Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
20-24987539-A-G p.Phe562Ser missense ACSS1 2 36222 5.52151E-5 18111 0 NA
20-24987549-C-T p.Val559Ile missense ACSS1 1 36230 2.76014E-5 18115 0 7.66084E-6
20-24987558-G-T p.Leu556Ile missense ACSS1 8 36230 2.20811E-4 18115 0 2.54712E-4
20-24987559-T-C p.Ile555Met missense+splice_region ACSS1 1 36230 2.76014E-5 18115 0 4.2904E-4
20-24987561-T-C p.Ile555Val missense+splice_region ACSS1 2 36228 5.52059E-5 18114 0 NA
20-24987565-G-A c.1663-4C>T splice_region ACSS1 1 36226 2.76045E-5 18113 0 9.2885E-5
20-24988406-C-T p.Ala688Thr missense ACSS1 8 83280 9.60615E-5 41640 0 6.37267E-5
20-24988419-G-C p.Asp683Glu missense ACSS1 2 83314 2.40056E-5 41657 0 NA
20-24988421-C-T p.Asp683Asn missense ACSS1 1 83316 1.20025E-5 41658 0 6.25E-4
20-24988426-C-A p.Cys681Phe missense ACSS1 1 83312 1.20031E-5 41656 0 5.03525E-4
20-24988428-C-T p.Lys680Lys synonymous ACSS1 1 83322 1.20016E-5 41661 0 NA
20-24988441-C-G p.Ser676Thr missense ACSS1 1 83342 1.19988E-5 41671 0 3.97766E-6
20-24988445-G-A p.Leu675Leu synonymous ACSS1 8 83326 9.60085E-5 41663 0 4.11963E-5
20-24988454-C-T p.Ala672Thr missense ACSS1 10 83330 1.20005E-4 41665 0 6.37349E-5
20-24988455-G-A p.Ile671Ile synonymous ACSS1 5 83328 6.00038E-5 41664 0 6.25E-4
20-24988462-C-G p.Ser669Thr missense ACSS1 6 83338 7.1996E-5 41669 0 1.67022E-4
20-24988471-T-G p.Glu666Ala missense ACSS1 1 83330 1.20005E-5 41665 0 NA
20-24988472-C-T p.Glu666Lys missense ACSS1 1 83324 1.20013E-5 41662 0 NA
20-24988474-A-C p.Leu665Trp missense ACSS1 1 83328 1.20008E-5 41664 0 3.97649E-6
20-24988475-A-G p.Leu665Leu synonymous ACSS1 1 83316 1.20025E-5 41658 0 5.76597E-5
20-24988479-G-C p.Thr663Thr synonymous ACSS1 1 83320 1.20019E-5 41660 0 NA
20-24988503-C-T p.Glu655Glu synonymous ACSS1 7 83308 8.40255E-5 41654 0 2.23044E-4
20-24988506-A-G p.Ser654Ser synonymous ACSS1 26 83308 3.12095E-4 41654 0 5.73687E-4
20-24988507-C-T p.Ser654Asn missense ACSS1 2 83314 2.40056E-5 41657 1 NA
20-24988512-G-A p.Ile652Ile synonymous ACSS1 68 83314 8.16189E-4 41657 1 0.00125
20-24988515-G-A p.Ile651Ile synonymous ACSS1 1 83312 1.20031E-5 41656 0 NA
20-24988522-C-T p.Arg649Lys missense ACSS1 2 83302 2.4009E-5 41651 0 3.18573E-5
20-24988524-C-T p.Leu648Leu synonymous ACSS1 12 83296 1.44065E-4 41648 0 1.27445E-4
20-24988534-C-T p.Arg645Gln missense ACSS1 8 83284 9.60569E-5 41642 0 1.27429E-4
20-24988535-G-A p.Arg645Trp missense ACSS1 1 83286 1.20068E-5 41643 0 3.18654E-5
20-24988544-T-TC p.Lys642fs frameshift ACSS1 1 83274 1.20085E-5 41637 0 NA
20-24988555-G-A p.Thr638Ile missense ACSS1 2 83222 2.40321E-5 41611 0 NA
20-24988568-G-A p.Arg634Cys missense ACSS1 1 83048 1.20412E-5 41524 0 1.59482E-5
20-24988582-C-G c.1891-5G>C splice_region ACSS1 1 82860 1.20685E-5 41430 0 NA
20-24989909-G-T p.Ile629Ile synonymous ACSS1 1 83172 1.20233E-5 41586 0 8.24131E-6
20-24989919-G-A p.Pro626Leu missense ACSS1 1 83208 1.20181E-5 41604 0 8.2394E-6
20-24989921-C-A p.Val625Val synonymous ACSS1 7 83236 8.40982E-5 41618 0 3.1839E-5
20-24989933-G-A p.Ala621Ala synonymous ACSS1 1 83264 1.201E-5 41632 0 2.4715E-5
20-24989935-C-T p.Ala621Thr missense ACSS1 1 83258 1.20109E-5 41629 0 1.64769E-5
20-24989936-G-A p.Ile620Ile synonymous ACSS1 1 83264 1.201E-5 41632 0 5.03525E-4
20-24989942-G-A p.Thr618Thr synonymous ACSS1 5 83274 6.00428E-5 41637 0 9.88533E-5
20-24989979-T-G p.Asp606Ala missense ACSS1 1 83296 1.20054E-5 41648 0 NA
20-24989986-C-G p.Asp604His missense ACSS1 1 83288 1.20065E-5 41644 0 NA
20-24989990-C-T p.Ala602Ala synonymous ACSS1 6 83278 7.20478E-5 41639 0 1.98829E-5
20-24989991-G-A p.Ala602Val missense ACSS1 1 83286 1.20068E-5 41643 0 1.98829E-5
20-24990003-A-C p.Val598Gly missense ACSS1 1 83244 1.20129E-5 41622 0 NA
20-24990006-A-C p.Val597Gly missense ACSS1 3 83232 3.60438E-5 41616 0 6.36902E-5
20-24990010-T-C p.Ile596Val missense ACSS1 1 83224 1.20158E-5 41612 0 NA
20-24990020-G-C p.Ala592Ala synonymous ACSS1 1 83180 1.20221E-5 41590 0 NA
20-24993238-T-A p.Glu590Asp missense+splice_region ACSS1 3 83306 3.60118E-5 41653 0 1.64772E-5
20-24993245-T-C p.Lys588Arg missense ACSS1 1 83300 1.20048E-5 41650 0 8.23805E-6
20-24993252-C-T p.Asp586Asn missense ACSS1 30 83300 3.60144E-4 41650 0 0.00105116
20-24993253-G-A p.His585His synonymous ACSS1 3 83308 3.60109E-5 41654 0 4.11868E-5
20-24993262-G-C p.Gly582Gly synonymous ACSS1 1 83322 1.20016E-5 41661 0 8.23696E-6
20-24993268-G-A p.Val580Val synonymous ACSS1 1 83336 1.19996E-5 41668 0 NA
20-24993297-C-T p.Asp571Asn missense ACSS1 4 83338 4.79973E-5 41669 0 5.04541E-4
20-24993298-G-A p.Ala570Ala splice_region+synonymous ACSS1 3 83340 3.59971E-5 41670 0 0.00100806
20-24993302-T-G c.1708-2A>C splice_acceptor ACSS1 1 83324 1.20013E-5 41662 0 3.97753E-6
20-24993303-G-A c.1708-3C>T splice_region ACSS1 1 83322 1.20016E-5 41661 0 NA
20-24993448-G-A p.Ile569Ile splice_region+synonymous ACSS1 2 83218 2.40333E-5 41609 0 7.96362E-6
20-24993453-C-T p.Ala568Thr missense ACSS1 1 83212 1.20175E-5 41606 0 8.25314E-6
20-24993454-G-A p.Asp567Asp synonymous ACSS1 4 83218 4.80665E-5 41609 0 4.12528E-5
20-24993456-C-T p.Asp567Asn missense ACSS1 1 83236 1.2014E-5 41618 0 NA
20-24993468-C-T p.Ala563Thr missense ACSS1 2 83206 2.40367E-5 41603 0 2.47345E-5
20-24993469-G-C p.Thr562Thr synonymous ACSS1 1 83218 1.20166E-5 41609 0 NA
20-24993472-C-T p.Gly561Gly synonymous ACSS1 1 83254 1.20114E-5 41627 0 NA
20-24993479-C-T p.Arg559Gln missense ACSS1 1 83276 1.20083E-5 41638 0 8.24049E-6
20-24993480-G-A p.Arg559Trp missense ACSS1 4 83280 4.80307E-5 41640 0 1.64802E-5
20-24993503-T-A p.Asp551Val missense ACSS1 1 83314 1.20028E-5 41657 0 8.23791E-6
20-24993515-C-T p.Gly547Glu missense ACSS1 1 83316 1.20025E-5 41658 0 NA
20-24993524-TG-T p.Gln544fs frameshift ACSS1 2 83310 2.40067E-5 41655 0 NA
20-24993526-G-C p.Tyr543* stop_gained ACSS1 2 83314 2.40056E-5 41657 0 NA
20-24993530-T-C p.Tyr542Cys missense ACSS1 2 83322 2.40033E-5 41661 0 3.18127E-5
20-24993534-C-T p.Gly541Ser missense ACSS1 1 83318 1.20022E-5 41659 0 3.97665E-6
20-24993535-G-A p.Gly540Gly synonymous ACSS1 2 83312 2.40061E-5 41656 0 3.18756E-5
20-24993545-C-T p.Arg537Gln missense ACSS1 2 83312 2.40061E-5 41656 0 7.95374E-6
20-24993551-G-A p.Ala535Val missense ACSS1 1 83308 1.20036E-5 41654 0 1.19305E-5
20-24993556-G-A p.Asp533Asp synonymous ACSS1 6 83286 7.20409E-5 41643 0 2.38616E-5
20-24993578-G-GGGTAGGCCTTGAAGTAGGCGTC c.1580-4_1580-3insGACGCCTACTTCAAGGCCTACC splice_region ACSS1 1 83246 1.20126E-5 41623 0 NA
20-24993581-C-T c.1580-6G>A splice_region ACSS1 1 83232 1.20146E-5 41616 0 NA
20-24993582-C-T c.1580-7G>A splice_region ACSS1 1 83222 1.20161E-5 41611 0 7.9602E-6
20-24994177-T-A p.Tyr525Phe missense ACSS1 1 83038 1.20427E-5 41519 0 4.01577E-6
20-24994191-G-C p.Ala520Ala synonymous ACSS1 1 82986 1.20502E-5 41493 0 NA
20-24994193-C-T p.Ala520Thr missense ACSS1 1 82946 1.2056E-5 41473 0 3.18573E-5
20-24994194-G-A p.Asp519Asp synonymous ACSS1 12 82942 1.44679E-4 41471 0 1.27437E-4
20-24994195-T-C p.Asp519Gly missense ACSS1 1 82930 1.20584E-5 41465 0 3.99869E-6
20-24994196-C-T p.Asp519Asn missense ACSS1 2 82938 2.41144E-5 41469 0 NA
20-24994199-C-T p.Val518Met missense ACSS1 1 82904 1.20621E-5 41452 0 8.42134E-6
20-24994199-C-A p.Val518Leu missense ACSS1 1 82904 1.20621E-5 41452 0 3.99878E-6
20-24994211-G-C p.His514Asp missense ACSS1 2 82762 2.41657E-5 41381 0 4.00365E-6
20-24994215-G-A p.Gly512Gly synonymous ACSS1 5 82684 6.04712E-5 41342 0 4.41299E-5
20-24994240-G-A p.Pro504Leu missense ACSS1 2 82534 2.42324E-5 41267 0 3.19714E-5
20-24994254-G-C p.Ile499Met missense ACSS1 1 82468 1.21259E-5 41234 0 1.68597E-5
20-24994266-C-G p.Gly495Gly synonymous ACSS1 1 82302 1.21504E-5 41151 0 3.20102E-5
20-24994268-C-G p.Gly495Arg missense ACSS1 1 82288 1.21524E-5 41144 0 NA
20-24994268-C-T p.Gly495Arg missense ACSS1 4 82288 4.86098E-5 41144 0 NA
20-24994269-G-A p.Ser494Ser synonymous ACSS1 7 82300 8.50547E-5 41150 0 0.00151668
20-24994274-C-T p.Val493Ile missense ACSS1 8 82280 9.7229E-5 41140 0 2.53126E-5
20-24994275-G-A p.Asn492Asn synonymous ACSS1 7414 81748 0.0906933 40874 340 0.102123
20-24994275-G-C p.Asn492Lys missense ACSS1 2 82262 2.43126E-5 41131 0 5.06022E-5
20-24994283-C-G p.Gly490Arg missense ACSS1 3 82108 3.65372E-5 41054 0 NA
20-24994289-C-T p.Val488Met missense ACSS1 15168 80962 0.187347 40481 1448 0.209726
20-24994292-C-T p.Val487Ile missense ACSS1 9 81918 1.09866E-4 40959 0 1.59408E-4
20-24994293-G-A p.Ser486Ser synonymous ACSS1 620 81720 0.00758688 40860 17 0.0182114
20-24994300-T-TTCTCATCCATGAGGACGGGGACGATGCCAAAGAAGGGCCTCATC c.1453-3_1453-2insGATGAGGCCCTTCTTTGGCATCGTCCCCGTCCTCATGGATGAGA splice_region ACSS1 2 81706 2.4478E-5 40853 1 NA
20-24994300-T-TTCTCATCCATGAGGACGGGGACGATGCCAAAGAAGG c.1453-3_1453-2insCCTTCTTTGGCATCGTCCCCGTCCTCATGGATGAGA splice_region ACSS1 2 81706 2.4478E-5 40853 1 NA
20-24994592-C-T c.1452+5G>A splice_region ACSS1 217 81402 0.00266578 40701 1 0.0045932
20-24994594-C-T c.1452+3G>A splice_region ACSS1 1 81524 1.22663E-5 40762 0 3.18451E-5
20-24994597-C-T p.Lys484Lys splice_region+synonymous ACSS1 1 81650 1.22474E-5 40825 0 4.01113E-6
20-24994611-G-T p.Leu480Ile missense ACSS1 4 82020 4.87686E-5 41010 0 1.7963E-5
20-24994614-C-T p.Val479Ile missense ACSS1 623 81998 0.00759775 40999 12 0.0167173
20-24994615-G-A p.Pro478Pro synonymous ACSS1 92 82102 0.00112056 41051 0 0.00210271
20-24994621-G-A p.Ile476Ile synonymous ACSS1 1 82224 1.21619E-5 41112 0 NA
20-24994624-G-A p.Gly475Gly synonymous ACSS1 1 82292 1.21518E-5 41146 0 0.00101215
20-24994625-C-G p.Gly475Ala missense ACSS1 1 82270 1.21551E-5 41135 0 NA
20-24994632-A-T p.Phe473Ile missense ACSS1 1 82380 1.21389E-5 41190 0 7.99111E-6
20-24994663-C-T p.Ala462Ala synonymous ACSS1 9 82222 1.0946E-4 41111 0 0.00125
20-24994664-G-A p.Ala462Val missense ACSS1 30 82188 3.65017E-4 41094 0 5.05561E-4
20-24994665-C-T p.Ala462Thr missense ACSS1 1 82204 1.21649E-5 41102 0 NA
20-24994675-C-T p.Ser458Ser synonymous ACSS1 2 82046 2.43766E-5 41023 0 1.21129E-5
20-24994676-G-A p.Ser458Leu missense ACSS1 1 82028 1.2191E-5 41014 0 1.59226E-4
20-24994682-C-T p.Arg456Gln missense ACSS1 2 81858 2.44326E-5 40929 0 1.91083E-4
20-24994683-G-A p.Arg456Trp missense ACSS1 16 81874 1.95422E-4 40937 0 8.68998E-5
20-24994686-G-A p.Pro455Ser missense ACSS1 2 81824 2.44427E-5 40912 0 1.11017E-5
20-24994689-C-T p.Ala454Thr missense ACSS1 10 81680 1.22429E-4 40840 0 1.24711E-4
20-24994690-G-A p.Ile453Ile synonymous ACSS1 2 81696 2.4481E-5 40848 0 4.11455E-5
20-24994704-C-A p.Gly449Cys missense ACSS1 1 81238 1.23095E-5 40619 0 NA
20-24995767-T-C c.1339+7A>G splice_region ACSS1 1 82980 1.20511E-5 41490 0 8.36946E-6
20-24995774-C-T p.Glu447Lys missense+splice_region ACSS1 1 83008 1.2047E-5 41504 0 NA
20-24995777-T-C p.Thr446Ala missense ACSS1 1 83012 1.20465E-5 41506 0 3.18715E-5
20-24995800-G-A p.Thr438Met missense ACSS1 2 83122 2.4061E-5 41561 0 2.39013E-5
20-24995806-C-T p.Arg436Lys missense ACSS1 3 83146 3.60811E-5 41573 0 8.27007E-6
20-24995811-G-A p.Asp434Asp synonymous ACSS1 3 83130 3.60881E-5 41565 0 6.37349E-5
20-24995820-C-G p.Val431Val synonymous ACSS1 2 83136 2.4057E-5 41568 0 2.38911E-5
20-24995841-G-A p.Ala424Ala synonymous ACSS1 1 83232 1.20146E-5 41616 0 NA
20-24995865-C-T p.Val416Val splice_region+synonymous ACSS1 1 83200 1.20192E-5 41600 0 1.21191E-5
20-24995874-C-G c.1247-8G>C splice_region ACSS1 1 83162 1.20247E-5 41581 0 4.13158E-6
20-25000639-C-T c.1246+7G>A splice_region ACSS1 2 82812 2.41511E-5 41406 0 3.98581E-6
20-25000640-G-A c.1246+6C>T splice_region ACSS1 739 82798 0.00892534 41399 14 0.0182884
20-25000660-C-T p.Arg411Gln missense ACSS1 2 83066 2.40772E-5 41533 0 3.97858E-6
20-25000661-G-A p.Arg411Trp missense ACSS1 3 83062 3.61176E-5 41531 0 3.18532E-5
20-25000664-G-A p.Leu410Leu synonymous ACSS1 203 83138 0.00244172 41569 0 0.00855992
20-25000666-G-A p.Ser409Phe missense ACSS1 1 83148 1.20267E-5 41574 0 NA
20-25000673-G-A p.Arg407Cys missense ACSS1 1 83202 1.20189E-5 41601 0 1.19323E-5
20-25000683-C-T p.Lys403Lys synonymous ACSS1 633 83264 0.00760233 41632 1 0.00761195
20-25000699-C-T p.Gly398Asp missense ACSS1 1 83298 1.20051E-5 41649 0 NA
20-25000704-T-C p.Lys396Lys synonymous ACSS1 3 83314 3.60084E-5 41657 0 3.97633E-6
20-25000713-C-T p.Leu393Leu synonymous ACSS1 1 83330 1.20005E-5 41665 0 NA
20-25000715-G-A p.Leu393Leu synonymous ACSS1 2 83324 2.40027E-5 41662 0 3.9764E-6
20-25000719-G-A p.Val391Val synonymous ACSS1 1 83334 1.19999E-5 41667 0 NA
20-25000726-G-A p.Thr389Met missense ACSS1 1 83330 1.20005E-5 41665 0 1.64753E-5
20-25000733-C-T p.Ala387Thr missense ACSS1 2 83328 2.40015E-5 41664 0 4.11889E-5
20-25000734-G-A p.Gly386Gly synonymous ACSS1 8872 83168 0.106676 41584 542 0.123916
20-25000738-T-C p.Tyr385Cys missense ACSS1 1 83334 1.19999E-5 41667 0 3.18451E-5
20-25000743-C-T p.Gln383Gln synonymous ACSS1 6 83328 7.20046E-5 41664 0 NA
20-25000746-A-G p.Asn382Asn synonymous ACSS1 13 83336 1.55995E-4 41668 0 2.2293E-4
20-25000747-T-C p.Asn382Ser missense ACSS1 3 83332 3.60006E-5 41666 0 6.36983E-5
20-25000770-C-T p.Glu374Glu synonymous ACSS1 3 83314 3.60084E-5 41657 0 8.24008E-6
20-25000779-C-G p.Arg371Arg synonymous ACSS1 1 83292 1.2006E-5 41646 0 NA
20-25000781-GACC-G p.Gly370fs frameshift ACSS1 1 83286 1.20068E-5 41643 0 NA
20-25000784-C-CAGCATTGGGA c.1109-2_1109-1insTCCCAATGCT splice_acceptor ACSS1 2 83272 2.40177E-5 41636 1 NA
20-25002018-T-C c.1108+7A>G splice_region ACSS1 20 83180 2.40442E-4 41590 0 1.59195E-4
20-25002020-C-T c.1108+5G>A splice_region ACSS1 1 83188 1.2021E-5 41594 0 7.99348E-6
20-25002023-A-G c.1108+2T>C splice_donor ACSS1 4 83222 4.80642E-5 41611 0 6.37024E-5
20-25002061-C-T p.Val358Ile missense ACSS1 6 83308 7.20219E-5 41654 0 3.18573E-5
20-25002062-G-A p.Ser357Ser synonymous ACSS1 5 83320 6.00096E-5 41660 0 6.25E-4
20-25002063-C-T p.Ser357Asn missense ACSS1 1 83326 1.20011E-5 41663 0 8.28761E-6
20-25002064-T-C p.Ser357Gly missense ACSS1 1 83328 1.20008E-5 41664 0 NA
20-25002071-A-T p.Gly354Gly synonymous ACSS1 2 83340 2.39981E-5 41670 0 NA
20-25002082-G-A p.Leu351Phe missense ACSS1 4 83342 4.7995E-5 41671 0 9.15095E-5
20-25002090-T-A p.Tyr348Phe missense ACSS1 1 83350 1.19976E-5 41675 0 NA
20-25002098-G-A p.Tyr345Tyr synonymous ACSS1 25 83344 2.99962E-4 41672 0 5.41263E-4
20-25002119-A-G p.Gly338Gly synonymous ACSS1 1 83338 1.19993E-5 41669 0 NA
20-25002121-C-T p.Gly338Ser missense ACSS1 1 83330 1.20005E-5 41665 0 NA
20-25002122-G-A p.Ile337Ile synonymous ACSS1 7 83338 8.39953E-5 41669 0 7.95792E-5
20-25002127-C-T p.Asp336Asn missense ACSS1 1 83340 1.1999E-5 41670 0 3.18532E-5
20-25002138-C-A p.Gly332Val missense ACSS1 1 83326 1.20011E-5 41663 0 NA
20-25002144-A-G p.Ile330Thr missense ACSS1 1 83322 1.20016E-5 41661 0 1.59195E-5
20-25002157-G-A p.Gln326* stop_gained ACSS1 1 83280 1.20077E-5 41640 0 3.9853E-6
20-25002163-C-G p.Asp324His missense ACSS1 1 83240 1.20135E-5 41620 0 NA
20-25002165-AAC-A p.Phe323fs frameshift ACSS1 1 83236 1.2014E-5 41618 0 NA
20-25002168-A-C p.Val322Gly missense ACSS1 1 83228 1.20152E-5 41614 0 NA
20-25003590-C-T p.Ala316Thr missense ACSS1 2 80170 2.4947E-5 40085 0 3.61521E-5
20-25003591-G-A p.Ala315Ala synonymous ACSS1 24 80276 2.98969E-4 40138 0 6.69131E-4
20-25003597-G-C p.Leu313Leu synonymous ACSS1 122 80594 0.00151376 40297 0 0.00201816
20-25003597-G-A p.Leu313Leu synonymous ACSS1 1 80598 1.24073E-5 40299 0 3.44021E-5
20-25003641-C-T p.Gly299Arg missense ACSS1 2 81364 2.45809E-5 40682 0 NA
20-25003642-G-A p.Thr298Thr synonymous ACSS1 11 81310 1.35285E-4 40655 0 1.27389E-4
20-25003644-T-C p.Thr298Ala missense ACSS1 1 81384 1.22874E-5 40692 0 NA
20-25003669-G-A p.Leu289Leu synonymous ACSS1 5 81378 6.14417E-5 40689 0 6.36983E-5
20-25003673-A-T p.Met288Lys missense ACSS1 3 81320 3.68913E-5 40660 0 9.55779E-5
20-25003682-C-G p.Ser285Thr missense ACSS1 1 81300 1.23001E-5 40650 0 1.59507E-5
20-25003682-C-T p.Ser285Asn missense ACSS1 1 81300 1.23001E-5 40650 0 NA
20-25003693-C-T p.Glu281Glu synonymous ACSS1 5 80902 6.18032E-5 40451 0 1.11835E-4
20-25003701-C-T p.Ala279Thr missense ACSS1 16 80454 1.98871E-4 40227 0 1.68785E-4
20-25003705-A-C p.Val277Val synonymous ACSS1 2398 80362 0.02984 40181 49 0.0353455
20-25003708-A-C p.Pro276Pro synonymous ACSS1 2 80464 2.48558E-5 40232 0 3.18593E-5
20-25003733-C-A c.808-5G>T splice_region ACSS1 1 78800 1.26904E-5 39400 0 NA
20-25004097-C-A c.807+5G>T splice_region ACSS1 1 82954 1.20549E-5 41477 0 7.96464E-6
20-25004112-G-A p.Pro266Leu missense ACSS1 17 83154 2.0444E-4 41577 1 0.00100908
20-25004117-G-A p.Asp264Asp synonymous ACSS1 1 83204 1.20187E-5 41602 0 6.37633E-5
20-25004131-T-C p.Met260Val missense ACSS1 3 83282 3.60222E-5 41641 0 3.97814E-6
20-25004131-T-A p.Met260Leu missense ACSS1 3 83282 3.60222E-5 41641 0 3.97814E-6
20-25004136-A-C p.Val258Gly missense ACSS1 1 83282 1.20074E-5 41641 0 NA
20-25004138-C-A p.Lys257Asn missense ACSS1 1 83292 1.2006E-5 41646 0 3.18573E-5
20-25004155-G-A p.His252Tyr missense ACSS1 1 83302 1.20045E-5 41651 0 NA
20-25004176-C-T p.Val245Met missense ACSS1 43 83296 5.16231E-4 41648 0 6.0498E-4
20-25004177-G-A p.Thr244Thr synonymous ACSS1 8 83302 9.60361E-5 41651 0 6.76412E-5
20-25004195-A-G p.Ala238Ala synonymous ACSS1 1 83314 1.20028E-5 41657 0 NA
20-25004202-T-C p.Asp236Gly missense ACSS1 2 83314 2.40056E-5 41657 0 NA
20-25004210-T-C p.Lys233Lys synonymous ACSS1 1 83324 1.20013E-5 41662 0 NA
20-25004219-C-G p.Glu230Asp missense ACSS1 3 83334 3.59997E-5 41667 0 8.28665E-6
20-25004227-C-T p.Val228Met missense ACSS1 1 83310 1.20034E-5 41655 0 6.25E-4
20-25004228-G-A p.Arg227Arg synonymous ACSS1 1 83314 1.20028E-5 41657 0 6.64905E-5
20-25004229-C-T p.Arg227His missense ACSS1 19 83308 2.28069E-4 41654 0 0.00125
20-25004230-G-A p.Arg227Cys missense ACSS1 4 83310 4.80134E-5 41655 0 3.99259E-5
20-25004231-C-A p.Gly226Gly synonymous ACSS1 2 83306 2.40079E-5 41653 0 3.18532E-5
20-25004235-C-A p.Gly225Val missense ACSS1 1 83304 1.20042E-5 41652 0 NA
20-25004239-G-C p.Arg224Gly missense ACSS1 2 83308 2.40073E-5 41654 0 NA
20-25004239-G-A p.Arg224Trp missense ACSS1 1 83308 1.20036E-5 41654 0 3.18715E-5
20-25004248-G-A p.Gln221* stop_gained ACSS1 1 83298 1.20051E-5 41649 0 4.02573E-6
20-25004266-C-T p.Val215Met missense ACSS1 1 83238 1.20137E-5 41619 0 NA
20-25004272-A-G p.Cys213Arg missense ACSS1 1 83194 1.20201E-5 41597 0 8.29745E-6
20-25004277-G-A p.Ala211Val missense+splice_region ACSS1 1 83174 1.2023E-5 41587 0 4.19403E-6
20-25004280-AAC-A c.632-5_632-4delGT splice_region ACSS1 5 83142 6.01381E-5 41571 0 2.62559E-5
20-25004283-A-G c.632-6T>C splice_region ACSS1 1 83126 1.20299E-5 41563 0 NA
20-25011400-T-C p.Asn209Ser missense ACSS1 1 83158 1.20253E-5 41579 0 3.98051E-6
20-25011420-C-T p.Glu202Glu synonymous ACSS1 3 83186 3.60638E-5 41593 0 1.19326E-5
20-25011423-T-C p.Ala201Ala synonymous ACSS1 24383 82694 0.294858 41347 3641 0.332326
20-25011446-C-T p.Val194Ile missense ACSS1 1 83182 1.20218E-5 41591 0 NA
20-25011461-C-T p.Gly189Arg missense ACSS1 5 83140 6.01395E-5 41570 0 6.36902E-5
20-25011495-C-G p.Leu177Phe missense ACSS1 4 83216 4.80677E-5 41608 0 3.29864E-5
20-25011495-CA-C p.Leu177fs frameshift ACSS1 1 83216 1.20169E-5 41608 0 NA
20-25011506-C-T p.Val174Met missense ACSS1 2 83168 2.40477E-5 41584 0 6.36821E-5
20-25011507-G-A p.Pro173Pro synonymous ACSS1 1 83174 1.2023E-5 41587 0 1.59129E-5
20-25011508-G-A p.Pro173Leu missense ACSS1 2 83178 2.40448E-5 41589 0 3.97798E-6
20-25011513-G-A p.Tyr171Tyr synonymous ACSS1 1 83178 1.20224E-5 41589 0 NA
20-25011524-C-T p.Val168Ile missense ACSS1 1 83164 1.20244E-5 41582 0 3.1835E-5
20-25011525-A-G p.Arg167Arg synonymous ACSS1 4 83154 4.81035E-5 41577 0 8.27472E-6
20-25011528-G-T p.Asp166Glu missense ACSS1 2 83154 2.40518E-5 41577 0 6.25E-4
20-25011533-C-A p.Gly165Trp missense ACSS1 1 83152 1.20262E-5 41576 0 3.18431E-5
20-25011535-C-A p.Arg164Leu missense ACSS1 1 83126 1.20299E-5 41563 0 NA
20-25011540-G-C p.Val162Val synonymous ACSS1 1 83114 1.20317E-5 41557 0 3.1837E-5
20-25011545-C-T p.Gly161Arg missense ACSS1 1 83108 1.20325E-5 41554 0 8.31034E-6
20-25011549-C-T p.Arg159Arg synonymous ACSS1 1 83096 1.20343E-5 41548 0 NA
20-25011558-C-T p.Thr156Thr synonymous ACSS1 2 83050 2.40819E-5 41525 0 3.18431E-5
20-25011559-G-A p.Thr156Met missense ACSS1 4 83052 4.81626E-5 41526 0 6.36862E-5
20-25011571-C-T p.Arg152His missense ACSS1 3 82984 3.61515E-5 41492 0 3.18634E-5
20-25011572-G-A p.Arg152Cys missense ACSS1 20 82984 2.4101E-4 41492 0 0.00114701
20-25011573-G-A p.Cys151Cys synonymous ACSS1 4 82974 4.82079E-5 41487 0 6.84603E-5
20-25011576-C-T p.Thr150Thr synonymous ACSS1 2 82944 2.41127E-5 41472 0 3.18573E-5
20-25011577-G-A p.Thr150Met missense ACSS1 6 82924 7.23554E-5 41462 0 NA
20-25011581-T-A p.Thr149Ser missense ACSS1 1 82880 1.20656E-5 41440 0 3.986E-6
20-25011584-C-T p.Glu148Lys missense ACSS1 2 82846 2.41412E-5 41423 0 NA
20-25011587-G-A p.Leu147Leu synonymous ACSS1 2 82816 2.41499E-5 41408 0 5.04032E-4
20-25011590-G-A p.Leu146Leu synonymous ACSS1 1 82774 1.20811E-5 41387 0 6.36862E-5
20-25011597-G-GTAGGTGATCCTCACTTCCGTTC p.Cys60fs frameshift ACSS1 4 82662 4.83898E-5 41331 1 NA
20-25011598-C-A p.Cys60Phe missense ACSS1 14 82610 1.69471E-4 41305 0 6.36943E-5
20-25011602-A-T p.Cys59Ser missense ACSS1 1 82548 1.21142E-5 41274 0 NA
20-25011608-A-G p.Ser57Pro missense ACSS1 1 82428 1.21318E-5 41214 0 NA
20-25011611-A-C p.Ser56Ala missense ACSS1 1 82342 1.21445E-5 41171 0 NA
20-25011619-AT-A p.Met53fs frameshift ACSS1 1 82134 1.21752E-5 41067 0 NA
20-25011626-A-G p.Ser51Pro missense ACSS1 1 81920 1.2207E-5 40960 0 1.18467E-5
20-25011637-C-T p.Gly47Asp missense ACSS1 2 81420 2.4564E-5 40710 0 6.37146E-5
20-25011638-CA-TG p.PheGly46PheSer missense ACSS1 1 81410 1.22835E-5 40705 0 NA
20-25011639-A-G p.Phe46Phe synonymous ACSS1 12493 80290 0.155598 40145 834 0.180521
20-25011643-T-A p.His45Leu missense ACSS1 1 81334 1.2295E-5 40667 0 NA
20-25011646-A-C p.Leu44Arg missense ACSS1 13 81212 1.60075E-4 40606 0 1.59226E-4
20-25011663-G-A p.Leu38Leu synonymous ACSS1 1 80498 1.24227E-5 40249 0 1.10563E-5
20-25011672-T-G p.Ala35Ala synonymous ACSS1 1 80166 1.24741E-5 40083 0 NA
20-25011680-T-C p.Lys33Glu missense ACSS1 1 79934 1.25103E-5 39967 0 8.79353E-5
20-25011698-G-A p.Leu27Leu synonymous ACSS1 1 78630 1.27178E-5 39315 0 6.80828E-6
20-25011705-G-C p.Gly24Gly synonymous ACSS1 2 78118 2.56023E-5 39059 0 9.55049E-5
20-25011746-A-G p.Tyr11His missense ACSS1 88 70726 0.00124424 35363 0 0.00305713
20-25011774-C-T p.Met1? start_lost ACSS1 1 59208 1.68896E-5 29604 0 NA
20-25011877-G-A c.-101C>T 5_prime_UTR_premature_start_codon_gain ACSS1 25 12682 0.0019713 6341 0 0.00299382
20-25012052-T-C c.-276A>G 5_prime_UTR_premature_start_codon_gain ACSS1 1 5462 1.83083E-4 2731 0 NA
20-25012925-C-T c.-1149G>A 5_prime_UTR_premature_start_codon_gain ACSS1 1 26860 3.72301E-5 13430 0 3.18634E-5
20-25012988-G-A c.-1212C>T 5_prime_UTR_premature_start_codon_gain ACSS1 2 29494 6.78104E-5 14747 0 6.25E-4
20-25012990-G-C c.-1214C>G 5_prime_UTR_premature_start_codon_gain ACSS1 329 29556 0.0111314 14778 4 0.0309278
20-25012997-C-T c.68+8G>A splice_region ACSS1 1 29318 3.41087E-5 14659 0 NA
20-25013000-C-G c.68+5G>C splice_region ACSS1 1 29394 3.40205E-5 14697 0 3.18451E-5
20-25013000-C-T c.68+5G>A splice_region ACSS1 1 29394 3.40205E-5 14697 0 6.36902E-5
20-25013005-C-A p.Arg23Leu missense+splice_region ACSS1 2 29292 6.8278E-5 14646 0 NA
20-25013006-G-A p.Arg23Trp missense+splice_region ACSS1 1 29322 3.41041E-5 14661 0 6.37024E-5
20-25013006-G-T p.Arg23Arg splice_region+synonymous ACSS1 2 29322 6.82082E-5 14661 0 6.37024E-5
20-25013007-G-A p.Gly22Gly splice_region+synonymous ACSS1 28 29442 9.51022E-4 14721 0 0.0110193
20-25013010-A-G p.His21His synonymous ACSS1 2 29566 6.76453E-5 14783 0 4.04122E-5
20-25013010-A-C p.His21Gln missense ACSS1 2 29566 6.76453E-5 14783 0 NA
20-25013013-C-T p.Pro20Pro synonymous ACSS1 2 29500 6.77966E-5 14750 0 7.89515E-5
20-25013014-G-A p.Pro20Leu missense ACSS1 5 29522 1.69365E-4 14761 0 0.0021692
20-25013015-G-A p.Pro20Ser missense ACSS1 1 29850 3.35008E-5 14925 0 NA
20-25013016-T-A p.Ala19Ala synonymous ACSS1 3 30298 9.90164E-5 15149 0 3.29229E-5
20-25013017-G-A p.Ala19Val missense ACSS1 2 30328 6.59457E-5 15164 0 NA
20-25013019-G-A c.-1243C>T 5_prime_UTR_premature_start_codon_gain ACSS1 5 30330 1.64853E-4 15165 0 1.67051E-5
20-25013066-G-A p.Arg3Cys missense ACSS1 1 29834 3.35188E-5 14917 0 7.48503E-4
20-25013068-C-G p.Arg2Thr missense ACSS1 1 29824 3.353E-5 14912 0 NA
20-25013210-G-A c.-1434C>T 5_prime_UTR_premature_start_codon_gain ACSS1 2 26000 7.69231E-5 13000 0 NA
20-25013221-C-G c.-1445G>C 5_prime_UTR_premature_start_codon_gain ACSS1 1 25702 3.89075E-5 12851 0 NA
20-25013230-G-A c.-1454C>T 5_prime_UTR_premature_start_codon_gain ACSS1 1 25606 3.90533E-5 12803 0 5.74309E-4
20-25027486-C-A p.Gly152Cys missense ACSS1 2 51810 3.86026E-5 25905 0 6.96512E-5
20-25027487-A-T p.Cys151* stop_gained ACSS1 1 51830 1.92938E-5 25915 0 NA
20-25027491-G-A p.Pro150Leu missense ACSS1 154 51794 0.00297332 25897 1 0.00244582
20-25027499-C-T p.Leu147Leu synonymous ACSS1 49 51722 9.47372E-4 25861 0 0.00328276
20-25027507-G-T p.Pro145Thr missense+splice_region ACSS1 129 51594 0.00250029 25797 1 0.00493725
20-25027516-T-C c.432-8A>G splice_region ACSS1 14 51330 2.72745E-4 25665 0 3.18837E-4
20-25028741-C-T p.Thr137Thr synonymous ACSS1 1 83190 1.20207E-5 41595 0 3.18959E-5
20-25028742-G-C p.Thr137Arg missense ACSS1 4 83194 4.80804E-5 41597 0 4.99359E-5
20-25028750-C-T p.Glu134Glu synonymous ACSS1 41 83252 4.92481E-4 41626 0 0.00216754
20-25028756-G-C p.Arg132Arg synonymous ACSS1 2 83242 2.40263E-5 41621 0 5.03525E-4
20-25028758-G-A p.Arg132Cys missense ACSS1 5 83242 6.00658E-5 41621 0 1.27567E-4
20-25028758-G-T p.Arg132Ser missense ACSS1 2 83242 2.40263E-5 41621 0 NA
20-25028774-A-T p.Val126Val synonymous ACSS1 3 83266 3.60291E-5 41633 0 1.99067E-5
20-25028776-C-T p.Val126Ile missense ACSS1 6 83252 7.20703E-5 41626 0 5.03525E-4
20-25028777-G-A p.Ser125Ser synonymous ACSS1 2 83264 2.402E-5 41632 0 3.32171E-5
20-25028778-C-T p.Ser125Asn missense ACSS1 1 83266 1.20097E-5 41633 0 NA
20-25028782-C-T p.Glu124Lys missense ACSS1 7 83270 8.40639E-5 41635 0 5.03525E-4
20-25028783-G-A p.Pro123Pro synonymous ACSS1 1 83256 1.20111E-5 41628 0 2.39006E-5
20-25028794-G-A p.Arg120Trp missense ACSS1 12 83232 1.44175E-4 41616 0 1.23578E-4
20-25028814-TTGACTGTACAAAAAGAGGGTTTGCGGATGTTACACTTGGTGCTTTTTGAGTGAGAATTCGGCCAGGTTGAGGGGTTGGAGCGGGTCTAGTTTGCTGTGGCTCTCTCTTCTTCCAC-T p.Val112_Asn113delinsAsp splice_acceptor ACSS1 1 83120 1.20308E-5 41560 0 NA
20-25028818-C-CAGAGACATTTAACTGGCCTCCCAGGAACCAGCCGATCTTGCCAG c.335-2_335-1insCTGGCAAGATCGGCTGGTTCCTGGGAGGCCAGTTAAATGTCTCT splice_acceptor ACSS1 2 83082 2.40726E-5 41541 1 NA
20-25028823-CA-C c.335-7delT splice_region ACSS1 2 82996 2.40975E-5 41498 0 1.20425E-5
20-25038406-A-T p.Ser111Ser splice_region+synonymous ACSS1 1 79708 1.25458E-5 39854 0 1.27698E-4
20-25038407-G-C p.Ser111Cys missense+splice_region ACSS1 9 79718 1.12898E-4 39859 0 4.32324E-5
20-25038408-A-G p.Ser111Pro missense ACSS1 1 79734 1.25417E-5 39867 0 1.72709E-5
20-25038412-A-G p.Asn109Asn synonymous ACSS1 5 79832 6.26315E-5 39916 0 3.43289E-5
20-25038429-G-A p.Leu104Leu synonymous ACSS1 3 80122 3.74429E-5 40061 0 NA
20-25038432-A-G p.Phe103Leu missense ACSS1 2 80114 2.49644E-5 40057 0 4.12415E-6
20-25038441-T-C p.Ile100Val missense ACSS1 1 80600 1.24069E-5 40300 0 NA
20-25038449-G-A p.Thr97Ile missense ACSS1 1 80726 1.23876E-5 40363 0 NA
20-25038450-T-C p.Thr97Ala missense ACSS1 2 80716 2.47782E-5 40358 0 1.22255E-5
20-25038460-G-T p.Cys93* stop_gained ACSS1 2 80830 2.47433E-5 40415 0 NA
20-25038465-C-A p.Asp92Tyr missense ACSS1 2 80940 2.47097E-5 40470 0 NA
20-25038466-C-A p.Trp91Cys missense ACSS1 2 80948 2.47072E-5 40474 0 NA
20-25038473-G-A p.Thr89Ile missense ACSS1 1 81098 1.23308E-5 40549 0 3.19285E-5
20-25038484-G-T p.Thr85Thr synonymous ACSS1 12635 80894 0.156192 40447 1130 0.186875
20-25038484-GGT-TGC p.Thr85Ala missense ACSS1 1 81220 1.23122E-5 40610 0 NA
20-25038485-G-T p.Thr85Asn missense ACSS1 73 81214 8.9886E-4 40607 0 0.00625
20-25038486-T-C p.Thr85Ala missense ACSS1 1 81148 1.23232E-5 40574 0 1.34619E-4
20-25038506-C-G p.Arg78Pro missense ACSS1 1 81278 1.23035E-5 40639 0 4.04289E-6
20-25038509-G-T p.Ala77Glu missense ACSS1 1 81260 1.23062E-5 40630 0 8.51948E-6
20-25038517-C-T p.Gly74Gly synonymous ACSS1 2 81240 2.46184E-5 40620 0 1.62409E-5
20-25038520-C-T p.Trp73* stop_gained ACSS1 1 81172 1.23195E-5 40586 0 NA
20-25038532-C-T p.Pro69Pro synonymous ACSS1 1 80736 1.2386E-5 40368 0 1.64217E-5
20-25038536-T-C p.Glu68Gly missense ACSS1 1 80676 1.23953E-5 40338 0 NA
20-25038542-G-C p.Ala66Gly missense ACSS1 2 80534 2.48342E-5 40267 0 NA
20-25038553-A-T p.Ser62Arg missense ACSS1 1106 80286 0.0137758 40143 46 0.0285412
20-25038561-C-T p.Ala60Thr missense ACSS1 4 79868 5.00826E-5 39934 0 4.22119E-6
20-25038562-G-C p.Pro59Pro synonymous ACSS1 1 79972 1.25044E-5 39986 0 9.59693E-5
20-25038569-G-T p.Ser57* stop_gained ACSS1 4 79472 5.03322E-5 39736 0 NA
20-25038571-G-C p.Gly56Gly synonymous ACSS1 353 79288 0.00445212 39644 2 0.00684006
20-25038579-GTGC-G p.Ala53del conservative_inframe_deletion ACSS1 3 78604 3.8166E-5 39302 0 0.0157201
20-25038579-G-GTGC p.Ala53dup conservative_inframe_insertion ACSS1 12 78708 1.52462E-4 39354 0 1.00798E-4
20-25038594-C-T p.Ala49Thr missense ACSS1 1 77446 1.29122E-5 38723 0 NA
20-25038601-G-T p.Pro46Pro synonymous ACSS1 2 76718 2.60695E-5 38359 0 7.86295E-5
20-25038604-A-G p.Ala45Ala synonymous ACSS1 2 76398 2.61787E-5 38199 0 5.40021E-6
20-25038607-G-A p.Ser44Ser synonymous ACSS1 4 75840 5.27426E-5 37920 0 NA
20-25038629-G-T p.Ala37Glu missense ACSS1 1 73004 1.36979E-5 36502 0 3.24149E-5
20-25038631-C-T p.Arg36Arg synonymous ACSS1 4 72920 5.48546E-5 36460 0 NA
20-25038635-C-A p.Arg35Leu missense ACSS1 4 72108 5.54723E-5 36054 0 NA
20-25038635-C-G p.Arg35Pro missense ACSS1 1 72108 1.38681E-5 36054 0 NA
20-25038643-G-T p.Ser32Arg missense ACSS1 1 70780 1.41283E-5 35390 0 7.51541E-5
20-25038648-C-G p.Val31Leu missense ACSS1 1 70274 1.423E-5 35137 0 1.48987E-4
20-25038655-C-G p.Pro28Pro synonymous ACSS1 4 68920 5.80383E-5 34460 0 3.3942E-5
20-25038656-G-T p.Pro28Gln missense ACSS1 1 68614 1.45743E-5 34307 0 NA
20-25038659-G-A p.Pro27Leu missense ACSS1 3 67510 4.44379E-5 33755 0 1.35943E-4
20-25038661-C-T p.Arg26Arg synonymous ACSS1 1 67198 1.48814E-5 33599 0 NA
20-25038664-C-A p.Ala25Ala synonymous ACSS1 1 66482 1.50417E-5 33241 0 NA
20-25038667-G-GGGCTGCCCCGAGAGCCCTCGCA p.Pro27fs frameshift ACSS1 1 66556 1.50249E-5 33278 0 NA
20-25038676-C-T p.Ser21Ser synonymous ACSS1 2 65176 3.06861E-5 32588 0 NA
20-25038676-C-A p.Ser21Ser synonymous ACSS1 2 65176 3.06861E-5 32588 0 NA
20-25038676-C-G p.Ser21Ser synonymous ACSS1 1 65176 1.53431E-5 32588 0 3.24023E-5
20-25038685-T-A p.Arg18Arg synonymous ACSS1 1 63122 1.58423E-5 31561 0 NA
20-25038687-G-T p.Arg18Arg synonymous ACSS1 6 62504 9.59939E-5 31252 0 NA
20-25038696-C-G p.Gly15Arg missense ACSS1 2 60568 3.30207E-5 30284 0 NA
20-25038711-C-A p.Val10Phe missense ACSS1 1229 56484 0.0217584 28242 36 0.0555556
20-25038711-C-T p.Val10Ile missense ACSS1 5 56632 8.82893E-5 28316 0 NA
20-25038713-C-T p.Gly9Asp missense ACSS1 760 56144 0.0135366 28072 15 0.0287145
20-25038726-T-C p.Thr5Ala missense ACSS1 1 53880 1.85598E-5 26940 0 NA
20-25038859-G-A c.-121C>T 5_prime_UTR_premature_start_codon_gain ACSS1 2 27164 7.36269E-5 13582 0 NA
20-25038908-G-A c.-170C>T 5_prime_UTR_premature_start_codon_gain ACSS1 2 17026 1.17467E-4 8513 0 NA
20-25038980-G-A c.-242C>T 5_prime_UTR_premature_start_codon_gain ACSS1 1 12034 8.30979E-5 6017 0 NA
20-25039031-C-A c.-293G>T 5_prime_UTR_premature_start_codon_gain ACSS1 2 6842 2.92312E-4 3421 0 3.19061E-5