Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
20-33460810-T-C n.120+6T>C splice_region ACSS2 3594 9888 0.363471 4944 94 0.682245
20-33462819-G-T c.-84G>T 5_prime_UTR_premature_start_codon_gain ACSS2 1 58582 1.70701E-5 29291 0 NA
20-33462824-C-A c.-79C>A 5_prime_UTR_premature_start_codon_gain ACSS2 1 58566 1.70748E-5 29283 0 NA
20-33462900-GA-G p.Met1fs frameshift ACSS2 3 58930 5.09079E-5 29465 0 NA
20-33462913-G-A p.Arg4Lys missense ACSS2 4 58922 6.78864E-5 29461 0 6.81122E-5
20-33462921-C-T p.Leu7Phe missense ACSS2 1 58912 1.69745E-5 29456 0 4.00657E-6
20-33464358-A-G c.-91A>G 5_prime_UTR_premature_start_codon_gain ACSS2 1 39176 2.55258E-5 19588 0 3.21792E-5
20-33464383-C-T c.-66C>T 5_prime_UTR_premature_start_codon_gain ACSS2 1 47206 2.11837E-5 23603 0 NA
20-33464398-C-T c.-51C>T 5_prime_UTR_premature_start_codon_gain ACSS2 1 50836 1.96711E-5 25418 0 NA
20-33464414-C-T c.-35C>T 5_prime_UTR_premature_start_codon_gain ACSS2 1 55352 1.80662E-5 27676 0 1.90676E-4
20-33464435-A-G c.-14A>G 5_prime_UTR_premature_start_codon_gain ACSS2 1 60444 1.65442E-5 30222 0 NA
20-33464449-ATG-A p.Met1fs frameshift ACSS2 1 62278 1.6057E-5 31139 0 NA
20-33464450-T-A p.Met1? start_lost ACSS2 1 62376 1.60318E-5 31188 0 NA
20-33464452-G-C p.Gly2Arg missense ACSS2 3 62680 4.78622E-5 31340 0 6.39386E-4
20-33464453-G-A p.Gly2Glu missense ACSS2 1 62502 1.59995E-5 31251 0 NA
20-33464455-C-T p.Leu3Phe missense ACSS2 1 62288 1.60545E-5 31144 0 NA
20-33464467-C-A p.Arg7Arg synonymous ACSS2 2 61306 3.26232E-5 30653 0 NA
20-33464475-G-C p.Arg9Arg synonymous ACSS2 1 60134 1.66295E-5 30067 0 0.00104493
20-33464502-G-A p.Glu18Glu synonymous ACSS2 1 55088 1.81528E-5 27544 0 2.81452E-4
20-33464503-G-A p.Glu19Lys missense ACSS2 2 54872 3.64485E-5 27436 0 3.1902E-5
20-33464528-G-C p.Arg27Pro missense ACSS2 2 48314 4.13959E-5 24157 0 9.5761E-5
20-33464532-T-C p.Ser28Ser synonymous ACSS2 1 47194 2.11891E-5 23597 0 1.23784E-5
20-33464534-G-C p.Trp29Ser missense ACSS2 27 46882 5.75914E-4 23441 0 3.31565E-4
20-33464550-G-A p.Glu34Glu splice_region+synonymous ACSS2 1 43654 2.29074E-5 21827 0 NA
20-33464572-C-A p.Pro42Thr missense ACSS2 65 40314 0.00161234 20157 1 0.00475643
20-33464582-A-G p.Gln45Arg missense ACSS2 4 38940 1.02722E-4 19470 0 1.91681E-4
20-33464585-G-A p.Arg46His missense ACSS2 1 38428 2.60227E-5 19214 0 NA
20-33464590-C-G p.Arg48Gly missense ACSS2 1 37436 2.67123E-5 18718 0 NA
20-33464603-G-C p.Arg52Pro missense ACSS2 2 35926 5.567E-5 17963 0 7.47384E-4
20-33470590-G-C c.179-7G>C splice_region ACSS2 3 79926 3.75347E-5 39963 0 8.24606E-6
20-33470613-T-C p.Leu40Ser missense ACSS2 1 80180 1.24719E-5 40090 0 NA
20-33470617-A-G p.Lys67Glu missense ACSS2 1 80246 1.24617E-5 40123 0 NA
20-33470642-G-A p.Cys75Tyr missense ACSS2 1 80574 1.2411E-5 40287 0 NA
20-33470659-C-T p.Arg81Trp missense ACSS2 16 80644 1.98403E-4 40322 0 1.40026E-4
20-33470660-G-A p.Arg81Gln missense ACSS2 3 80674 3.71867E-5 40337 0 6.37064E-5
20-33470663-A-T p.Tyr82Phe missense ACSS2 1 80710 1.239E-5 40355 0 4.94218E-5
20-33470674-G-A p.Val86Met missense ACSS2 1 80724 1.23879E-5 40362 0 5.97519E-5
20-33470694-C-T p.Phe92Phe synonymous ACSS2 45230 80404 0.562534 40202 13102 0.675625
20-33470696-T-C p.Ile93Thr missense ACSS2 3 80764 3.71453E-5 40382 0 8.23696E-6
20-33470703-G-A p.Trp95* stop_gained ACSS2 1 80720 1.23885E-5 40360 0 NA
20-33470715-A-G p.Ala99Ala synonymous ACSS2 1 80666 1.23968E-5 40333 0 8.23723E-6
20-33470721-C-T p.Thr101Thr synonymous ACSS2 2 80628 2.48053E-5 40314 0 3.98346E-6
20-33470736-T-C p.Asn106Asn synonymous ACSS2 7 80490 8.69673E-5 40245 0 5.76682E-5
20-33470737-G-C p.Val107Leu missense ACSS2 26 80478 3.2307E-4 40239 0 6.04941E-4
20-33470739-A-G p.Val107Val synonymous ACSS2 4 80462 4.97129E-5 40231 0 1.20021E-5
20-33470746-C-G p.Arg110Gly missense ACSS2 1 80336 1.24477E-5 40168 0 4.04325E-6
20-33470747-G-A p.Arg110Gln missense ACSS2 2 80304 2.49054E-5 40152 0 2.83059E-5
20-33470756-A-G p.His113Arg missense ACSS2 1 80212 1.2467E-5 40106 0 3.18329E-5
20-33470773-G-T p.Asp119Tyr missense ACSS2 8 79958 1.00053E-4 39979 0 5.7925E-5
20-33470782-G-A p.Ala122Thr missense ACSS2 4 79682 5.01995E-5 39841 0 1.59266E-4
20-33470790-C-T p.Tyr124Tyr splice_region+synonymous ACSS2 1 79584 1.25653E-5 39792 0 3.18634E-5
20-33470791-T-C p.Ter75Argext*? stop_lost ACSS2 2 79560 2.51383E-5 39780 0 6.36821E-5
20-33470795-A-G c.374+3A>G splice_region ACSS2 1 79446 1.25872E-5 39723 0 6.37755E-4
20-33481364-A-T c.375-8A>T splice_region ACSS2 1 10 0.1 5 0 0.104681
20-33481409-C-G p.Gln138Glu missense ACSS2 5 372 0.0134409 186 1 0.079661
20-33496711-C-T p.Ser126Ser synonymous ACSS2 1 52592 1.90143E-5 26296 0 NA
20-33496726-A-G p.Ser131Ser synonymous ACSS2 2 52604 3.80199E-5 26302 0 NA
20-33496730-T-C p.Tyr133His missense ACSS2 11 52604 2.0911E-4 26302 0 1.62201E-4
20-33496740-C-T p.Thr136Ile missense ACSS2 1 52598 1.90121E-5 26299 0 8.02143E-6
20-33496744-C-T p.Cys137Cys splice_region+synonymous ACSS2 1 52604 1.901E-5 26302 0 7.98799E-6
20-33496747-G-GGAGGGCAA c.413+1_413+2insGAGGGCAA splice_donor ACSS2 1 52612 1.90071E-5 26306 0 NA
20-33500894-C-G c.375-5C>G splice_region ACSS2 1 80956 1.23524E-5 40478 0 NA
20-33500907-A-G p.Asn128Ser missense ACSS2 33 81002 4.07397E-4 40501 0 3.82458E-4
20-33500908-T-A p.Asn128Lys missense ACSS2 1 81008 1.23445E-5 40504 0 8.23642E-6
20-33500914-A-C p.Pro130Pro synonymous ACSS2 2 81020 2.46853E-5 40510 0 NA
20-33500920-G-A p.Glu132Glu synonymous ACSS2 1 81030 1.23411E-5 40515 0 NA
20-33500939-C-T p.His139Tyr missense ACSS2 1 81026 1.23417E-5 40513 0 NA
20-33500968-C-A p.Phe148Leu missense ACSS2 1 81030 1.23411E-5 40515 0 3.9769E-6
20-33500973-A-G p.Asn150Ser missense ACSS2 1 81020 1.23426E-5 40510 0 1.19307E-5
20-33500981-C-T p.Arg153* stop_gained ACSS2 1 81022 1.23423E-5 40511 0 8.23683E-6
20-33500982-G-A p.Arg153Gln missense ACSS2 4 81018 4.93717E-5 40509 0 1.27437E-4
20-33500985-A-G p.Lys154Arg missense ACSS2 1 81014 1.23435E-5 40507 0 8.23683E-6
20-33500997-G-T c.466+7G>T splice_region ACSS2 5 80974 6.17482E-5 40487 0 3.97757E-6
20-33501199-T-C p.Ile157Thr missense ACSS2 1 80556 1.24137E-5 40278 0 2.47999E-5
20-33501200-TC-T p.Gln158fs frameshift ACSS2 1 80552 1.24143E-5 40276 0 9.5645E-5
20-33501210-G-A p.Asp161Asn missense ACSS2 6 80502 7.45323E-5 40251 0 1.19471E-5
20-33501214-G-A p.Arg162Gln missense ACSS2 1 80484 1.24248E-5 40242 0 8.25655E-6
20-33501230-G-A p.Met167Ile missense ACSS2 1 80412 1.2436E-5 40206 0 6.76832E-5
20-33501234-A-G p.Met169Val missense ACSS2 1 80400 1.24378E-5 40200 0 8.25355E-6
20-33501235-T-C p.Met169Thr missense ACSS2 2 80394 2.48775E-5 40197 0 NA
20-33501245-G-A n.256-5G>A splice_region ACSS2 1 80330 1.24486E-5 40165 0 3.98222E-6
20-33501246-C-G p.Leu173Val missense ACSS2 2 80324 2.48992E-5 40162 0 NA
20-33501258-A-C p.Met177Leu missense ACSS2 1 80244 1.2462E-5 40122 0 NA
20-33501271-C-T p.Ala181Val missense ACSS2 82 80102 0.00102369 40051 0 8.32868E-4
20-33501301-TAGG-T p.Ile189del disruptive_inframe_deletion ACSS2 1 79798 1.25316E-5 39899 0 NA
20-33501569-C-T p.Ser195Phe missense ACSS2 1 80778 1.23796E-5 40389 0 6.37471E-5
20-33501569-C-A p.Ser195Tyr missense ACSS2 1 80778 1.23796E-5 40389 0 3.29489E-5
20-33501582-A-G p.Leu199Leu synonymous ACSS2 1 80766 1.23814E-5 40383 0 6.37511E-5
20-33501583-T-C p.Cys200Arg missense ACSS2 1 80770 1.23808E-5 40385 0 1.19372E-5
20-33501589-C-T p.Arg202Trp missense ACSS2 1 80734 1.23864E-5 40367 0 2.78583E-5
20-33501593-TC-T p.Leu204fs frameshift ACSS2 1 80736 1.2386E-5 40368 0 NA
20-33501612-T-C n.569T>C splice_region ACSS2 2 80662 2.47948E-5 40331 0 8.23859E-6
20-33501651-C-T n.409-6C>T splice_region ACSS2 4 80300 4.98132E-5 40150 0 7.9769E-6
20-33501893-C-T c.644-6C>T splice_region ACSS2 1 80936 1.23554E-5 40468 0 NA
20-33501896-A-G c.644-3A>G splice_region ACSS2 2 80950 2.47066E-5 40475 0 1.59188E-5
20-33501907-T-C p.Tyr218His missense ACSS2 1 81002 1.23454E-5 40501 0 3.97826E-6
20-33501917-A-G p.Glu221Gly missense ACSS2 1 81028 1.23414E-5 40514 0 3.3065E-5
20-33501918-A-C p.Glu221Asp missense ACSS2 1 81032 1.23408E-5 40516 0 NA
20-33501928-A-C p.Asn225His missense ACSS2 1 81044 1.2339E-5 40522 0 NA
20-33501931-C-T p.Leu226Leu synonymous ACSS2 1 81044 1.2339E-5 40522 0 NA
20-33501946-G-C p.Asp231His missense ACSS2 11 81042 1.35732E-4 40521 0 1.3221E-4
20-33501948-C-T p.Asp231Asp synonymous ACSS2 2 81042 2.46786E-5 40521 0 6.37146E-5
20-33501951-G-C p.Glu232Asp missense ACSS2 7 81040 8.63771E-5 40520 0 3.18233E-5
20-33501953-C-A p.Ala233Asp missense ACSS2 2 81030 2.46822E-5 40515 0 3.97763E-6
20-33501955-C-T p.Leu234Leu synonymous ACSS2 1 81040 1.23396E-5 40520 0 NA
20-33501958-C-A p.Gln235Lys missense ACSS2 14 81042 1.7275E-4 40521 0 0.00107591
20-33501959-A-C p.Gln235Pro missense ACSS2 1 81044 1.2339E-5 40522 0 1.65519E-5
20-33502120-C-T c.720-6C>T splice_region ACSS2 1351 80312 0.0168219 40156 61 0.0338708
20-33502133-C-A p.Pro243Thr missense ACSS2 1 80346 1.24462E-5 40173 0 NA
20-33502160-C-T p.His252Tyr missense ACSS2 1 80328 1.2449E-5 40164 0 3.99144E-6
20-33502162-C-T p.His252His synonymous ACSS2 104 80350 0.00129434 40175 0 0.00331295
20-33502169-C-T p.Arg255Trp missense ACSS2 2 80342 2.48936E-5 40171 0 3.32784E-5
20-33502170-G-A p.Arg255Gln missense ACSS2 17 80354 2.11564E-4 40177 0 5.03525E-4
20-33502181-G-A p.Gly259Ser missense ACSS2 31 80290 3.861E-4 40145 0 5.03525E-4
20-33502198-C-T p.Thr264Thr synonymous ACSS2 1 80422 1.24344E-5 40211 0 NA
20-33502205-T-TC p.Ile270fs frameshift ACSS2 4 80394 4.9755E-5 40197 0 8.3724E-5
20-33502210-C-A p.Pro268Pro synonymous ACSS2 1 80426 1.24338E-5 40213 0 NA
20-33502223-T-A p.Ser273Thr missense ACSS2 1 80398 1.24381E-5 40199 0 NA
20-33502240-G-GATCTCATGGAACCAAGGGATTGACTT c.834_834+1insATCTCATGGAACCAAGGGATTGACTT splice_donor ACSS2 5 80346 6.22309E-5 40173 2 NA
20-33503013-C-G c.835-8C>G splice_region ACSS2 1 80100 1.24844E-5 40050 0 NA
20-33503026-A-G p.Lys280Lys synonymous ACSS2 24 80136 2.99491E-4 40068 0 2.23271E-4
20-33503046-G-A p.Arg287His missense ACSS2 4 80120 4.99251E-5 40060 0 7.63488E-5
20-33503047-T-A p.Arg287Arg synonymous ACSS2 1 80122 1.2481E-5 40061 0 NA
20-33503059-G-T p.Gln291His missense+splice_region ACSS2 1 80100 1.24844E-5 40050 0 NA
20-33503062-A-G c.873+3A>G splice_region ACSS2 1 80088 1.24863E-5 40044 0 4.01845E-6
20-33507242-C-G p.Ser293* stop_gained ACSS2 1 81014 1.23435E-5 40507 0 NA
20-33507243-A-G p.Ser293Ser synonymous ACSS2 1 81014 1.23435E-5 40507 0 NA
20-33507260-A-C p.Asp299Ala missense ACSS2 1 81008 1.23445E-5 40504 0 NA
20-33507261-C-T p.Asp299Asp synonymous ACSS2 1 81014 1.23435E-5 40507 0 3.97716E-6
20-33507264-G-C p.Leu300Phe missense ACSS2 1 81018 1.23429E-5 40509 0 8.2375E-6
20-33507266-G-A p.Trp301* stop_gained ACSS2 5 81012 6.17192E-5 40506 0 8.23723E-6
20-33507273-T-G p.His303Gln missense ACSS2 1 81010 1.23442E-5 40505 0 NA
20-33507277-C-T p.Leu305Phe missense ACSS2 1 81002 1.23454E-5 40501 0 8.23764E-6
20-33507280-A-G p.Met306Val missense ACSS2 2 81002 2.46907E-5 40501 0 NA
20-33507289-G-A p.Ala309Thr missense ACSS2 1 80978 1.2349E-5 40489 0 NA
20-33507292-G-T p.Gly310Trp missense ACSS2 3 80970 3.70508E-5 40485 0 NA
20-33507301-T-A p.Cys313Ser missense ACSS2 746 80944 0.00921625 40472 22 0.0190857
20-33507304-G-A p.Glu314Lys missense ACSS2 15 80944 1.85313E-4 40472 1 1.59469E-4
20-33507307-C-T p.Pro315Ser missense ACSS2 12 80930 1.48276E-4 40465 0 6.70455E-4
20-33507309-C-T p.Pro315Pro synonymous ACSS2 10 80912 1.23591E-4 40456 0 2.55395E-4
20-33507310-G-A p.Glu316Lys missense ACSS2 1 80910 1.23594E-5 40455 0 3.18979E-5
20-33507324-C-T p.Ala320Ala synonymous ACSS2 88 80774 0.00108946 40387 0 0.00503525
20-33507325-G-A p.Glu321Lys missense ACSS2 4 80758 4.95307E-5 40379 0 2.78682E-5
20-33507330-C-T p.Asp322Asp synonymous ACSS2 6 80684 7.43642E-5 40342 0 3.18634E-5
20-33507334-C-T p.Leu324Phe missense ACSS2 1 80676 1.23953E-5 40338 0 NA
20-33507335-T-G p.Leu324Arg missense ACSS2 2 80654 2.47973E-5 40327 0 NA
20-33507349-A-G p.Thr329Ala missense ACSS2 1 80344 1.24465E-5 40172 0 NA
20-33507372-C-G p.Pro336Pro synonymous ACSS2 2 79618 2.51199E-5 39809 0 NA
20-33507379-AGTGT-A c.1011+5_1011+8delGTGT splice_region ACSS2 12612 72720 0.173432 36360 1050 0.280717
20-33507379-AGT-A c.1011+5_1011+6delGT splice_region ACSS2 4427 73990 0.0598324 36995 127 0.0989203
20-33507379-AGTGTGTGTGTGTGT-A c.1011+5_1011+18delGTGTGTGTGTGTGT splice_region ACSS2 153 79240 0.00193084 39620 2 NA
20-33507379-AGTGTGTGT-A c.1011+5_1011+12delGTGTGTGT splice_region ACSS2 5925 76290 0.0776642 38145 215 0.141057
20-33507379-AGTGTGT-A c.1011+5_1011+10delGTGTGT splice_region ACSS2 2759 77418 0.0356377 38709 89 0.0635152
20-33507379-AGTGTGTGTGT-A c.1011+5_1011+14delGTGTGTGTGT splice_region ACSS2 408 78982 0.00516573 39491 4 0.0122214
20-33507379-A-AGTGT c.1011+4_1011+5insGTGT splice_region ACSS2 508 79078 0.00642404 39539 7 0.0215682
20-33507379-A-AGTGTGT c.1011+4_1011+5insGTGTGT splice_region ACSS2 55 79276 6.93779E-4 39638 0 NA
20-33507379-AGTGTGTGTGTGT-A c.1011+5_1011+16delGTGTGTGTGTGT splice_region ACSS2 40 79292 5.04464E-4 39646 0 NA
20-33507379-AGTGTGTGTGTGTGTGT-A c.1011+5_1011+20delGTGTGTGTGTGTGTGT splice_region ACSS2 5 79312 6.30422E-5 39656 0 NA
20-33507379-AGTGTGTGTGTGTGTGTGTGT-A c.1011+5_1011+24delGTGTGTGTGTGTGTGTGTGT splice_region ACSS2 4 79312 5.04337E-5 39656 0 NA
20-33507379-AGTGTGTGTGTGTGTGTGTGTGTGT-A c.1011+5_1011+28delGTGTGTGTGTGTGTGTGTGTGTGT splice_region ACSS2 2 79314 2.52162E-5 39657 0 NA
20-33507379-AGTGTGTGTGTGTGTGTGT-A c.1011+5_1011+22delGTGTGTGTGTGTGTGTGT splice_region ACSS2 2 79314 2.52162E-5 39657 0 NA
20-33507379-A-AGTGTGTGTGTGT c.1011+4_1011+5insGTGTGTGTGTGT splice_region ACSS2 5 79314 6.30406E-5 39657 0 NA
20-33507379-A-AGTGTGTGTGTGTGTGT c.1011+4_1011+5insGTGTGTGTGTGTGTGT splice_region ACSS2 4 79314 5.04325E-5 39657 0 NA
20-33508338-A-T c.1012-4A>T splice_region ACSS2 1 79608 1.25616E-5 39804 0 NA
20-33508358-T-C p.Val343Ala missense ACSS2 152 79908 0.00190219 39954 2 0.0032482
20-33508369-A-G p.Met347Val missense ACSS2 1 79954 1.25072E-5 39977 0 3.98448E-6
20-33508369-A-T p.Met347Leu missense ACSS2 1 79954 1.25072E-5 39977 0 NA
20-33508374-C-G p.Leu348Leu synonymous ACSS2 2 79980 2.50063E-5 39990 0 NA
20-33508376-A-G p.Tyr349Cys missense ACSS2 2 79986 2.50044E-5 39993 0 8.2545E-6
20-33508395-G-A p.Lys355Lys synonymous ACSS2 47 79810 5.88899E-4 39905 0 0.0020141
20-33508399-G-A p.Val357Met missense ACSS2 1 79804 1.25307E-5 39902 0 3.98489E-6
20-33508425-G-A p.Val365Val synonymous ACSS2 1 79324 1.26065E-5 39662 0 NA
20-33508436-C-T p.Thr369Met missense ACSS2 1 78936 1.26685E-5 39468 0 8.25614E-6
20-33508437-G-C p.Thr369Thr synonymous ACSS2 8 78858 1.01448E-4 39429 0 9.55597E-5
20-33508437-G-A p.Thr369Thr synonymous ACSS2 1 78862 1.26804E-5 39431 0 NA
20-33508442-A-G p.Asp371Gly missense ACSS2 1 78720 1.27033E-5 39360 0 NA
20-33508446-TG-T p.Gly373fs frameshift ACSS2 1 78636 1.27168E-5 39318 0 NA
20-33508448-G-A p.Gly373Asp missense ACSS2 1 78502 1.27385E-5 39251 0 NA
20-33508453-A-G p.Ile375Val missense ACSS2 2 78386 2.55148E-5 39193 0 NA
20-33508457-C-T p.Thr376Ile missense ACSS2 4 78374 5.10373E-5 39187 0 NA
20-33508470-C-T p.Tyr380Tyr synonymous ACSS2 2 78006 2.56391E-5 39003 0 1.66262E-5
20-33508471-G-A p.Val381Ile missense ACSS2 3 77956 3.84832E-5 38978 0 1.91119E-4
20-33508486-C-T p.Leu386Leu synonymous ACSS2 3 77864 3.85287E-5 38932 0 NA
20-33508498-G-C p.Ala390Pro missense ACSS2 1 77624 1.28826E-5 38812 0 8.474E-6
20-33508505-G-A p.Ser392Asn missense ACSS2 1 77564 1.28926E-5 38782 0 1.70558E-5
20-33508511-T-C p.Leu394Ser missense+splice_region ACSS2 1 77472 1.29079E-5 38736 0 1.21794E-5
20-33508520-G-A c.1182+8G>A splice_region ACSS2 1 77244 1.2946E-5 38622 0 8.63841E-6
20-33508803-G-A c.1183-6G>A splice_region ACSS2 1 80894 1.23619E-5 40447 0 NA
20-33508807-A-G c.1183-2A>G splice_acceptor ACSS2 1 80896 1.23616E-5 40448 0 NA
20-33508826-A-G p.Thr400Thr synonymous ACSS2 3080 80848 0.0380962 40424 347 0.081132
20-33508829-T-G p.Tyr401* stop_gained ACSS2 1 80888 1.23628E-5 40444 0 8.23927E-6
20-33508831-C-T p.Pro402Leu missense ACSS2 1 80898 1.23612E-5 40449 0 3.18878E-5
20-33508832-G-A p.Pro402Pro synonymous ACSS2 2 80884 2.47268E-5 40442 0 6.25E-4
20-33508836-G-A p.Val404Met missense ACSS2 2 80880 2.4728E-5 40440 0 8.23778E-6
20-33508840-A-G p.Asn405Ser missense ACSS2 2 80866 2.47323E-5 40433 0 3.97864E-6
20-33508842-C-T p.Arg406Cys missense ACSS2 1 80860 1.23671E-5 40430 0 8.23723E-6
20-33508843-G-T p.Arg406Leu missense ACSS2 1 80838 1.23704E-5 40419 0 NA
20-33508843-G-A p.Arg406His missense ACSS2 1 80838 1.23704E-5 40419 0 8.23737E-6
20-33508854-A-C p.Ile410Leu missense ACSS2 2 80814 2.47482E-5 40407 0 3.1955E-5
20-33508855-T-C p.Ile410Thr missense ACSS2 1 80812 1.23744E-5 40406 0 1.64734E-5
20-33508863-A-G p.Lys413Glu missense ACSS2 1 80778 1.23796E-5 40389 0 NA
20-33508864-A-T p.Lys413Ile missense ACSS2 1 80776 1.23799E-5 40388 0 NA
20-33508872-G-A p.Val416Met missense ACSS2 1 80730 1.2387E-5 40365 0 NA
20-33508876-C-A p.Thr417Asn missense ACSS2 4 80704 4.95638E-5 40352 0 1.27527E-4
20-33508891-C-T p.Ala422Val missense ACSS2 1 80674 1.23956E-5 40337 0 NA
20-33508897-C-T p.Thr424Ile missense ACSS2 3 80680 3.71839E-5 40340 0 1.99007E-5
20-33508901-C-T p.Ala425Ala synonymous ACSS2 1 80692 1.23928E-5 40346 0 NA
20-33508906-G-A p.Arg427His missense ACSS2 3 80694 3.71775E-5 40347 0 3.18593E-5
20-33508914-A-T p.Met430Leu missense ACSS2 1 80734 1.23864E-5 40367 0 2.47117E-5
20-33508929-G-A p.Glu435Lys missense ACSS2 2 80772 2.47611E-5 40386 0 1.98976E-5
20-33508934-T-C p.Pro436Pro synonymous ACSS2 3 80778 3.71388E-5 40389 0 1.27429E-4
20-33508949-C-A c.1316+7C>A splice_region ACSS2 1 80820 1.23732E-5 40410 0 3.98004E-6
20-33508950-C-G c.1316+8C>G splice_region ACSS2 1 80830 1.23716E-5 40415 0 NA
20-33509126-G-T c.1317-7G>T splice_region ACSS2 1 80736 1.2386E-5 40368 0 3.98762E-6
20-33509132-G-C c.1317-1G>C splice_acceptor ACSS2 2 80718 2.47776E-5 40359 0 NA
20-33509140-C-A p.Arg442Arg synonymous ACSS2 1 80710 1.239E-5 40355 0 3.5856E-5
20-33509140-C-T p.Arg442Trp missense ACSS2 1 80710 1.239E-5 40355 0 3.18492E-5
20-33509142-GGCATCCTT-G p.Ser444fs frameshift ACSS2 1 80702 1.23913E-5 40351 0 NA
20-33509147-C-A p.Ser444Tyr missense ACSS2 1 80662 1.23974E-5 40331 0 1.59304E-5
20-33509155-G-T p.Val447Leu missense ACSS2 1 80636 1.24014E-5 40318 0 NA
20-33509188-G-C p.Glu458Gln missense ACSS2 2 80532 2.48348E-5 40266 0 NA
20-33509195-G-A p.Trp460* stop_gained ACSS2 2 80526 2.48367E-5 40263 0 8.24022E-6
20-33509199-A-G p.Leu461Leu synonymous ACSS2 1 80528 1.2418E-5 40264 0 1.99027E-5
20-33509209-C-T p.Arg465Trp missense ACSS2 1 80536 1.24168E-5 40268 0 3.29614E-5
20-33509210-G-A p.Arg465Gln missense ACSS2 1 80544 1.24156E-5 40272 0 0.00100705
20-33509219-G-A p.Gly468Asp missense ACSS2 1 80592 1.24082E-5 40296 0 NA
20-33509224-C-G p.Gln470Glu missense ACSS2 1 80606 1.2406E-5 40303 0 3.98064E-6
20-33509224-C-T p.Gln470* stop_gained ACSS2 1 80606 1.2406E-5 40303 0 3.98064E-6
20-33509227-C-T p.Arg471Cys missense ACSS2 8 80614 9.92383E-5 40307 0 7.96153E-5
20-33509233-C-A p.Pro473Thr missense ACSS2 1 80660 1.23977E-5 40330 0 7.96121E-6
20-33509238-C-T p.Ile474Ile synonymous ACSS2 5 80708 6.19517E-5 40354 0 0.00100705
20-33509239-G-A p.Val475Met missense ACSS2 1 80714 1.23894E-5 40357 0 5.17409E-5
20-33509246-CCTT-C p.Phe478del disruptive_inframe_deletion ACSS2 1 80728 1.23873E-5 40364 0 NA
20-33509258-CAG-C p.Glu482fs frameshift ACSS2 2 80820 2.47464E-5 40410 0 NA
20-33509265-AGTGAGTGAAGGGTACAGAAGGCTGGGGCCCAGGGACAATGTGGGAAGATTGACTCAAATTTCTCATCTCTGACTTCCCCAG-A c.1449+1_1450-1delGTGAGTGAAGGGTACAGAAGGCTGGGGCCCAGGGACAATGTGGGAAGATTGACTCAAATTTCTCATCTCTGACTTCCCCAG splice_acceptor ACSS2 7 80846 8.65844E-5 40423 0 NA
20-33509341-C-G c.1450-6C>G splice_region ACSS2 13 80916 1.6066E-4 40458 0 1.64731E-5
20-33509347-G-C p.Gly484Arg missense+splice_region ACSS2 2 80900 2.47219E-5 40450 0 NA
20-33509351-G-A p.Gly485Asp missense ACSS2 1 80880 1.2364E-5 40440 0 4.37644E-5
20-33509356-A-G p.Met487Val missense ACSS2 1 80842 1.23698E-5 40421 0 8.23655E-6
20-33509364-T-C p.Thr489Thr synonymous ACSS2 1 80786 1.23784E-5 40393 0 NA
20-33509366-C-G p.Pro490Arg missense ACSS2 3 80790 3.71333E-5 40395 0 4.94193E-5
20-33509373-T-C p.Pro492Pro synonymous ACSS2 1 80742 1.23851E-5 40371 0 NA
20-33509377-G-A p.Ala494Thr missense ACSS2 12 80724 1.48655E-4 40362 0 0.00100705
20-33509394-C-T p.Pro499Pro synonymous ACSS2 13 80608 1.61274E-4 40304 0 2.42832E-4
20-33509395-G-A p.Gly500Ser missense ACSS2 1 80610 1.24054E-5 40305 0 3.18492E-5
20-33509410-G-A c.1506+7G>A splice_region ACSS2 1 80546 1.24153E-5 40273 0 NA
20-33509582-C-T c.1507-7C>T splice_region ACSS2 1 81054 1.23375E-5 40527 0 NA
20-33509590-C-T p.Thr503Ile missense+splice_region ACSS2 1 81068 1.23353E-5 40534 0 NA
20-33509605-G-A p.Gly508Asp missense ACSS2 1 81082 1.23332E-5 40541 0 3.9814E-6
20-33509607-G-A p.Val509Ile missense ACSS2 1 81082 1.23332E-5 40541 0 5.03525E-4
20-33509608-T-C p.Val509Ala missense ACSS2 84 81084 0.00103596 40542 0 0.00232038
20-33509632-C-A p.Ser517Tyr missense ACSS2 1 81088 1.23323E-5 40544 0 1.65216E-5
20-33509633-C-G p.Ser517Ser synonymous ACSS2 3 81086 3.69978E-5 40543 0 NA
20-33509651-T-A p.Gly523Gly synonymous ACSS2 1 81092 1.23317E-5 40546 0 NA
20-33509655-G-A p.Ala525Thr missense ACSS2 34 81094 4.19267E-4 40547 0 6.68832E-4
20-33509675-G-A c.1587+6G>A splice_region ACSS2 2 81040 2.46792E-5 40520 0 3.18552E-5
20-33511122-C-T c.1588-4C>T splice_region ACSS2 2 80724 2.47758E-5 40362 0 8.33611E-6
20-33511125-G-C c.1588-1G>C splice_acceptor ACSS2 1 80752 1.23836E-5 40376 0 8.31794E-6
20-33511137-G-A p.Ser129Asn missense ACSS2 3 80844 3.71085E-5 40422 0 NA
20-33511141-T-C p.Trp535Arg missense ACSS2 1 80876 1.23646E-5 40438 0 NA
20-33511143-G-C p.Trp535Cys missense ACSS2 1 80868 1.23658E-5 40434 0 NA
20-33511153-A-G p.Met539Val missense ACSS2 1 80918 1.23582E-5 40459 0 NA
20-33511157-G-A p.Arg540His missense ACSS2 3 80924 3.70718E-5 40462 0 2.47684E-5
20-33511160-C-A p.Thr541Lys missense ACSS2 1 80924 1.23573E-5 40462 0 3.97757E-6
20-33511162-G-A p.Val542Ile missense ACSS2 83 80938 0.00102548 40469 0 6.4433E-4
20-33511170-G-A p.Gly140Glu missense ACSS2 3 80946 3.70617E-5 40473 0 6.37064E-5
20-33511176-C-T p.Thr142Met missense ACSS2 5 80950 6.17665E-5 40475 0 3.18205E-5
20-33511177-G-A p.Glu547Lys missense ACSS2 6 80948 7.41217E-5 40474 0 3.18471E-5
20-33511180-C-T p.Arg548Cys missense ACSS2 1 80946 1.23539E-5 40473 0 9.55353E-5
20-33511182-C-T p.Ala144Val missense ACSS2 1 80936 1.23554E-5 40468 0 3.97747E-6
20-33511189-A-T p.Thr551Ser missense ACSS2 2 80932 2.47121E-5 40466 0 0.00151057
20-33511194-C-G p.Pro148Arg missense ACSS2 1 80926 1.2357E-5 40463 0 NA
20-33511203-G-C p.Lys555Asn missense ACSS2 1 80898 1.23612E-5 40449 0 NA
20-33511224-T-C p.Leu158Ser missense ACSS2 4 80764 4.9527E-5 40382 0 1.69566E-5
20-33511235-G-GCTGCCAGCGGGACCAGGATGGCTATTACTGGATCACTGGCAGGATTGA c.1696+1_1696+2insCTGCCAGCGGGACCAGGATGGCTATTACTGGATCACTGGCAGGATTGA splice_donor ACSS2 2 80658 2.47961E-5 40329 1 NA
20-33511237-G-A c.1696+3G>A splice_region ACSS2 1 80644 1.24002E-5 40322 0 NA
20-33511241-C-G c.1696+7C>G splice_region ACSS2 1 80576 1.24106E-5 40288 0 NA
20-33513507-A-G p.Gln568Arg missense ACSS2 1 80760 1.23824E-5 40380 0 NA
20-33513510-G-A p.Arg569Gln missense ACSS2 1 80772 1.23805E-5 40386 0 1.92526E-5
20-33513514-C-T p.Thr166Ile missense ACSS2 1 80792 1.23775E-5 40396 0 NA
20-33513537-C-T p.Thr578Ile missense ACSS2 6 80826 7.42335E-5 40413 0 6.37064E-5
20-33513546-T-C p.Ile581Thr missense ACSS2 1 80752 1.23836E-5 40376 0 2.81801E-5
20-33513553-C-T p.Thr179Ile missense ACSS2 1 80742 1.23851E-5 40371 0 6.37146E-5
20-33513554-A-T p.Met584Leu missense ACSS2 3 80742 3.71554E-5 40371 0 9.49668E-6
20-33513559-CAATGT-C p.Asn586fs frameshift ACSS2 1 80710 1.239E-5 40355 0 NA
20-33513566-T-TC p.Gly589fs frameshift ACSS2 1 80674 1.23956E-5 40337 0 NA
20-33513570-G-GACACCTGC c.1765+1_1765+2insACACCTGC splice_donor ACSS2 2 80632 2.4804E-5 40316 0 NA
20-33513570-G-GACACCTGCTGAGTACAGCAGAGGTGGAGTCAGCACTTGTGGAACA c.1765+1_1765+2insACACCTGCTGAGTACAGCAGAGGTGGAGTCAGCACTTGTGGAACA splice_donor ACSS2 2 80630 2.48047E-5 40315 1 NA
20-33513572-G-A c.1765+3G>A splice_region ACSS2 3 80596 3.72227E-5 40298 0 1.01634E-5
20-33513572-G-T c.1765+3G>T splice_region ACSS2 2 80594 2.48157E-5 40297 0 3.18776E-5
20-33513904-C-A c.1766-4C>A splice_region ACSS2 1 80796 1.23769E-5 40398 0 1.19414E-5
20-33513920-G-A p.Ser593Asn missense ACSS2 1 80872 1.23652E-5 40436 0 8.23927E-6
20-33513927-A-G p.Ala595Ala synonymous ACSS2 1 80864 1.23664E-5 40432 0 NA
20-33513936-G-A p.Glu598Glu synonymous ACSS2 1 80874 1.23649E-5 40437 0 NA
20-33513939-A-G p.Ser599Ser synonymous ACSS2 17 80870 2.10214E-4 40435 0 0.00100705
20-33513943-C-T p.Leu601Phe missense ACSS2 1 80872 1.23652E-5 40436 0 3.97798E-6
20-33513955-G-A p.Glu605Lys missense ACSS2 1 80864 1.23664E-5 40432 0 3.97807E-6
20-33513957-G-A p.Glu605Glu synonymous ACSS2 2 80842 2.47396E-5 40421 0 3.18471E-5
20-33513961-G-A p.Val607Ile missense ACSS2 4 80832 4.94854E-5 40416 0 2.47133E-5
20-33513965-C-G p.Ala608Gly missense ACSS2 5 80804 6.18781E-5 40402 0 3.29527E-5
20-33513965-C-CA p.Glu609fs frameshift ACSS2 1 80804 1.23756E-5 40402 0 NA
20-33513983-G-C p.Gly614Ala missense ACSS2 1347 80622 0.0167076 40311 61 0.0340047
20-33514001-A-G p.Lys620Arg missense ACSS2 2 80502 2.48441E-5 40251 0 NA
20-33514004-G-T p.Gly621Val missense ACSS2 3 80446 3.72921E-5 40223 0 3.18492E-5
20-33514030-T-C p.Leu630Leu synonymous ACSS2 3 79660 3.76601E-5 39830 0 6.37471E-5
20-33514055-C-G p.Pro638Arg missense ACSS2 1 77910 1.28353E-5 38955 0 6.37349E-5
20-33514065-C-T p.Thr641Thr synonymous ACSS2 28 76762 3.64764E-4 38381 0 6.05327E-4
20-33514065-CGAG-C p.Glu643del conservative_inframe_deletion ACSS2 8 76764 1.04216E-4 38382 0 0.00201613
20-33514681-TAGAGA-T p.Arg649fs frameshift ACSS2 1 81064 1.23359E-5 40532 0 NA
20-33514692-T-C p.Ile652Thr missense ACSS2 1 81082 1.23332E-5 40541 0 7.9533E-6
20-33514695-G-GC p.Ile655fs frameshift ACSS2 1 81086 1.23326E-5 40543 0 NA
20-33514748-C-T p.Arg671Cys missense ACSS2 3 81070 3.70051E-5 40535 0 2.38618E-5
20-33514749-G-A p.Arg671His missense ACSS2 16 81068 1.97365E-4 40534 0 2.86661E-4
20-33514751-TCAGGTATGTTCAGAGGCCTCCATGGATTGGGATGGGCTGAGGCCTGGTGGTGGTGGGGTGTGCGTGGATGAAAGCCTTTGGCAGGGCTAGGGTGGGTCAGTGCTTTCACCAAGTAACTAGAGGTCTGTGGTTCCC-T p.Ser672_Gly673delinsTrp splice_donor ACSS2 6 81072 7.40083E-5 40536 0 NA
20-33514755-G-T c.2017+1G>T splice_donor ACSS2 1 81074 1.23344E-5 40537 0 NA
20-33514882-T-C c.2018-8T>C splice_region ACSS2 3 81034 3.70215E-5 40517 0 3.19061E-5
20-33514890-G-T p.Gly673Val missense+splice_region ACSS2 1 81052 1.23378E-5 40526 0 8.23683E-6
20-33514900-G-A p.Met676Ile missense ACSS2 1 81064 1.23359E-5 40532 0 8.23655E-6
20-33514905-G-A p.Arg678Gln missense ACSS2 5 81060 6.16827E-5 40530 0 9.56511E-5
20-33514913-C-T p.Arg681Trp missense ACSS2 2 81058 2.46737E-5 40529 0 9.56572E-5
20-33514914-G-A p.Arg681Gln missense ACSS2 2 81062 2.46725E-5 40531 0 2.47093E-5
20-33514919-A-T p.Ile683Phe missense ACSS2 1 81060 1.23365E-5 40530 0 1.19296E-5
20-33514941-T-G p.Leu690Arg missense ACSS2 1 81056 1.23371E-5 40528 0 NA
20-33514942-C-T p.Leu690Leu synonymous ACSS2 1 81062 1.23362E-5 40531 0 1.19289E-5
20-33514943-G-A p.Gly691Arg missense ACSS2 2 81058 2.46737E-5 40529 0 6.37755E-5
20-33514945-G-T p.Gly691Gly synonymous ACSS2 1 81054 1.23375E-5 40527 0 NA
20-33514977-T-C p.Ile702Thr missense ACSS2 2 81004 2.46901E-5 40502 0 8.23723E-6
20-33514984-C-T p.His704His synonymous ACSS2 19 80988 2.34603E-4 40494 0 9.56084E-5
20-33514997-C-T p.Arg709Cys missense ACSS2 18 80956 2.22343E-4 40478 0 5.41781E-4
20-33514998-G-A p.Arg709His missense ACSS2 1 80958 1.23521E-5 40479 0 4.11929E-5