Leu94Leu synonymous ACTB 4 82976 4.82067E-5 41488 0 1.59226E-4
7-5568885-G-A p.Phe90Phe synonymous ACTB 1 82978 1.20514E-5 41489 0 3.97931E-6
7-5568888-G-A p.Thr89Thr synonymous ACTB 2 82982 2.41016E-5 41491 0 7.44048E-5
7-5568891-G-A p.His88His synonymous ACTB 5 82952 6.02758E-5 41476 0 3.97928E-6
7-5568900-G-T p.Ile85Ile synonymous ACTB 1 82964 1.20534E-5 41482 0 8.26528E-6
7-5568933-G-A p.Gly74Gly synonymous ACTB 3 82886 3.61943E-5 41443 0 3.18552E-5
7-5568945-G-A p.Pro70Pro synonymous ACTB 1 82886 1.20648E-5 41443 0 3.18613E-5
7-5568950-A-G p.Tyr69His missense ACTB 1 82856 1.20691E-5 41428 0 NA
7-5568957-G-A p.Thr66Thr synonymous ACTB 11 82856 1.3276E-4 41428 0 5.96806E-5
7-5568960-G-A p.Leu65Leu synonymous ACTB 2 82852 2.41394E-5 41426 0 3.9788E-6
7-5568975-G-A p.Ser60Ser synonymous ACTB 8 82918 9.64809E-5 41459 0 5.17261E-5
7-5568987-G-A p.Asp56Asp synonymous ACTB 56 82960 6.75024E-4 41480 0 0.00127429
7-5568999-G-A p.Ser52Ser synonymous ACTB 14 83016 1.68642E-4 41508 0 6.25E-4
7-5569008-C-G p.Gln49His missense ACTB 1 83030 1.20438E-5 41515 0 NA
7-5569020-C-A p.Val45Val synonymous ACTB 1 83010 1.20467E-5 41505 0 3.97899E-6
7-5569030-CCCTGGGAAGGAAAGGACAAGAAGCCCTGAGCACGGGCGCAGCCCCCACCCCGGAAACCGGGAGGCTCCTGTGCAGAGAAAGCGCCCTTGCCTCCCGCCCGCTCCCGGGGCTGCCCCACCCAGCCAGCTCCCCTA-C p.Gly42fs frameshift ACTB 1 83000 1.20482E-5 41500 0 NA
7-5569035-G-A c.124-4C>T splice_region ACTB 22 83000 2.6506E-4 41500 1 0.00106266
7-5569036-G-A c.124-5C>T splice_region ACTB 2 83000 2.40964E-5 41500 0 4.13695E-5
7-5569038-A-T c.124-7T>A splice_region ACTB 9 82998 1.08436E-4 41499 0 6.92581E-4
7-5569193-G-A p.Pro32Pro synonymous ACTB 1 80620 1.24039E-5 40310 0 1.52512E-4
7-5569196-G-A p.Phe31Phe synonymous ACTB 9 80588 1.11679E-4 40294 0 4.48189E-5
7-5569205-C-A p.Arg28Arg synonymous ACTB 1 80510 1.24208E-5 40255 0 NA
7-5569208-G-T p.Pro27Pro synonymous ACTB 2 80678 2.47899E-5 40339 0 1.78508E-5
7-5569226-G-A p.Phe21Phe synonymous ACTB 2 80704 2.47819E-5 40352 0 1.77557E-5
7-5569232-G-C p.Ala19Ala synonymous ACTB 5 80808 6.18751E-5 40404 0 NA
7-5569232-G-A p.Ala19Ala synonymous ACTB 1 80808 1.2375E-5 40404 0 1.63658E-5
7-5569253-G-A p.Asn12Asn synonymous ACTB 3 80748 3.71526E-5 40374 0 1.27437E-4
7-5569265-G-C p.Leu8Leu synonymous ACTB 5 80552 6.20717E-5 40276 0 3.18715E-5
7-5569265-G-T p.Leu8Leu synonymous ACTB 1 80552 1.24143E-5 40276 0 1.22537E-5
7-5569271-G-T p.Ala6Ala synonymous ACTB 1 80474 1.24264E-5 40237 0 NA
7-5569274-G-A p.Ile5Ile synonymous ACTB 1 80484 1.24248E-5 40242 0 8.8333E-6
7-5569290-G-C p.Thr3Ser missense ACTB 3 79976 3.75113E-5 39988 0 3.18674E-5
7-5569292-G-A p.Leu2Leu splice_region+synonymous ACTB 1 79894 1.25166E-5 39947 0 9.55901E-5
7-5569294-G-C p.Leu2Val missense+splice_region ACTB 1 79798 1.25316E-5 39899 0 8.86226E-6
7-5569295-C-T c.-6-1G>A splice_acceptor ACTB 1 79752 1.25389E-5 39876 0 NA
7-5569296-T-TGGCG c.-6-3_-6-2insCGCC splice_region ACTB 1 79696 1.25477E-5 39848 0 NA
7-5569296-T-TG c.-6-3dupC splice_region ACTB 1 79698 1.25474E-5 39849 0 NA
7-5569296-T-TGGCGGCGGGTGTG c.-6-3_-6-2insCACACCCGCCGCC splice_region ACTB 1 79696 1.25477E-5 39848 0 NA
7-5569297-G-A c.-6-3C>T splice_region ACTB 2 79626 2.51174E-5 39813 0 NA
7-5569298-C-A c.-6-4G>T splice_region ACTB 259 79550 0.00325581 39775 0 0.00325151
7-5569298-C-CGGCGGGTGTG c.-6-5_-6-4insCACACCCGCC splice_region ACTB 1 79556 1.25698E-5 39778 0 NA
7-5569299-G-A c.-6-5C>T splice_region ACTB 6 79512 7.54603E-5 39756 0 1.27445E-4
7-5569302-A-G c.-6-8T>C splice_region ACTB 2 79428 2.518E-5 39714 0 8.23269E-6
7-5569362-G-A n.82C>T splice_region ACTB 1 76612 1.30528E-5 38306 0 NA
7-5569364-C-G n.80G>C splice_region ACTB 8 76590 1.04452E-4 38295 0 1.91314E-4
7-5569367-T-C n.80-3A>G splice_region ACTB 1 76520 1.30685E-5 38260 0 NA
7-5569370-G-A n.80-6C>T splice_region ACTB 1 76440 1.30822E-5 38220 0 3.18898E-5
7-5569434-T-A c.3+3A>T splice_region ACTB 1 74574 1.34095E-5 37287 0 6.51568E-6
7-5569438-A-T p.Met1? start_lost ACTB 2 74240 2.69397E-5 37120 0 NA
7-5569452-C-T c.-13G>A 5_prime_UTR_premature_start_codon_gain ACTB 2 72654 2.75277E-5 36327 0 NA
7-5569459-G-C c.-20C>G 5_prime_UTR_premature_start_codon_gain ACTB 29 70840 4.09373E-4 35420 0 0.00110058
7-5569464-G-A c.-25C>T 5_prime_UTR_premature_start_codon_gain ACTB 1 69136 1.44642E-5 34568 0 1.28436E-4
7-5569469-C-A c.-30G>T 5_prime_UTR_premature_start_codon_gain ACTB 1 68116 1.46808E-5 34058 0 8.8433E-5
7-5569472-G-A c.-33C>T 5_prime_UTR_premature_start_codon_gain ACTB 1 67286 1.48619E-5 33643 0 1.42743E-5
7-5569479-G-A c.-40C>T 5_prime_UTR_premature_start_codon_gain ACTB 2 66068 3.02718E-5 33034 0 NA
7-5569518-C-A c.-79G>T 5_prime_UTR_premature_start_codon_gain ACTB 2 53912 3.70975E-5 26956 0 NA
7-5569567-C-G c.-128G>C 5_prime_UTR_premature_start_codon_gain ACTB 2 36526 5.47555E-5 18263 0 NA
7-5569571-G-A c.-132C>T 5_prime_UTR_premature_start_codon_gain ACTB 37 35282 0.00104869 17641 0 0.00383366
7-5570156-T-TGGCGGCGGGTGTGGACG c.-25_-9dupCGTCCACACCCGCCGCC splice_region ACTB 11 35058 3.13766E-4 17529 0 0.00120868
7-5570156-TGGCGGCGGGTGTGGACG-T c.-25_-9delCGTCCACACCCGCCGCC splice_region ACTB 2 35058 5.70483E-5 17529 0 NA
7-5570163-G-A c.-15C>T 5_prime_UTR_premature_start_codon_gain ACTB 3 36306 8.2631E-5 18153 0 9.71754E-5
7-5570189-A-G c.-41T>C 5_prime_UTR_premature_start_codon_gain ACTB 1 39188 2.5518E-5 19594 0 3.27118E-5
7-5570221-G-A c.-73C>T 5_prime_UTR_premature_start_codon_gain ACTB 63 40440 0.00155786 20220 0 6.16563E-4
7-5570230-G-A c.-82C>T 5_prime_UTR_premature_start_codon_gain ACTB 1 40620 2.46184E-5 20310 0 3.24254E-5
7-5602200-G-C c.-103+5C>G splice_region ACTB 8 16 0.5 8 3 0.543927