Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
16-20686144-G-GTTGCAGGT n.313_313+1insTTGCAGGT splice_donor ACSM3 2 10 0.2 5 0 NA
16-20775303-T-C c.-196T>C 5_prime_UTR_premature_start_codon_gain ACSM3 97 2938 0.0330157 1469 1 0.0256386
16-20775447-A-AATGAACTGGTCTCT c.-52_-52+1insATGAACTGGTCTCT splice_donor ACSM3 4 2946 0.00135777 1473 2 NA
16-20781297-GTC-TTT c.-51-9_-51-7delGTCinsTTT splice_region ACSM3 1 81246 1.23083E-5 40623 0 NA
16-20781299-C-A c.-51-7C>A splice_region ACSM3 1 81388 1.22868E-5 40694 0 NA
16-20781360-C-G p.Leu2Val missense ACSM3 7 83012 8.43252E-5 41506 0 1.59215E-4
16-20781367-G-A p.Arg4His missense ACSM3 1 83034 1.20433E-5 41517 0 2.38854E-5
16-20781388-G-A p.Arg11His missense ACSM3 3 83104 3.60993E-5 41552 0 3.2956E-5
16-20781393-GC-G p.Lys14fs frameshift ACSM3 1 83130 1.20294E-5 41565 0 NA
16-20781394-C-T p.Ala13Val missense ACSM3 1 83132 1.20291E-5 41566 0 7.95906E-6
16-20781408-C-T p.Arg18Cys missense ACSM3 1 83140 1.20279E-5 41570 0 3.18471E-5
16-20781417-A-G p.Ile21Val missense ACSM3 178 83150 0.00214071 41575 0 0.00557538
16-20781424-G-A p.Gly23Asp missense ACSM3 2 83160 2.405E-5 41580 0 8.23778E-6
16-20781431-G-A p.Val25Val splice_region+synonymous ACSM3 3 83170 3.60707E-5 41585 0 5.03525E-4
16-20781436-C-T p.Ala27Val missense ACSM3 1 83156 1.20256E-5 41578 0 3.18593E-5
16-20781449-T-C p.Asp31Asp synonymous ACSM3 54 83092 6.49882E-4 41546 0 3.62111E-4
16-20781454-G-T p.Arg33Ile missense ACSM3 4 83064 4.81556E-5 41532 0 NA
16-20781457-C-A p.Thr34Lys missense ACSM3 1 83020 1.20453E-5 41510 0 8.239E-6
16-20781457-C-T p.Thr34Ile missense ACSM3 1 83020 1.20453E-5 41510 0 NA
16-20781463-C-A p.Thr36Asn missense ACSM3 3 82982 3.61524E-5 41491 0 1.27453E-4
16-20781484-A-G p.Tyr43Cys missense ACSM3 2 82774 2.41622E-5 41387 0 NA
16-20781486-G-T p.Glu44* stop_gained ACSM3 1 82752 1.20843E-5 41376 0 3.98073E-6
16-20781486-G-C p.Glu44Gln missense ACSM3 12 82752 1.45012E-4 41376 0 0.00251762
16-20781489-T-C p.Ser45Pro missense ACSM3 65 82706 7.85916E-4 41353 0 0.00338734
16-20781494-G-T p.Met1? start_lost ACSM3 1 82624 1.2103E-5 41312 0 NA
16-20781501-G-A p.Asp49Asn missense ACSM3 1 82502 1.21209E-5 41251 0 1.19483E-5
16-20781502-A-G p.Asp49Gly missense ACSM3 1 82470 1.21256E-5 41235 0 NA
16-20781509-A-T p.Lys51Asn missense ACSM3 1 82374 1.21398E-5 41187 0 NA
16-20781512-G-T p.Leu52Leu splice_region+synonymous ACSM3 22 82292 2.67341E-4 41146 0 1.1957E-4
16-20781520-C-T p.Pro55Leu missense ACSM3 1 82324 1.21471E-5 41162 0 NA
16-20781542-A-G p.Lys62Lys synonymous ACSM3 12 82240 1.45914E-4 41120 0 1.57246E-4
16-20781557-A-G p.Gln67Gln synonymous ACSM3 65 82288 7.89909E-4 41144 1 0.00358118
16-20781558-T-C p.Trp68Arg missense ACSM3 1 82322 1.21474E-5 41161 0 NA
16-20781575-G-T p.Lys73Asn missense+splice_region ACSM3 7 82206 8.51519E-5 41103 0 5.06372E-5
16-20781575-G-A p.Lys73Lys splice_region+synonymous ACSM3 2 82206 2.43291E-5 41103 0 4.02722E-6
16-20781580-G-A c.219+5G>A splice_region ACSM3 3 82138 3.65239E-5 41069 0 1.69802E-5
16-20781580-G-C c.219+5G>C splice_region ACSM3 1 82138 1.21746E-5 41069 0 6.25E-4
16-20781581-G-C c.219+6G>C splice_region ACSM3 1 82124 1.21767E-5 41062 0 8.50167E-6
16-20781581-G-T c.219+6G>T splice_region ACSM3 1 82124 1.21767E-5 41062 0 4.03106E-6
16-20781583-G-A c.219+8G>A splice_region ACSM3 1 82092 1.21815E-5 41046 0 NA
16-20787156-C-T c.220-5C>T splice_region ACSM3 1 82944 1.20563E-5 41472 0 NA
16-20787158-C-T c.220-3C>T splice_region ACSM3 51 82958 6.14769E-4 41479 0 9.24038E-4
16-20787185-G-T p.Ala82Ser missense ACSM3 3 83036 3.61289E-5 41518 0 5.03525E-4
16-20787193-G-A p.Trp84* stop_gained ACSM3 1 83068 1.20383E-5 41534 0 NA
16-20787221-C-T p.Arg94* stop_gained ACSM3 1 83168 1.20239E-5 41584 0 6.36862E-5
16-20787221-C-A p.Arg94Arg synonymous ACSM3 1 83168 1.20239E-5 41584 0 NA
16-20787222-G-C p.Arg94Pro missense ACSM3 4 83178 4.80896E-5 41589 0 3.18532E-5
16-20787222-G-A p.Arg94Gln missense ACSM3 1 83178 1.20224E-5 41589 0 8.23805E-6
16-20787225-G-A p.Trp95* stop_gained ACSM3 1 83194 1.20201E-5 41597 0 1.19355E-5
16-20787240-T-C p.Leu100Pro missense+splice_region ACSM3 762 83204 0.00915821 41602 6 0.00956697
16-20787243-G-T p.Gly101Val missense ACSM3 171 83222 0.00205475 41611 2 0.00461842
16-20787243-G-A p.Gly101Glu missense ACSM3 3 83222 3.60482E-5 41611 0 1.6475E-5
16-20787246-C-G p.Ser102Cys missense ACSM3 1 83228 1.20152E-5 41614 0 8.2375E-6
16-20787246-C-A p.Ser102Tyr missense ACSM3 1 83228 1.20152E-5 41614 0 NA
16-20787259-A-G p.Lys106Lys synonymous ACSM3 1 83240 1.20135E-5 41620 0 NA
16-20787268-T-C p.Asn109Asn synonymous ACSM3 2 83256 2.40223E-5 41628 0 8.23655E-6
16-20787295-A-G p.Gln118Gln synonymous ACSM3 1 83276 1.20083E-5 41638 0 NA
16-20787305-C-T p.Arg122Trp missense ACSM3 4 83284 4.80284E-5 41642 0 3.18208E-5
16-20787306-G-A p.Arg122Gln missense ACSM3 4 83278 4.80319E-5 41639 0 1.23556E-4
16-20787307-G-A p.Arg122Arg synonymous ACSM3 1 83282 1.20074E-5 41641 0 NA
16-20787313-T-C p.Ile124Ile synonymous ACSM3 1 83286 1.20068E-5 41643 0 NA
16-20787322-GC-G p.Arg129fs frameshift ACSM3 1 83278 1.2008E-5 41639 0 1.64745E-5
16-20787323-C-G p.Pro128Ala missense ACSM3 1 83280 1.20077E-5 41640 0 NA
16-20787324-C-G p.Pro128Arg missense ACSM3 1 83280 1.20077E-5 41640 0 1.64747E-5
16-20787330-T-C p.Val130Ala missense ACSM3 1 83276 1.20083E-5 41638 0 NA
16-20787335-G-T p.Glu132* stop_gained ACSM3 1 83278 1.2008E-5 41639 0 NA
16-20787340-G-A p.Trp133* stop_gained ACSM3 2 83278 2.40159E-5 41639 0 3.97779E-6
16-20787353-G-C p.Val138Leu missense ACSM3 2 83228 2.40304E-5 41614 0 3.97864E-6
16-20787370-A-G p.Thr143Thr splice_region+synonymous ACSM3 2 83118 2.40622E-5 41559 0 NA
16-20787371-GGT-AGG p.Gly144Arg splice_donor ACSM3 1 83112 1.2032E-5 41556 0 NA
16-20788716-C-T p.Thr151Ile missense ACSM3 2 82194 2.43327E-5 41097 0 8.33709E-6
16-20788733-A-G p.Lys157Glu missense ACSM3 1 82502 1.21209E-5 41251 0 NA
16-20788737-A-G p.Asp158Gly missense+splice_region ACSM3 1 82534 1.21162E-5 41267 0 3.18451E-5
16-20788741-T-A p.Ile159Ile synonymous ACSM3 1 82546 1.21145E-5 41273 0 NA
16-20788749-G-A p.Arg162Lys missense ACSM3 1 82574 1.21103E-5 41287 0 8.28583E-6
16-20788773-G-T p.Cys170Phe missense ACSM3 4 82670 4.83851E-5 41335 0 NA
16-20788775-A-G p.Ile171Val missense ACSM3 2 82696 2.4185E-5 41348 0 8.27499E-6
16-20788797-C-T p.Ala178Val missense ACSM3 1 82708 1.20907E-5 41354 0 NA
16-20788810-C-T p.Asp182Asp synonymous ACSM3 8 82752 9.66744E-5 41376 0 6.61967E-5
16-20788811-G-A p.Ala183Thr missense ACSM3 9 82750 1.08761E-4 41375 0 5.41367E-4
16-20788812-C-T p.Ala183Val missense ACSM3 2 82756 2.41674E-5 41378 0 NA
16-20788819-A-G p.Ala185Ala synonymous ACSM3 1 82768 1.2082E-5 41384 0 3.1839E-5
16-20788822-C-T p.Ser186Ser synonymous ACSM3 2 82778 2.4161E-5 41389 0 3.18492E-5
16-20788827-G-C p.Cys188Ser missense ACSM3 6 82756 7.25023E-5 41378 0 9.55414E-5
16-20788835-CT-C p.Leu191fs frameshift ACSM3 2 82768 2.41639E-5 41384 0 NA
16-20788851-T-C p.Ile196Thr missense ACSM3 2 82754 2.4168E-5 41377 0 NA
16-20788852-T-C p.Ile196Ile synonymous ACSM3 1874 82728 0.0226525 41364 127 0.0473369
16-20788878-G-C p.Trp205Ser missense ACSM3 3 82758 3.62503E-5 41379 0 NA
16-20788879-G-A p.Trp205* stop_gained ACSM3 1 82774 1.20811E-5 41387 0 1.07731E-4
16-20788880-G-C p.Gly206Arg missense ACSM3 2 82772 2.41628E-5 41386 0 NA
16-20788882-G-A p.Gly206Gly synonymous ACSM3 115 82752 0.00138969 41376 0 0.00112566
16-20788882-G-GC p.Asn207fs frameshift ACSM3 1 82758 1.20834E-5 41379 0 NA
16-20788882-G-C p.Gly206Gly synonymous ACSM3 1 82758 1.20834E-5 41379 0 3.99275E-6
16-20788885-C-T p.Asn207Asn synonymous ACSM3 1 82738 1.20863E-5 41369 0 3.4462E-5
16-20788887-T-C p.Leu208Pro missense ACSM3 1 82744 1.20855E-5 41372 0 3.18512E-5
16-20788890-A-G p.Lys209Arg missense ACSM3 1 82726 1.20881E-5 41363 0 NA
16-20788891-G-C p.Lys209Asn missense ACSM3 1 82720 1.2089E-5 41360 0 8.7512E-6
16-20788895-T-C p.Leu211Leu synonymous ACSM3 3 82700 3.62757E-5 41350 0 NA
16-20788905-G-A c.638+3G>A splice_region ACSM3 64 82608 7.74743E-4 41304 0 0.00390338
16-20791144-A-C p.Ser177Arg missense ACSM3 1 2388 4.1876E-4 1194 0 1.9454E-4
16-20791152-G-A p.Val179Val synonymous ACSM3 2 2464 8.11688E-4 1232 0 1.61228E-4
16-20791230-G-A c.614+1G>A splice_donor ACSM3 1 1782 5.61167E-4 891 0 9.56328E-5
16-20792033-C-A c.639-3C>A splice_region ACSM3 1 82930 1.20584E-5 41465 0 NA
16-20792041-C-T p.Ala215Val missense ACSM3 4 82872 4.82672E-5 41436 0 5.03525E-4
16-20792043-A-C p.Ser216Arg missense ACSM3 6 82872 7.24008E-5 41436 0 1.59215E-4
16-20792053-A-G p.His219Arg missense ACSM3 2 82820 2.41488E-5 41410 0 8.23737E-6
16-20792056-C-T p.Thr220Ile missense ACSM3 2 82820 2.41488E-5 41410 0 3.18431E-5
16-20792061-G-A p.Val222Met missense ACSM3 3 82788 3.62371E-5 41394 0 8.23723E-6
16-20792083-T-A p.Ile229Asn missense ACSM3 1 82660 1.20978E-5 41330 0 NA
16-20792086-T-C p.Met230Thr missense ACSM3 2 82634 2.42031E-5 41317 0 3.29495E-5
16-20792095-T-C p.Phe233Ser missense ACSM3 1 82562 1.21121E-5 41281 0 NA
16-20792101-C-T p.Thr235Ile missense ACSM3 1 82480 1.21242E-5 41240 0 NA
16-20792110-C-T p.Thr238Ile missense ACSM3 4 82418 4.85331E-5 41209 0 2.55367E-4
16-20792113-G-C p.Ser239Thr missense ACSM3 1 82408 1.21347E-5 41204 0 8.2375E-6
16-20792121-C-CT p.Pro242fs frameshift ACSM3 2 82342 2.42889E-5 41171 0 NA
16-20792122-C-T p.Pro242Leu missense ACSM3 83 82334 0.00100809 41167 1 9.87198E-4
16-20792122-C-A p.Pro242Gln missense ACSM3 2 82334 2.42913E-5 41167 0 1.64745E-5
16-20792123-G-A p.Pro242Pro synonymous ACSM3 5 82342 6.07224E-5 41171 0 2.39252E-5
16-20792131-C-T p.Thr245Ile missense ACSM3 1 82348 1.21436E-5 41174 0 NA
16-20792138-C-T p.His247His synonymous ACSM3 6 82330 7.28774E-5 41165 0 NA
16-20792141-C-A p.Thr248Thr synonymous ACSM3 1 82342 1.21445E-5 41171 0 NA
16-20792147-C-T p.Ser250Ser synonymous ACSM3 1 82380 1.21389E-5 41190 0 3.1839E-5
16-20792163-T-C p.Leu256Leu synonymous ACSM3 1 82500 1.21212E-5 41250 0 NA
16-20792175-G-A p.Gly260Arg missense ACSM3 1 82574 1.21103E-5 41287 0 3.98543E-6
16-20792177-AAGGTATACTTTCACAAAAGTGCAGCTTGAAGTGTCAAAACTGCAAAGATGATGACTTATGTACTGGTCTTTTATATTTATTTTCCTATGTACATCAGGGCTACTCTTTGTTTTCCC-A p.Arg261fs frameshift ACSM3 1 82588 1.21083E-5 41294 0 NA
16-20792180-G-A c.782+1G>A splice_donor ACSM3 1 82604 1.2106E-5 41302 0 1.64777E-5
16-20792292-C-T c.783-4C>T splice_region ACSM3 3 83128 3.60889E-5 41564 0 1.64938E-5
16-20792316-C-G p.Pro268Arg missense ACSM3 3 83180 3.60664E-5 41590 0 6.76762E-5
16-20792321-G-C p.Asp270His missense ACSM3 19 83192 2.28387E-4 41596 0 0.00206954
16-20792345-A-G p.Thr278Ala missense ACSM3 1 83204 1.20187E-5 41602 0 NA
16-20792346-C-T p.Thr278Met missense ACSM3 4 83204 4.80746E-5 41602 0 2.4719E-5
16-20792347-G-A p.Thr278Thr synonymous ACSM3 2 83208 2.40361E-5 41604 0 6.25E-4
16-20792368-G-A p.Trp285* stop_gained ACSM3 1 83168 1.20239E-5 41584 0 3.9794E-6
16-20792382-C-T p.Ser290Phe missense ACSM3 1 83118 1.20311E-5 41559 0 NA
16-20792384-C-T p.Pro291Ser missense ACSM3 3 83112 3.60959E-5 41556 0 3.18959E-5
16-20792385-C-T p.Pro291Leu missense ACSM3 8 83120 9.62464E-5 41560 0 6.37592E-5
16-20792388-G-A p.Trp292* stop_gained ACSM3 400 83104 0.00481325 41552 8 0.00937082
16-20792394-A-C p.Gln294Pro missense ACSM3 3 83086 3.61072E-5 41543 0 3.98019E-6
16-20792399-GCATGTGTATTCACACAC-G p.Cys297fs frameshift ACSM3 1 83062 1.20392E-5 41531 0 NA
16-20792401-A-G p.Ala296Ala synonymous ACSM3 2 83058 2.40796E-5 41529 0 6.36821E-5
16-20792405-G-A p.Val298Ile missense ACSM3 1 83014 1.20462E-5 41507 0 NA
16-20792417-C-T p.His302Tyr missense ACSM3 177 82892 0.00213531 41446 1 0.0012942
16-20792425-C-T p.Pro304Pro synonymous ACSM3 55 82794 6.64299E-4 41397 0 0.00143321
16-20792426-C-T p.Arg305Cys missense ACSM3 1 82782 1.20799E-5 41391 0 2.39276E-5
16-20792435-C-A p.Pro308Thr missense ACSM3 796 82668 0.00962888 41334 26 0.0210218
16-20792436-C-T p.Pro308Leu missense ACSM3 2 82686 2.41879E-5 41343 0 3.18471E-5
16-20792437-G-A p.Pro308Pro synonymous ACSM3 1 82684 1.20942E-5 41342 0 3.18532E-5
16-20792447-T-C p.Leu312Leu synonymous ACSM3 1 82626 1.21027E-5 41313 0 3.5939E-5
16-20792452-A-G p.Gln313Gln splice_region+synonymous ACSM3 2 82568 2.42225E-5 41284 0 4.79421E-5
16-20792458-C-T c.939+6C>T splice_region ACSM3 1 82500 1.21212E-5 41250 0 1.66306E-5
16-20793033-C-T p.Leu315Phe missense ACSM3 2 83064 2.40778E-5 41532 0 3.98115E-6
16-20793034-T-A p.Leu315His missense ACSM3 1 83068 1.20383E-5 41534 0 NA
16-20793046-C-T p.Pro319Leu missense ACSM3 1 83118 1.20311E-5 41559 0 6.25E-4
16-20793062-T-C p.Cys324Cys synonymous ACSM3 1 83132 1.20291E-5 41566 0 NA
16-20793080-C-T p.Tyr330Tyr synonymous ACSM3 2 83124 2.40604E-5 41562 0 1.99046E-5
16-20793080-CCG-C p.Arg331fs frameshift ACSM3 1 83124 1.20302E-5 41562 0 NA
16-20793081-C-T p.Arg331* stop_gained ACSM3 9 83126 1.08269E-4 41563 0 1.89647E-4
16-20793082-G-C p.Arg331Pro missense ACSM3 3 83134 3.60863E-5 41567 0 6.36862E-5
16-20793082-G-GTTTA p.Met332fs frameshift ACSM3 1 83134 1.20288E-5 41567 0 NA
16-20793084-A-G p.Met332Val missense ACSM3 14 83124 1.68423E-4 41562 0 7.12585E-4
16-20793090-G-A p.Val334Ile missense ACSM3 1 83114 1.20317E-5 41557 0 3.18471E-5
16-20796308-A-G p.Tyr341Cys missense+splice_region ACSM3 2 83158 2.40506E-5 41579 0 3.1839E-5
16-20796309-T-C p.Tyr341Tyr synonymous ACSM3 1 83156 1.20256E-5 41578 0 5.04032E-4
16-20796322-T-C p.Leu346Leu synonymous ACSM3 1 83174 1.2023E-5 41587 0 8.25423E-6
16-20796338-G-A p.Ser351Asn missense ACSM3 160 83194 0.00192322 41597 1 0.00806452
16-20796345-G-A p.Gly353Gly synonymous ACSM3 1 83214 1.20172E-5 41607 0 3.98102E-6
16-20796352-A-G p.Ile356Val missense ACSM3 3 83226 3.60464E-5 41613 0 3.18451E-5
16-20796359-C-T p.Pro358Leu missense ACSM3 2 83234 2.40286E-5 41617 0 8.24117E-6
16-20796363-C-T p.Asp359Asp synonymous ACSM3 6 83242 7.2079E-5 41621 0 3.18695E-5
16-20796363-C-G p.Asp359Glu missense ACSM3 4 83240 4.80538E-5 41620 0 1.99046E-5
16-20796363-C-A p.Asp359Glu missense ACSM3 1 83242 1.20132E-5 41621 0 3.98092E-6
16-20796364-G-A p.Val360Met missense ACSM3 1 83244 1.20129E-5 41622 0 8.24063E-6
16-20796369-T-C p.Thr361Thr synonymous ACSM3 2 83248 2.40246E-5 41624 0 5.76825E-5
16-20796372-A-G p.Glu362Glu synonymous ACSM3 3 83260 3.60317E-5 41630 0 8.24008E-6
16-20796372-A-C p.Glu362Asp missense ACSM3 1 83260 1.20106E-5 41630 0 3.97972E-6
16-20796385-A-G p.Lys367Glu missense ACSM3 6 83278 7.20478E-5 41639 0 2.22475E-4
16-20796387-G-C p.Lys367Asn missense ACSM3 6585 83194 0.0791523 41597 296 0.125625
16-20796388-A-C p.Thr368Pro missense ACSM3 1 83272 1.20088E-5 41636 0 NA
16-20796391-G-A p.Gly369Ser missense ACSM3 2 83266 2.40194E-5 41633 0 7.95849E-6
16-20796395-T-C p.Leu370Pro missense ACSM3 2 83266 2.40194E-5 41633 0 3.18532E-5
16-20796405-C-T p.Tyr373Tyr synonymous ACSM3 7 83250 8.40841E-5 41625 0 4.14224E-4
16-20796406-G-A p.Glu374Lys missense ACSM3 2 83238 2.40275E-5 41619 0 6.37227E-5
16-20796424-G-A p.Glu380Lys missense ACSM3 1 83218 1.20166E-5 41609 0 NA
16-20796427-A-T p.Thr381Ser missense+splice_region ACSM3 2 83204 2.40373E-5 41602 0 8.24606E-6
16-20796428-C-T p.Thr381Met missense+splice_region ACSM3 7 83202 8.41326E-5 41601 0 4.94756E-5
16-20796431-T-TGCTAATCTGTGGAAATTTTAAGGGAATGAAAATTAA c.1143+2_1143+3insGCTAATCTGTGGAAATTTTAAGGGAATGAAAATTAA splice_region ACSM3 2 83204 2.40373E-5 41602 0 NA
16-20797407-T-G p.Ile384Ser missense ACSM3 2 83102 2.40668E-5 41551 0 NA
16-20797410-G-A p.Cys385Tyr missense ACSM3 1 83116 1.20314E-5 41558 0 8.59853E-6
16-20797418-T-G p.Phe388Val missense ACSM3 1 83110 1.20322E-5 41555 0 4.29015E-5
16-20797458-C-T p.Pro401Leu missense ACSM3 3 83186 3.60638E-5 41593 0 7.48976E-5
16-20797471-C-T p.Phe405Phe synonymous ACSM3 261 83176 0.00313792 41588 2 0.00694533
16-20797472-G-A p.Asp406Asn missense ACSM3 1 83184 1.20215E-5 41592 0 3.18573E-5
16-20797474-T-C n.527T>C splice_region ACSM3 1 83198 1.20195E-5 41599 0 8.34265E-6
16-20797479-A-AG p.Val409fs frameshift ACSM3 6 83208 7.21085E-5 41604 0 NA
16-20797479-AG-A p.Val409fs frameshift ACSM3 1 83208 1.20181E-5 41604 0 NA
16-20797491-C-A p.Ser412Tyr missense ACSM3 5 83192 6.01019E-5 41596 0 2.20279E-4
16-20797491-C-G p.Ser412Cys missense ACSM3 2 83192 2.40408E-5 41596 0 6.77782E-5
16-20797494-C-G p.Pro413Arg missense ACSM3 1 83192 1.20204E-5 41596 0 8.53315E-6
16-20797501-G-A p.Arg415Arg synonymous ACSM3 1 83178 1.20224E-5 41589 0 5.03525E-4
16-20797511-A-G p.Asn419Asp missense ACSM3 1 83172 1.20233E-5 41586 0 NA
16-20797527-C-T p.Thr424Ile missense ACSM3 4 83104 4.81325E-5 41552 0 7.3104E-5
16-20797541-C-T p.Arg429Cys missense ACSM3 82 82690 9.91656E-4 41345 0 0.00162482
16-20797545-T-C p.Leu430Ser missense ACSM3 2 82716 2.41791E-5 41358 0 5.14509E-6
16-20801917-T-G p.Asp411Glu missense ACSM3 1 83250 1.2012E-5 41625 0 NA
16-20801933-C-G p.Leu417Val missense ACSM3 1 83266 1.20097E-5 41633 0 NA
16-20801945-CAAG-C p.Glu422del disruptive_inframe_deletion ACSM3 29 83262 3.48298E-4 41631 0 0.00123628
16-20801949-A-G p.Glu422Gly missense ACSM3 3 83268 3.60282E-5 41634 0 3.1835E-5
16-20801950-A-AG p.Asp424fs frameshift ACSM3 6 83268 7.20565E-5 41634 0 5.03525E-4
16-20801954-G-A p.Asp424Asn missense ACSM3 22 83264 2.6422E-4 41632 0 9.55353E-5
16-20801957-A-G p.Ile425Val missense ACSM3 2 83260 2.40211E-5 41630 0 NA
16-20801958-T-C p.Ile425Thr missense ACSM3 4 83262 4.80411E-5 41631 0 3.58012E-5
16-20801981-C-T p.Arg433* stop_gained ACSM3 4 83240 4.80538E-5 41620 0 8.75211E-5
16-20801982-G-A p.Arg433Gln missense ACSM3 2 83240 2.40269E-5 41620 0 3.18492E-5
16-20801985-C-T p.Pro434Leu missense ACSM3 1 83232 1.20146E-5 41616 0 NA
16-20801993-CT-C p.Phe438fs frameshift ACSM3 9 83210 1.0816E-4 41605 0 1.91071E-4
16-20802002-C-T p.His440Tyr missense ACSM3 1 83172 1.20233E-5 41586 0 1.64867E-5
16-20802007-C-G p.Tyr441* stop_gained ACSM3 667 83170 0.00801972 41585 3 0.00659362
16-20802007-C-T p.Tyr441Tyr synonymous ACSM3 1 83174 1.2023E-5 41587 0 3.18532E-5
16-20802008-G-A p.Val442Ile missense+splice_region ACSM3 4 83160 4.81E-5 41580 0 7.56677E-5
16-20802009-TAGTA-T p.Asp443fs frameshift ACSM3 1 83152 1.20262E-5 41576 0 NA
16-20803316-T-C c.1327-8T>C splice_region ACSM3 4 83168 4.80954E-5 41584 0 4.3875E-5
16-20803318-T-A c.1327-6T>A splice_region ACSM3 1 83184 1.20215E-5 41592 0 NA
16-20803327-A-C p.Asn444His missense ACSM3 1 83222 1.20161E-5 41611 0 3.30251E-5
16-20803332-T-C p.Pro445Pro synonymous ACSM3 1 83252 1.20117E-5 41626 0 3.18512E-5
16-20803354-C-T p.Arg453* stop_gained ACSM3 4 83286 4.80273E-5 41643 0 3.29788E-5
16-20803358-G-A p.Gly454Asp missense ACSM3 1 83300 1.20048E-5 41650 0 6.25E-4
16-20803360-A-G p.Asn455Asp missense ACSM3 2 83298 2.40102E-5 41649 0 NA
16-20803367-A-C p.Tyr457Ser missense ACSM3 2 83308 2.40073E-5 41654 0 8.24171E-6
16-20803370-TCA-T p.Thr459fs frameshift ACSM3 6 83306 7.20236E-5 41653 0 1.19358E-5
16-20803374-T-G p.Thr459Thr synonymous ACSM3 2 83310 2.40067E-5 41655 0 NA
16-20803376-G-A p.Gly460Glu missense ACSM3 10 83302 1.20045E-4 41651 0 4.1396E-4
16-20803377-G-A p.Gly460Gly synonymous ACSM3 1 83306 1.20039E-5 41653 0 NA
16-20803377-G-T p.Gly460Gly synonymous ACSM3 2 83306 2.40079E-5 41653 0 NA
16-20803388-A-G p.Tyr464Cys missense ACSM3 1 83312 1.20031E-5 41656 0 NA
16-20803396-A-C p.Lys467Gln missense ACSM3 3 83314 3.60084E-5 41657 0 2.78485E-5
16-20803409-T-C p.Phe471Ser missense ACSM3 1 83306 1.20039E-5 41653 0 3.18471E-5
16-20803421-C-T p.Ala475Val missense ACSM3 3 83306 3.60118E-5 41653 0 NA
16-20803426-G-A p.Ala477Thr missense ACSM3 3 83302 3.60135E-5 41651 0 3.18431E-5
16-20803437-C-T p.Val480Val synonymous ACSM3 179 83300 0.00214886 41650 0 0.0056051
16-20803450-GGGTAACTTTCTTTTCCATATGTGCATATGTCTGTGTTAACTGATCATCAGTGTTCTAGAGTGAACCTGCCACTCACCTGTATGTATTCCTGCCATATGTGTTTCTA-G p.Gly485fs frameshift ACSM3 1 83276 1.20083E-5 41638 0 NA
16-20803452-G-A c.1454+1G>A splice_donor ACSM3 2 83260 2.40211E-5 41630 0 1.64775E-5
16-20803555-T-C c.1455-3T>C splice_region ACSM3 2 83282 2.40148E-5 41641 0 NA
16-20803558-C-T p.Gly485Gly splice_region+synonymous ACSM3 83 83286 9.96566E-4 41643 0 0.00162379
16-20803560-A-G p.Tyr486Cys missense+splice_region ACSM3 1 83294 1.20057E-5 41647 0 7.95684E-6
16-20803563-G-A p.Arg487Gln missense ACSM3 1 83292 1.2006E-5 41646 0 3.97829E-6
16-20803569-G-T p.Gly489Val missense ACSM3 4 83282 4.80296E-5 41641 0 3.29478E-5
16-20803581-T-C p.Val493Ala missense ACSM3 1 83286 1.20068E-5 41643 0 3.29484E-5
16-20803581-T-G p.Val493Gly missense ACSM3 1 83286 1.20068E-5 41643 0 3.18431E-5
16-20803590-C-A p.Ala496Asp missense ACSM3 1 83276 1.20083E-5 41638 0 8.23723E-6
16-20803591-CCTGAATGAACACCCT-C p.Leu497_Pro501del conservative_inframe_deletion ACSM3 1 83272 1.20088E-5 41636 0 NA
16-20803598-G-A p.Glu499Lys missense ACSM3 5 83258 6.00543E-5 41629 0 1.19376E-5
16-20803604-C-G p.Pro501Ala missense ACSM3 2 83226 2.4031E-5 41613 0 8.23737E-6
16-20803608-CA-C p.Val503fs frameshift ACSM3 1 83210 1.20178E-5 41605 0 NA
16-20803610-G-A p.Val503Ile missense ACSM3 2 83202 2.40379E-5 41601 0 8.23737E-6
16-20803611-TTGC-T p.Ala504del disruptive_inframe_deletion ACSM3 1 83198 1.20195E-5 41599 0 NA
16-20803611-T-C p.Val503Ala missense ACSM3 1 83200 1.20192E-5 41600 0 6.36821E-5
16-20803616-G-A p.Glu505Lys missense ACSM3 2 83170 2.40471E-5 41585 0 9.5511E-5
16-20803620-C-T p.Ser506Leu missense ACSM3 1 83156 1.20256E-5 41578 0 3.98061E-6
16-20803628-G-A p.Val509Ile missense ACSM3 1 83124 1.20302E-5 41562 0 NA
16-20803634-A-G p.Ser511Gly missense ACSM3 1 83084 1.2036E-5 41542 0 NA
16-20803643-C-T p.Pro514Ser missense ACSM3 2 83034 2.40865E-5 41517 0 8.23995E-6
16-20803648-C-CA p.Arg516fs frameshift ACSM3 1 82992 1.20494E-5 41496 0 NA
16-20803659-T-C c.1554+2T>C splice_donor ACSM3 4 82810 4.83033E-5 41405 0 NA
16-20807449-A-G n.47+3A>G splice_region ACSM3 108 38210 0.00282649 19105 0 0.00570136
16-20807454-C-T n.47+8C>T splice_region ACSM3 3 40660 7.37826E-5 20330 0 4.14118E-4
16-20807685-A-G c.1555-7A>G splice_region ACSM3 10 83042 1.20421E-4 41521 0 0.001875
16-20807692-G-T p.Val519Leu missense+splice_region ACSM3 3 83064 3.61167E-5 41532 0 3.74745E-4
16-20807709-C-T p.Val524Val synonymous ACSM3 7 83072 8.42643E-5 41536 0 2.23029E-4
16-20807710-G-A p.Val525Ile missense ACSM3 24 83078 2.88885E-4 41539 0 2.86624E-4
16-20807710-G-T p.Val525Phe missense ACSM3 1 83078 1.20369E-5 41539 0 NA
16-20807726-A-G p.Tyr530Cys missense ACSM3 1 83064 1.20389E-5 41532 0 NA
16-20807728-A-T p.Lys531* stop_gained ACSM3 1 83062 1.20392E-5 41531 0 2.48049E-5
16-20807736-T-A p.His533Gln missense ACSM3 1 83070 1.2038E-5 41535 0 3.18431E-5
16-20807768-A-G p.Glu544Gly missense ACSM3 1 82936 1.20575E-5 41468 0 8.27061E-6
16-20807781-A-G p.Lys548Lys synonymous ACSM3 1 82878 1.20659E-5 41439 0 7.97455E-6
16-20807786-C-T p.Thr550Ile missense ACSM3 1 82852 1.20697E-5 41426 0 NA
16-20807796-C-T p.Tyr553Tyr synonymous ACSM3 1 82742 1.20858E-5 41371 0 NA
16-20807810-A-C p.Lys558Thr missense+splice_region ACSM3 2 82558 2.42254E-5 41279 0 NA
16-20807815-G-GAATTTATTCAA c.1674+4_1674+5insAATTTATTCAA splice_region ACSM3 1 82424 1.21324E-5 41212 0 NA
16-20808209-T-C p.Val559Ala missense+splice_region ACSM3 1 83164 1.20244E-5 41582 0 6.37308E-5
16-20808215-T-A p.Phe561Tyr missense ACSM3 1 83190 1.20207E-5 41595 0 NA
16-20808219-T-C p.Ile562Ile synonymous ACSM3 3 83200 3.60577E-5 41600 0 9.55353E-5
16-20808223-G-C p.Glu564Gln missense ACSM3 2 83206 2.40367E-5 41603 0 NA
16-20808241-A-G p.Ser570Gly missense ACSM3 1 83236 1.2014E-5 41618 0 3.18512E-5
16-20808269-GGAA-G p.Lys581del disruptive_inframe_deletion ACSM3 2 83268 2.40188E-5 41634 0 1.73433E-4
16-20808279-A-G p.Glu582Glu synonymous ACSM3 1 83248 1.20123E-5 41624 0 7.98882E-6
16-20808285-G-A p.Lys584Lys synonymous ACSM3 1 83248 1.20123E-5 41624 0 0.00100806
16-20808288-A-G p.Thr585Thr synonymous ACSM3 4 83236 4.80561E-5 41618 0 2.23015E-4