Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
20-33460810-T-C n.120+6T>C splice_region ACSS2 3586 9902 0.362149 4951 94 0.682245
20-33462819-G-T c.-84G>T 5_prime_UTR_premature_start_codon_gain ACSS2 1 58758 1.7019E-5 29379 0 NA
20-33462824-C-A c.-79C>A 5_prime_UTR_premature_start_codon_gain ACSS2 1 58742 1.70236E-5 29371 0 NA
20-33462900-GA-G p.Met1fs frameshift ACSS2 3 59114 5.07494E-5 29557 0 NA
20-33462913-G-A p.Arg4Lys missense ACSS2 4 59106 6.7675E-5 29553 0 6.81122E-5
20-33462921-C-T p.Leu7Phe missense ACSS2 1 59094 1.69222E-5 29547 0 4.00657E-6
20-33464358-A-G c.-91A>G 5_prime_UTR_premature_start_codon_gain ACSS2 1 40758 2.45351E-5 20379 0 3.21792E-5
20-33464383-C-T c.-66C>T 5_prime_UTR_premature_start_codon_gain ACSS2 1 49002 2.04073E-5 24501 0 NA
20-33464398-C-T c.-51C>T 5_prime_UTR_premature_start_codon_gain ACSS2 1 52694 1.89775E-5 26347 0 NA
20-33464414-C-T c.-35C>T 5_prime_UTR_premature_start_codon_gain ACSS2 1 57252 1.74666E-5 28626 0 1.90676E-4
20-33464435-A-G c.-14A>G 5_prime_UTR_premature_start_codon_gain ACSS2 1 62464 1.60092E-5 31232 0 NA
20-33464449-ATG-A p.Met1fs frameshift ACSS2 1 64326 1.55458E-5 32163 0 NA
20-33464450-T-A p.Met1? start_lost ACSS2 1 64428 1.55212E-5 32214 0 NA
20-33464452-G-C p.Gly2Arg missense ACSS2 3 64730 4.63464E-5 32365 0 6.39386E-4
20-33464453-G-A p.Gly2Glu missense ACSS2 1 64548 1.54923E-5 32274 0 NA
20-33464455-C-T p.Leu3Phe missense ACSS2 1 64340 1.55424E-5 32170 0 NA
20-33464467-C-A p.Arg7Arg synonymous ACSS2 2 63374 3.15587E-5 31687 0 NA
20-33464475-G-C p.Arg9Arg synonymous ACSS2 1 62210 1.60746E-5 31105 0 0.00104493
20-33464502-G-A p.Glu18Glu synonymous ACSS2 1 57140 1.75009E-5 28570 0 2.81452E-4
20-33464503-G-A p.Glu19Lys missense ACSS2 2 56920 3.5137E-5 28460 0 3.1902E-5
20-33464528-G-C p.Arg27Pro missense ACSS2 1 50202 1.99195E-5 25101 0 9.5761E-5
20-33464532-T-C p.Ser28Ser synonymous ACSS2 1 49052 2.03865E-5 24526 0 1.23784E-5
20-33464534-G-C p.Trp29Ser missense ACSS2 27 48754 5.53801E-4 24377 0 3.31565E-4
20-33464572-C-A p.Pro42Thr missense ACSS2 65 41984 0.00154821 20992 1 0.00475643
20-33464574-C-T p.Pro42Pro synonymous ACSS2 2 41764 4.78881E-5 20882 0 6.08273E-4
20-33464582-A-G p.Gln45Arg missense ACSS2 4 40574 9.85853E-5 20287 0 1.91681E-4
20-33464585-G-A p.Arg46His missense ACSS2 1 40046 2.49713E-5 20023 0 NA
20-33464590-C-A p.Arg48Ser missense ACSS2 2 39030 5.12426E-5 19515 0 NA
20-33464590-C-G p.Arg48Gly missense ACSS2 1 39030 2.56213E-5 19515 0 NA
20-33464603-G-C p.Arg52Pro missense ACSS2 2 37488 5.33504E-5 18744 0 7.47384E-4
20-33470590-G-C c.179-7G>C splice_region ACSS2 3 82236 3.64804E-5 41118 0 8.24606E-6
20-33470613-T-C p.Leu40Ser missense ACSS2 1 82494 1.21221E-5 41247 0 NA
20-33470617-A-G p.Lys67Glu missense ACSS2 1 82560 1.21124E-5 41280 0 NA
20-33470642-G-A p.Cys75Tyr missense ACSS2 1 82890 1.20642E-5 41445 0 NA
20-33470659-C-T p.Arg81Trp missense ACSS2 16 82960 1.92864E-4 41480 0 1.40026E-4
20-33470660-G-A p.Arg81Gln missense ACSS2 1 82990 1.20496E-5 41495 0 6.37064E-5
20-33470663-A-T p.Tyr82Phe missense ACSS2 1 83026 1.20444E-5 41513 0 4.94218E-5
20-33470674-G-A p.Val86Met missense ACSS2 1 83040 1.20424E-5 41520 0 5.97519E-5
20-33470694-C-T p.Phe92Phe synonymous ACSS2 46646 82716 0.56393 41358 13551 0.675625
20-33470696-T-C p.Ile93Thr missense ACSS2 3 83080 3.61098E-5 41540 0 8.23696E-6
20-33470703-G-A p.Trp95* stop_gained ACSS2 1 83038 1.20427E-5 41519 0 NA
20-33470715-A-G p.Ala99Ala synonymous ACSS2 1 82982 1.20508E-5 41491 0 8.23723E-6
20-33470721-C-T p.Thr101Thr synonymous ACSS2 2 82944 2.41127E-5 41472 0 3.98346E-6
20-33470730-C-T p.Cys104Cys synonymous ACSS2 1 82868 1.20674E-5 41434 0 NA
20-33470736-T-C p.Asn106Asn synonymous ACSS2 7 82806 8.45349E-5 41403 0 5.76682E-5
20-33470737-G-C p.Val107Leu missense ACSS2 26 82794 3.14032E-4 41397 0 6.04941E-4
20-33470739-A-G p.Val107Val synonymous ACSS2 4 82778 4.8322E-5 41389 0 1.20021E-5
20-33470746-C-G p.Arg110Gly missense ACSS2 1 82652 1.20989E-5 41326 0 4.04325E-6
20-33470747-G-A p.Arg110Gln missense ACSS2 2 82618 2.42078E-5 41309 0 2.83059E-5
20-33470756-A-G p.His113Arg missense ACSS2 1 82528 1.21171E-5 41264 0 3.18329E-5
20-33470773-G-T p.Asp119Tyr missense ACSS2 8 82274 9.72361E-5 41137 0 5.7925E-5
20-33470782-G-A p.Ala122Thr missense ACSS2 4 81998 4.87817E-5 40999 0 1.59266E-4
20-33470790-C-T p.Tyr124Tyr splice_region+synonymous ACSS2 1 81896 1.22106E-5 40948 0 3.18634E-5
20-33470791-T-C p.Ter75Argext*? stop_lost ACSS2 2 81870 2.4429E-5 40935 0 6.36821E-5
20-33470795-A-G c.374+3A>G splice_region ACSS2 1 81754 1.22318E-5 40877 0 6.37755E-4
20-33481364-A-T c.375-8A>T splice_region ACSS2 2 40 0.05 20 0 0.104681
20-33481370-A-T c.375-2A>T splice_acceptor ACSS2 1 112 0.00892857 56 0 0.00801944
20-33481409-C-G p.Gln138Glu missense ACSS2 14 602 0.0232558 301 0 0.079661
20-33496711-C-T p.Ser126Ser synonymous ACSS2 1 52286 1.91256E-5 26143 0 NA
20-33496726-A-G p.Ser131Ser synonymous ACSS2 2 52298 3.82424E-5 26149 0 NA
20-33496730-T-C p.Tyr133His missense ACSS2 11 52298 2.10333E-4 26149 0 1.62201E-4
20-33496740-C-T p.Thr136Ile missense ACSS2 1 52292 1.91234E-5 26146 0 8.02143E-6
20-33496744-C-T p.Cys137Cys splice_region+synonymous ACSS2 1 52298 1.91212E-5 26149 0 7.98799E-6
20-33496747-G-GGAGGGCAA c.413+1_413+2insGAGGGCAA splice_donor ACSS2 1 52306 1.91183E-5 26153 0 NA
20-33500894-C-G c.375-5C>G splice_region ACSS2 1 83258 1.20109E-5 41629 0 NA
20-33500907-A-G p.Asn128Ser missense ACSS2 32 83306 3.84126E-4 41653 0 3.82458E-4
20-33500908-T-A p.Asn128Lys missense ACSS2 1 83314 1.20028E-5 41657 0 8.23642E-6
20-33500914-A-C p.Pro130Pro synonymous ACSS2 2 83326 2.40021E-5 41663 0 NA
20-33500916-G-A p.Gly131Glu missense ACSS2 1 83328 1.20008E-5 41664 0 4.11821E-5
20-33500920-G-A p.Glu132Glu synonymous ACSS2 1 83338 1.19993E-5 41669 0 NA
20-33500939-C-T p.His139Tyr missense ACSS2 1 83332 1.20002E-5 41666 0 NA
20-33500968-C-A p.Phe148Leu missense ACSS2 1 83338 1.19993E-5 41669 0 3.9769E-6
20-33500973-A-G p.Asn150Ser missense ACSS2 1 83330 1.20005E-5 41665 0 1.19307E-5
20-33500981-C-T p.Arg153* stop_gained ACSS2 1 83332 1.20002E-5 41666 0 8.23683E-6
20-33500982-G-A p.Arg153Gln missense ACSS2 4 83326 4.80042E-5 41663 0 1.27437E-4
20-33500985-A-G p.Lys154Arg missense ACSS2 1 83320 1.20019E-5 41660 0 8.23683E-6
20-33500997-G-T c.466+7G>T splice_region ACSS2 5 83278 6.00399E-5 41639 0 3.97757E-6
20-33500997-G-A c.466+7G>A splice_region ACSS2 1 83278 1.2008E-5 41639 0 NA
20-33501199-T-C p.Ile157Thr missense ACSS2 1 82846 1.20706E-5 41423 0 2.47999E-5
20-33501200-TC-T p.Gln158fs frameshift ACSS2 1 82840 1.20715E-5 41420 0 9.5645E-5
20-33501210-G-A p.Asp161Asn missense ACSS2 6 82786 7.2476E-5 41393 0 1.19471E-5
20-33501214-G-A p.Arg162Gln missense ACSS2 1 82774 1.20811E-5 41387 0 8.25655E-6
20-33501230-G-A p.Met167Ile missense ACSS2 1 82700 1.20919E-5 41350 0 6.76832E-5
20-33501234-A-G p.Met169Val missense ACSS2 1 82688 1.20937E-5 41344 0 8.25355E-6
20-33501235-T-C p.Met169Thr missense ACSS2 2 82682 2.41891E-5 41341 0 NA
20-33501245-G-A n.256-5G>A splice_region ACSS2 1 82620 1.21036E-5 41310 0 3.98222E-6
20-33501246-C-G p.Leu173Val missense ACSS2 2 82614 2.4209E-5 41307 0 NA
20-33501258-A-C p.Met177Leu missense ACSS2 1 82530 1.21168E-5 41265 0 NA
20-33501271-C-T p.Ala181Val missense ACSS2 84 82386 0.00101959 41193 0 8.32868E-4
20-33501301-TAGG-T p.Ile189del disruptive_inframe_deletion ACSS2 1 82076 1.21838E-5 41038 0 NA
20-33501569-C-T p.Ser195Phe missense ACSS2 1 83072 1.20378E-5 41536 0 6.37471E-5
20-33501569-C-A p.Ser195Tyr missense ACSS2 1 83072 1.20378E-5 41536 0 3.29489E-5
20-33501582-A-G p.Leu199Leu synonymous ACSS2 1 83062 1.20392E-5 41531 0 6.37511E-5
20-33501583-T-C p.Cys200Arg missense ACSS2 1 83068 1.20383E-5 41534 0 1.19372E-5
20-33501589-C-T p.Arg202Trp missense ACSS2 1 83032 1.20435E-5 41516 0 2.78583E-5
20-33501593-TC-T p.Leu204fs frameshift ACSS2 1 83032 1.20435E-5 41516 0 NA
20-33501612-T-C n.569T>C splice_region ACSS2 3 82952 3.61655E-5 41476 0 8.23859E-6
20-33501619-A-G p.Ile212Val missense ACSS2 2 82910 2.41225E-5 41455 0 6.25E-4
20-33501651-C-T n.409-6C>T splice_region ACSS2 4 82564 4.84473E-5 41282 0 7.9769E-6
20-33501893-C-T c.644-6C>T splice_region ACSS2 1 83226 1.20155E-5 41613 0 NA
20-33501896-A-G c.644-3A>G splice_region ACSS2 2 83242 2.40263E-5 41621 0 1.59188E-5
20-33501907-T-C p.Tyr218His missense ACSS2 1 83300 1.20048E-5 41650 0 3.97826E-6
20-33501912-G-C p.Arg219Ser missense ACSS2 1 83310 1.20034E-5 41655 0 NA
20-33501917-A-G p.Glu221Gly missense ACSS2 1 83324 1.20013E-5 41662 0 3.3065E-5
20-33501918-A-C p.Glu221Asp missense ACSS2 1 83328 1.20008E-5 41664 0 NA
20-33501928-A-C p.Asn225His missense ACSS2 1 83340 1.1999E-5 41670 0 NA
20-33501931-C-T p.Leu226Leu synonymous ACSS2 1 83340 1.1999E-5 41670 0 NA
20-33501946-G-C p.Asp231His missense ACSS2 11 83342 1.31986E-4 41671 0 1.3221E-4
20-33501948-C-T p.Asp231Asp synonymous ACSS2 2 83344 2.39969E-5 41672 0 6.37146E-5
20-33501951-G-C p.Glu232Asp missense ACSS2 7 83342 8.39913E-5 41671 0 3.18233E-5
20-33501953-C-A p.Ala233Asp missense ACSS2 2 83332 2.40004E-5 41666 0 3.97763E-6
20-33501955-C-T p.Leu234Leu synonymous ACSS2 1 83342 1.19988E-5 41671 0 NA
20-33501958-C-A p.Gln235Lys missense ACSS2 18 83344 2.15972E-4 41672 1 0.00107591
20-33501959-A-C p.Gln235Pro missense ACSS2 1 83346 1.19982E-5 41673 0 1.65519E-5
20-33502120-C-T c.720-6C>T splice_region ACSS2 1371 82610 0.0165961 41305 61 0.0338708
20-33502133-C-A p.Pro243Thr missense ACSS2 1 82644 1.21001E-5 41322 0 NA
20-33502160-C-T p.His252Tyr missense ACSS2 1 82622 1.21033E-5 41311 0 3.99144E-6
20-33502162-C-T p.His252His synonymous ACSS2 101 82642 0.00122214 41321 0 0.00331295
20-33502169-C-T p.Arg255Trp missense ACSS2 2 82632 2.42037E-5 41316 0 3.32784E-5
20-33502170-G-A p.Arg255Gln missense ACSS2 15 82646 1.81497E-4 41323 0 5.03525E-4
20-33502181-G-A p.Gly259Ser missense ACSS2 31 82574 3.75421E-4 41287 0 5.03525E-4
20-33502198-C-T p.Thr264Thr synonymous ACSS2 1 82710 1.20904E-5 41355 0 NA
20-33502205-T-TC p.Ile270fs frameshift ACSS2 5 82684 6.04712E-5 41342 0 8.3724E-5
20-33502210-C-A p.Pro268Pro synonymous ACSS2 1 82714 1.20899E-5 41357 0 NA
20-33502223-T-A p.Ser273Thr missense ACSS2 1 82682 1.20945E-5 41341 0 NA
20-33502240-G-GATCTCATGGAACCAAGGGATTGACTT c.834_834+1insATCTCATGGAACCAAGGGATTGACTT splice_donor ACSS2 5 82626 6.05136E-5 41313 2 NA
20-33503013-C-G c.835-8C>G splice_region ACSS2 1 82386 1.2138E-5 41193 0 NA
20-33503026-A-G p.Lys280Lys synonymous ACSS2 24 82426 2.9117E-4 41213 0 2.23271E-4
20-33503046-G-A p.Arg287His missense ACSS2 5 82406 6.06752E-5 41203 0 7.63488E-5
20-33503047-T-A p.Arg287Arg synonymous ACSS2 1 82408 1.21347E-5 41204 0 NA
20-33503057-C-CTATAT p.Gln291fs frameshift ACSS2 1 82396 1.21365E-5 41198 0 NA
20-33503059-G-T p.Gln291His missense+splice_region ACSS2 1 82380 1.21389E-5 41190 0 NA
20-33503062-A-G c.873+3A>G splice_region ACSS2 1 82366 1.21409E-5 41183 0 4.01845E-6
20-33507242-C-G p.Ser293* stop_gained ACSS2 1 83316 1.20025E-5 41658 0 NA
20-33507261-C-T p.Asp299Asp synonymous ACSS2 1 83320 1.20019E-5 41660 0 3.97716E-6
20-33507264-G-C p.Leu300Phe missense ACSS2 1 83324 1.20013E-5 41662 0 8.2375E-6
20-33507266-G-A p.Trp301* stop_gained ACSS2 5 83316 6.00125E-5 41658 0 8.23723E-6
20-33507273-T-G p.His303Gln missense ACSS2 1 83320 1.20019E-5 41660 0 NA
20-33507277-C-T p.Leu305Phe missense ACSS2 1 83314 1.20028E-5 41657 0 8.23764E-6
20-33507280-A-G p.Met306Val missense ACSS2 2 83314 2.40056E-5 41657 0 NA
20-33507289-G-A p.Ala309Thr missense ACSS2 1 83292 1.2006E-5 41646 0 NA
20-33507292-G-T p.Gly310Trp missense ACSS2 3 83286 3.60205E-5 41643 0 NA
20-33507301-T-A p.Cys313Ser missense ACSS2 748 83260 0.00898391 41630 22 0.0190857
20-33507304-G-A p.Glu314Lys missense ACSS2 16 83260 1.92169E-4 41630 1 1.59469E-4
20-33507307-C-T p.Pro315Ser missense ACSS2 12 83244 1.44155E-4 41622 0 6.70455E-4
20-33507309-C-T p.Pro315Pro synonymous ACSS2 10 83224 1.20158E-4 41612 0 2.55395E-4
20-33507310-G-A p.Glu316Lys missense ACSS2 1 83222 1.20161E-5 41611 0 3.18979E-5
20-33507324-C-T p.Ala320Ala synonymous ACSS2 106 83088 0.00127576 41544 0 0.00503525
20-33507325-G-A p.Glu321Lys missense ACSS2 4 83074 4.81498E-5 41537 0 2.78682E-5
20-33507330-C-T p.Asp322Asp synonymous ACSS2 6 83002 7.22874E-5 41501 0 3.18634E-5
20-33507334-C-T p.Leu324Phe missense ACSS2 1 82994 1.20491E-5 41497 0 NA
20-33507335-T-G p.Leu324Arg missense ACSS2 2 82974 2.41039E-5 41487 0 NA
20-33507349-A-G p.Thr329Ala missense ACSS2 1 82664 1.20972E-5 41332 0 NA
20-33507372-C-G p.Pro336Pro synonymous ACSS2 2 81940 2.44081E-5 40970 0 NA
20-33507379-AGTGT-A c.1011+5_1011+8delGTGT splice_region ACSS2 16365 79652 0.205456 39826 1954 0.280717
20-33507379-AGT-A c.1011+5_1011+6delGT splice_region ACSS2 5208 77090 0.0675574 38545 252 0.0989203
20-33507379-AGTGTGTGTGTGTGT-A c.1011+5_1011+18delGTGTGTGTGTGTGT splice_region ACSS2 193 81638 0.0023641 40819 2 NA
20-33507379-AGTGTGTGT-A c.1011+5_1011+12delGTGTGTGT splice_region ACSS2 7489 81118 0.0923223 40559 407 0.141057
20-33507379-AGTGTGT-A c.1011+5_1011+10delGTGTGT splice_region ACSS2 3783 81292 0.0465359 40646 178 0.0635152
20-33507379-AGTGTGTGTGT-A c.1011+5_1011+14delGTGTGTGTGT splice_region ACSS2 588 81618 0.00720429 40809 10 0.0122214
20-33507379-A-AGTGT c.1011+4_1011+5insGTGT splice_region ACSS2 592 81512 0.00726273 40756 13 0.0215682
20-33507379-A-AGTGTGT c.1011+4_1011+5insGTGTGT splice_region ACSS2 72 81632 8.82007E-4 40816 2 NA
20-33507379-AGTGTGTGTGTGT-A c.1011+5_1011+16delGTGTGTGTGTGT splice_region ACSS2 49 81634 6.0024E-4 40817 0 NA
20-33507379-AGTGTGTGTGTGTGTGT-A c.1011+5_1011+20delGTGTGTGTGTGTGTGT splice_region ACSS2 6 81640 7.34934E-5 40820 0 NA
20-33507379-AGTGTGTGTGTGTGTGTGTGT-A c.1011+5_1011+24delGTGTGTGTGTGTGTGTGTGT splice_region ACSS2 5 81640 6.12445E-5 40820 0 NA
20-33507379-AGTGTGTGTGTGTGTGTGTGTGTGT-A c.1011+5_1011+28delGTGTGTGTGTGTGTGTGTGTGTGT splice_region ACSS2 3 81640 3.67467E-5 40820 0 NA
20-33507379-AGTGTGTGTGTGTGTGTGTGTGT-A c.1011+5_1011+26delGTGTGTGTGTGTGTGTGTGTGT splice_region ACSS2 1 81640 1.22489E-5 40820 0 NA
20-33507379-AGTGTGTGTGTGTGTGTGT-A c.1011+5_1011+22delGTGTGTGTGTGTGTGTGT splice_region ACSS2 2 81640 2.44978E-5 40820 0 NA
20-33507379-A-AGTGTGTGTGTGT c.1011+4_1011+5insGTGTGTGTGTGT splice_region ACSS2 5 81640 6.12445E-5 40820 0 NA
20-33507379-A-AGTGTGTGTGTGTGTGT c.1011+4_1011+5insGTGTGTGTGTGTGTGT splice_region ACSS2 4 81640 4.89956E-5 40820 0 NA
20-33507379-A-AGTGTGTGTGTGTGT c.1011+4_1011+5insGTGTGTGTGTGTGT splice_region ACSS2 1 81640 1.22489E-5 40820 0 NA
20-33508338-A-T c.1012-4A>T splice_region ACSS2 1 81898 1.22103E-5 40949 0 NA
20-33508349-T-C p.Val340Ala missense ACSS2 1 82122 1.2177E-5 41061 0 NA
20-33508358-T-C p.Val343Ala missense ACSS2 154 82196 0.00187357 41098 2 0.0032482
20-33508369-A-G p.Met347Val missense ACSS2 1 82236 1.21601E-5 41118 0 3.98448E-6
20-33508369-A-T p.Met347Leu missense ACSS2 1 82236 1.21601E-5 41118 0 NA
20-33508374-C-G p.Leu348Leu synonymous ACSS2 2 82266 2.43114E-5 41133 0 NA
20-33508376-A-G p.Tyr349Cys missense ACSS2 2 82272 2.43096E-5 41136 0 8.2545E-6
20-33508395-G-A p.Lys355Lys synonymous ACSS2 52 82096 6.33405E-4 41048 0 0.0020141
20-33508399-G-A p.Val357Met missense ACSS2 1 82092 1.21815E-5 41046 0 3.98489E-6
20-33508407-C-T p.Asp359Asp synonymous ACSS2 3 81972 3.65979E-5 40986 0 NA
20-33508425-G-A p.Val365Val synonymous ACSS2 1 81612 1.22531E-5 40806 0 NA
20-33508436-C-T p.Thr369Met missense ACSS2 1 81224 1.23116E-5 40612 0 8.25614E-6
20-33508437-G-C p.Thr369Thr synonymous ACSS2 8 81142 9.85926E-5 40571 0 9.55597E-5
20-33508437-G-A p.Thr369Thr synonymous ACSS2 1 81146 1.23235E-5 40573 0 NA
20-33508442-A-G p.Asp371Gly missense ACSS2 1 81006 1.23448E-5 40503 0 NA
20-33508446-TG-T p.Gly373fs frameshift ACSS2 1 80924 1.23573E-5 40462 0 NA
20-33508448-G-A p.Gly373Asp missense ACSS2 1 80790 1.23778E-5 40395 0 NA
20-33508453-A-G p.Ile375Val missense ACSS2 2 80672 2.47917E-5 40336 0 NA
20-33508457-C-T p.Thr376Ile missense ACSS2 4 80664 4.95884E-5 40332 0 NA
20-33508470-C-T p.Tyr380Tyr synonymous ACSS2 2 80294 2.49085E-5 40147 0 1.66262E-5
20-33508471-G-A p.Val381Ile missense ACSS2 3 80246 3.7385E-5 40123 0 1.91119E-4
20-33508486-C-T p.Leu386Leu synonymous ACSS2 3 80156 3.7427E-5 40078 0 NA
20-33508498-G-C p.Ala390Pro missense ACSS2 1 79912 1.25138E-5 39956 0 8.474E-6
20-33508505-G-A p.Ser392Asn missense ACSS2 1 79850 1.25235E-5 39925 0 1.70558E-5
20-33508511-T-C p.Leu394Ser missense+splice_region ACSS2 1 79756 1.25382E-5 39878 0 1.21794E-5
20-33508520-G-A c.1182+8G>A splice_region ACSS2 1 79526 1.25745E-5 39763 0 8.63841E-6
20-33508803-G-A c.1183-6G>A splice_region ACSS2 1 83200 1.20192E-5 41600 0 NA
20-33508807-A-G c.1183-2A>G splice_acceptor ACSS2 1 83204 1.20187E-5 41602 0 NA
20-33508826-A-G p.Thr400Thr synonymous ACSS2 3104 83130 0.0373391 41565 345 0.081132
20-33508829-T-G p.Tyr401* stop_gained ACSS2 1 83192 1.20204E-5 41596 0 8.23927E-6
20-33508831-C-T p.Pro402Leu missense ACSS2 1 83200 1.20192E-5 41600 0 3.18878E-5
20-33508832-G-A p.Pro402Pro synonymous ACSS2 2 83188 2.40419E-5 41594 0 6.25E-4
20-33508836-G-A p.Val404Met missense ACSS2 2 83184 2.40431E-5 41592 0 8.23778E-6
20-33508840-A-G p.Asn405Ser missense ACSS2 2 83170 2.40471E-5 41585 0 3.97864E-6
20-33508842-C-T p.Arg406Cys missense ACSS2 1 83164 1.20244E-5 41582 0 8.23723E-6
20-33508843-G-T p.Arg406Leu missense ACSS2 1 83140 1.20279E-5 41570 0 NA
20-33508843-G-A p.Arg406His missense ACSS2 1 83140 1.20279E-5 41570 0 8.23737E-6
20-33508854-A-C p.Ile410Leu missense ACSS2 2 83116 2.40628E-5 41558 0 3.1955E-5
20-33508855-T-C p.Ile410Thr missense ACSS2 1 83114 1.20317E-5 41557 0 1.64734E-5
20-33508863-A-G p.Lys413Glu missense ACSS2 1 83078 1.20369E-5 41539 0 NA
20-33508864-A-T p.Lys413Ile missense ACSS2 1 83078 1.20369E-5 41539 0 NA
20-33508872-G-A p.Val416Met missense ACSS2 1 83026 1.20444E-5 41513 0 NA
20-33508876-C-A p.Thr417Asn missense ACSS2 4 83000 4.81928E-5 41500 0 1.27527E-4
20-33508891-C-T p.Ala422Val missense ACSS2 1 82966 1.20531E-5 41483 0 NA
20-33508897-C-T p.Thr424Ile missense ACSS2 3 82976 3.6155E-5 41488 0 1.99007E-5
20-33508901-C-T p.Ala425Ala synonymous ACSS2 1 82990 1.20496E-5 41495 0 NA
20-33508906-G-A p.Arg427His missense ACSS2 3 82992 3.61481E-5 41496 0 3.18593E-5
20-33508914-A-T p.Met430Leu missense ACSS2 1 83030 1.20438E-5 41515 0 2.47117E-5
20-33508929-G-A p.Glu435Lys missense ACSS2 2 83070 2.40761E-5 41535 0 1.98976E-5
20-33508934-T-C p.Pro436Pro synonymous ACSS2 4 83074 4.81498E-5 41537 0 1.27429E-4
20-33508949-C-A c.1316+7C>A splice_region ACSS2 1 83110 1.20322E-5 41555 0 3.98004E-6
20-33508949-C-G c.1316+7C>G splice_region ACSS2 1 83110 1.20322E-5 41555 0 NA
20-33508950-C-G c.1316+8C>G splice_region ACSS2 1 83116 1.20314E-5 41558 0 NA
20-33509126-G-T c.1317-7G>T splice_region ACSS2 1 83022 1.2045E-5 41511 0 3.98762E-6
20-33509132-G-C c.1317-1G>C splice_acceptor ACSS2 2 83012 2.40929E-5 41506 0 NA
20-33509140-C-A p.Arg442Arg synonymous ACSS2 1 83002 1.20479E-5 41501 0 3.5856E-5
20-33509140-C-T p.Arg442Trp missense ACSS2 1 83002 1.20479E-5 41501 0 3.18492E-5
20-33509142-GGCATCCTT-G p.Ser444fs frameshift ACSS2 1 82994 1.20491E-5 41497 0 NA
20-33509147-C-A p.Ser444Tyr missense ACSS2 1 82954 1.20549E-5 41477 0 1.59304E-5
20-33509188-G-C p.Glu458Gln missense ACSS2 2 82824 2.41476E-5 41412 0 NA
20-33509195-G-A p.Trp460* stop_gained ACSS2 2 82816 2.41499E-5 41408 0 8.24022E-6
20-33509199-A-G p.Leu461Leu synonymous ACSS2 1 82816 1.2075E-5 41408 0 1.99027E-5
20-33509209-C-T p.Arg465Trp missense ACSS2 3 82824 3.62214E-5 41412 0 3.29614E-5
20-33509210-G-A p.Arg465Gln missense ACSS2 1 82832 1.20726E-5 41416 0 0.00100705
20-33509219-G-A p.Gly468Asp missense ACSS2 1 82882 1.20653E-5 41441 0 NA
20-33509224-C-G p.Gln470Glu missense ACSS2 1 82896 1.20633E-5 41448 0 3.98064E-6
20-33509224-C-T p.Gln470* stop_gained ACSS2 1 82896 1.20633E-5 41448 0 3.98064E-6
20-33509227-C-T p.Arg471Cys missense ACSS2 8 82902 9.64995E-5 41451 0 7.96153E-5
20-33509233-C-A p.Pro473Thr missense ACSS2 1 82954 1.20549E-5 41477 0 7.96121E-6
20-33509238-C-T p.Ile474Ile synonymous ACSS2 5 83002 6.02395E-5 41501 0 0.00100705
20-33509239-G-A p.Val475Met missense ACSS2 1 83010 1.20467E-5 41505 0 5.17409E-5
20-33509246-CCTT-C p.Phe478del disruptive_inframe_deletion ACSS2 1 83026 1.20444E-5 41513 0 NA
20-33509258-CAG-C p.Glu482fs frameshift ACSS2 2 83120 2.40616E-5 41560 0 NA
20-33509265-AGTGAGTGAAGGGTACAGAAGGCTGGGGCCCAGGGACAATGTGGGAAGATTGACTCAAATTTCTCATCTCTGACTTCCCCAG-A c.1449+1_1450-1delGTGAGTGAAGGGTACAGAAGGCTGGGGCCCAGGGACAATGTGGGAAGATTGACTCAAATTTCTCATCTCTGACTTCCCCAG splice_acceptor ACSS2 7 83146 8.41893E-5 41573 0 NA
20-33509341-C-G c.1450-6C>G splice_region ACSS2 14 83220 1.68229E-4 41610 0 1.64731E-5
20-33509347-G-C p.Gly484Arg missense+splice_region ACSS2 2 83206 2.40367E-5 41603 0 NA
20-33509351-G-A p.Gly485Asp missense ACSS2 1 83182 1.20218E-5 41591 0 4.37644E-5
20-33509356-A-G p.Met487Val missense ACSS2 1 83144 1.20273E-5 41572 0 8.23655E-6
20-33509357-T-C p.Met487Thr missense ACSS2 1 83144 1.20273E-5 41572 0 NA
20-33509364-T-C p.Thr489Thr synonymous ACSS2 1 83088 1.20354E-5 41544 0 NA
20-33509366-C-G p.Pro490Arg missense ACSS2 3 83092 3.61046E-5 41546 0 4.94193E-5
20-33509373-T-C p.Pro492Pro synonymous ACSS2 1 83048 1.20412E-5 41524 0 NA
20-33509377-G-A p.Ala494Thr missense ACSS2 14 83030 1.68614E-4 41515 1 0.00100705
20-33509394-C-T p.Pro499Pro synonymous ACSS2 15 82912 1.80915E-4 41456 0 2.42832E-4
20-33509395-G-A p.Gly500Ser missense ACSS2 1 82914 1.20607E-5 41457 0 3.18492E-5
20-33509410-G-A c.1506+7G>A splice_region ACSS2 1 82848 1.20703E-5 41424 0 NA
20-33509582-C-T c.1507-7C>T splice_region ACSS2 1 83350 1.19976E-5 41675 0 NA
20-33509590-C-T p.Thr503Ile missense+splice_region ACSS2 1 83362 1.19959E-5 41681 0 NA
20-33509605-G-A p.Gly508Asp missense ACSS2 1 83376 1.19939E-5 41688 0 3.9814E-6
20-33509607-G-A p.Val509Ile missense ACSS2 1 83374 1.19941E-5 41687 0 5.03525E-4
20-33509608-T-C p.Val509Ala missense ACSS2 86 83378 0.00103145 41689 0 0.00232038
20-33509632-C-A p.Ser517Tyr missense ACSS2 1 83386 1.19924E-5 41693 0 1.65216E-5
20-33509633-C-G p.Ser517Ser synonymous ACSS2 3 83384 3.59781E-5 41692 0 NA
20-33509651-T-A p.Gly523Gly synonymous ACSS2 1 83390 1.19918E-5 41695 0 NA
20-33509655-G-A p.Ala525Thr missense ACSS2 34 83392 4.07713E-4 41696 0 6.68832E-4
20-33509675-G-A c.1587+6G>A splice_region ACSS2 2 83342 2.39975E-5 41671 0 3.18552E-5
20-33511122-C-T c.1588-4C>T splice_region ACSS2 2 83028 2.40883E-5 41514 0 8.33611E-6
20-33511125-G-C c.1588-1G>C splice_acceptor ACSS2 1 83056 1.20401E-5 41528 0 8.31794E-6
20-33511137-G-A p.Ser129Asn missense ACSS2 3 83152 3.60785E-5 41576 0 NA
20-33511141-T-C p.Trp535Arg missense ACSS2 1 83184 1.20215E-5 41592 0 NA
20-33511143-G-C p.Trp535Cys missense ACSS2 1 83176 1.20227E-5 41588 0 NA
20-33511152-C-T p.Ser134Leu missense ACSS2 2 83224 2.40315E-5 41612 0 NA
20-33511153-A-G p.Met539Val missense ACSS2 1 83226 1.20155E-5 41613 0 NA
20-33511157-G-A p.Arg540His missense ACSS2 2 83230 2.40298E-5 41615 0 2.47684E-5
20-33511160-C-A p.Thr541Lys missense ACSS2 1 83232 1.20146E-5 41616 0 3.97757E-6
20-33511162-G-A p.Val542Ile missense ACSS2 83 83246 9.97045E-4 41623 0 6.4433E-4
20-33511170-G-A p.Gly140Glu missense ACSS2 3 83254 3.60343E-5 41627 0 6.37064E-5
20-33511176-C-T p.Thr142Met missense ACSS2 5 83258 6.00543E-5 41629 0 3.18205E-5
20-33511177-G-A p.Glu547Lys missense ACSS2 5 83256 6.00557E-5 41628 0 3.18471E-5
20-33511180-C-T p.Arg548Cys missense ACSS2 1 83254 1.20114E-5 41627 0 9.55353E-5
20-33511182-C-T p.Ala144Val missense ACSS2 1 83244 1.20129E-5 41622 0 3.97747E-6
20-33511189-A-T p.Thr551Ser missense ACSS2 2 83236 2.40281E-5 41618 0 0.00151057
20-33511194-C-G p.Pro148Arg missense ACSS2 1 83232 1.20146E-5 41616 0 NA
20-33511203-G-C p.Lys555Asn missense ACSS2 1 83202 1.20189E-5 41601 0 NA
20-33511224-T-C p.Leu158Ser missense ACSS2 4 83060 4.8158E-5 41530 0 1.69566E-5
20-33511235-G-GCTGCCAGCGGGACCAGGATGGCTATTACTGGATCACTGGCAGGATTGA c.1696+1_1696+2insCTGCCAGCGGGACCAGGATGGCTATTACTGGATCACTGGCAGGATTGA splice_donor ACSS2 2 82954 2.41097E-5 41477 1 NA
20-33511237-G-A c.1696+3G>A splice_region ACSS2 1 82938 1.20572E-5 41469 0 NA
20-33511241-C-G c.1696+7C>G splice_region ACSS2 1 82872 1.20668E-5 41436 0 NA
20-33513507-A-G p.Gln568Arg missense ACSS2 1 83060 1.20395E-5 41530 0 NA
20-33513510-G-A p.Arg569Gln missense ACSS2 1 83072 1.20378E-5 41536 0 1.92526E-5
20-33513514-C-T p.Thr166Ile missense ACSS2 1 83092 1.20349E-5 41546 0 NA
20-33513537-C-T p.Thr578Ile missense ACSS2 6 83126 7.21796E-5 41563 0 6.37064E-5
20-33513546-T-C p.Ile581Thr missense ACSS2 1 83052 1.20406E-5 41526 0 2.81801E-5
20-33513553-C-T p.Thr179Ile missense ACSS2 1 83040 1.20424E-5 41520 0 6.37146E-5
20-33513554-A-T p.Met584Leu missense ACSS2 3 83040 3.61272E-5 41520 0 9.49668E-6
20-33513559-CAATGT-C p.Asn586fs frameshift ACSS2 1 83008 1.2047E-5 41504 0 NA
20-33513566-T-TC p.Gly589fs frameshift ACSS2 1 82972 1.20523E-5 41486 0 NA
20-33513570-G-GACACCTGC c.1765+1_1765+2insACACCTGC splice_donor ACSS2 2 82924 2.41185E-5 41462 0 NA
20-33513570-G-GACACCTGCTGAGTACAGCAGAGGTGGAGTCAGCACTTGTGGAACA c.1765+1_1765+2insACACCTGCTGAGTACAGCAGAGGTGGAGTCAGCACTTGTGGAACA splice_donor ACSS2 2 82922 2.41191E-5 41461 1 NA
20-33513572-G-A c.1765+3G>A splice_region ACSS2 3 82888 3.61934E-5 41444 0 1.01634E-5
20-33513572-G-T c.1765+3G>T splice_region ACSS2 2 82886 2.41295E-5 41443 0 3.18776E-5
20-33513904-C-A c.1766-4C>A splice_region ACSS2 1 83096 1.20343E-5 41548 0 1.19414E-5
20-33513920-G-A p.Ser593Asn missense ACSS2 1 83170 1.20236E-5 41585 0 8.23927E-6
20-33513927-A-G p.Ala595Ala synonymous ACSS2 1 83162 1.20247E-5 41581 0 NA
20-33513936-G-A p.Glu598Glu synonymous ACSS2 1 83174 1.2023E-5 41587 0 NA
20-33513939-A-G p.Ser599Ser synonymous ACSS2 17 83172 2.04396E-4 41586 0 0.00100705
20-33513943-C-T p.Leu601Phe missense ACSS2 1 83174 1.2023E-5 41587 0 3.97798E-6
20-33513955-G-A p.Glu605Lys missense ACSS2 1 83166 1.20241E-5 41583 0 3.97807E-6
20-33513957-G-A p.Glu605Glu synonymous ACSS2 2 83144 2.40547E-5 41572 0 3.18471E-5
20-33513961-G-A p.Val607Ile missense ACSS2 4 83136 4.81139E-5 41568 0 2.47133E-5
20-33513965-C-G p.Ala608Gly missense ACSS2 5 83106 6.01641E-5 41553 0 3.29527E-5
20-33513965-C-CA p.Glu609fs frameshift ACSS2 1 83106 1.20328E-5 41553 0 NA
20-33513983-G-C p.Gly614Ala missense ACSS2 1367 82924 0.016485 41462 61 0.0340047
20-33514001-A-G p.Lys620Arg missense ACSS2 2 82806 2.41528E-5 41403 0 NA
20-33514004-G-T p.Gly621Val missense ACSS2 3 82750 3.62538E-5 41375 0 3.18492E-5
20-33514030-T-C p.Leu630Leu synonymous ACSS2 3 81964 3.66014E-5 40982 0 6.37471E-5
20-33514055-C-G p.Pro638Arg missense ACSS2 1 80210 1.24673E-5 40105 0 6.37349E-5
20-33514065-C-T p.Thr641Thr synonymous ACSS2 28 79054 3.54188E-4 39527 0 6.05327E-4
20-33514065-CGAG-C p.Glu643del conservative_inframe_deletion ACSS2 9 79056 1.13843E-4 39528 0 0.00201613
20-33514681-TAGAGA-T p.Arg649fs frameshift ACSS2 1 83370 1.19947E-5 41685 0 NA
20-33514692-T-C p.Ile652Thr missense ACSS2 1 83390 1.19918E-5 41695 0 7.9533E-6
20-33514695-G-GC p.Ile655fs frameshift ACSS2 1 83394 1.19913E-5 41697 0 NA
20-33514720-C-T p.Ile661Ile synonymous ACSS2 1 83400 1.19904E-5 41700 0 NA
20-33514748-C-T p.Arg671Cys missense ACSS2 3 83376 3.59816E-5 41688 0 2.38618E-5
20-33514749-G-A p.Arg671His missense ACSS2 16 83374 1.91906E-4 41687 0 2.86661E-4
20-33514751-TCAGGTATGTTCAGAGGCCTCCATGGATTGGGATGGGCTGAGGCCTGGTGGTGGTGGGGTGTGCGTGGATGAAAGCCTTTGGCAGGGCTAGGGTGGGTCAGTGCTTTCACCAAGTAACTAGAGGTCTGTGGTTCCC-T p.Ser672_Gly673delinsTrp splice_donor ACSS2 6 83380 7.19597E-5 41690 0 NA
20-33514755-G-T c.2017+1G>T splice_donor ACSS2 1 83382 1.1993E-5 41691 0 NA
20-33514882-T-C c.2018-8T>C splice_region ACSS2 3 83338 3.5998E-5 41669 0 3.19061E-5
20-33514890-G-T p.Gly673Val missense+splice_region ACSS2 1 83356 1.19967E-5 41678 0 8.23683E-6
20-33514900-G-A p.Met676Ile missense ACSS2 1 83370 1.19947E-5 41685 0 8.23655E-6
20-33514905-G-A p.Arg678Gln missense ACSS2 5 83364 5.99779E-5 41682 0 9.56511E-5
20-33514913-C-T p.Arg681Trp missense ACSS2 2 83364 2.39912E-5 41682 0 9.56572E-5
20-33514914-G-A p.Arg681Gln missense ACSS2 2 83368 2.399E-5 41684 0 2.47093E-5
20-33514919-A-T p.Ile683Phe missense ACSS2 1 83366 1.19953E-5 41683 0 1.19296E-5
20-33514941-T-G p.Leu690Arg missense ACSS2 1 83360 1.19962E-5 41680 0 NA
20-33514942-C-T p.Leu690Leu synonymous ACSS2 1 83366 1.19953E-5 41683 0 1.19289E-5
20-33514943-G-A p.Gly691Arg missense ACSS2 2 83362 2.39917E-5 41681 0 6.37755E-5
20-33514945-G-T p.Gly691Gly synonymous ACSS2 1 83356 1.19967E-5 41678 0 NA
20-33514970-T-C p.Ser700Pro missense ACSS2 1 83312 1.20031E-5 41656 0 3.97655E-6
20-33514977-T-C p.Ile702Thr missense ACSS2 2 83304 2.40085E-5 41652 0 8.23723E-6
20-33514984-C-T p.His704His synonymous ACSS2 19 83286 2.2813E-4 41643 0 9.56084E-5
20-33514997-C-T p.Arg709Cys missense ACSS2 20 83252 2.40234E-4 41626 0 5.41781E-4
20-33514998-G-A p.Arg709His missense ACSS2 1 83252 1.20117E-5 41626 0 4.11929E-5