Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
10-114135260-G-A c.-70G>A 5_prime_UTR_premature_start_codon_gain ACSL5 8 2896 0.00276243 1448 0 0.0116931
10-114135302-T-TCTGAATTTCCTGCTGCTGTTCACAA c.-30+2_-30+3insCTGAATTTCCTGCTGCTGTTCACAA splice_region ACSL5 1 2926 3.41763E-4 1463 0 NA
10-114135302-T-TCTGAATTTCCTGCTGCTGTTCACAAAG c.-30+2_-30+3insCTGAATTTCCTGCTGCTGTTCACAAAG splice_region ACSL5 2 2926 6.83527E-4 1463 1 NA
10-114135302-T-TCTGAATTTCCTGCTGCTGTTCACA c.-30+2_-30+3insCTGAATTTCCTGCTGCTGTTCACA splice_region ACSL5 2 2926 6.83527E-4 1463 1 NA
10-114135978-C-T c.-258C>T 5_prime_UTR_premature_start_codon_gain ACSL5 346 81792 0.00423024 40896 5 0.00807224
10-114136011-C-G c.-225C>G 5_prime_UTR_premature_start_codon_gain ACSL5 2 82994 2.40981E-5 41497 0 NA
10-114136053-C-T c.-183C>T 5_prime_UTR_premature_start_codon_gain ACSL5 1 83256 1.20111E-5 41628 0 NA
10-114136073-C-T c.-163C>T 5_prime_UTR_premature_start_codon_gain ACSL5 19 83306 2.28075E-4 41653 0 2.1878E-4
10-114136074-G-A p.Ala3Thr missense ACSL5 2 83308 2.40073E-5 41654 0 6.25E-4
10-114136075-C-T p.Ala3Val missense ACSL5 4 83312 4.80123E-5 41656 0 8.24334E-6
10-114136083-C-G p.Pro6Ala missense ACSL5 1 83316 1.20025E-5 41658 0 NA
10-114136102-A-G p.Asn12Ser missense ACSL5 1 83336 1.19996E-5 41668 0 8.23913E-6
10-114136103-C-A p.Asn12Lys missense ACSL5 1 83328 1.20008E-5 41664 0 8.23927E-6
10-114136106-C-T c.-130C>T 5_prime_UTR_premature_start_codon_gain ACSL5 2 83328 2.40015E-5 41664 0 5.03525E-4
10-114136107-G-A p.Glu14Lys missense ACSL5 3 83326 3.60032E-5 41663 0 5.03525E-4
10-114136110-C-T p.Arg15* stop_gained ACSL5 1 83324 1.20013E-5 41662 0 1.98826E-5
10-114136111-G-A p.Arg15Gln missense ACSL5 1 83332 1.20002E-5 41666 0 5.03525E-4
10-114136127-G-C p.Arg20Ser missense ACSL5 2 83344 2.39969E-5 41672 0 3.97649E-6
10-114136130-C-T p.Asp21Asp synonymous ACSL5 1 83346 1.19982E-5 41673 0 3.97646E-6
10-114136132-C-T p.Ser22Leu missense ACSL5 3 83338 3.5998E-5 41669 0 1.48304E-4
10-114136133-G-A c.-103G>A 5_prime_UTR_premature_start_codon_gain ACSL5 3 83340 3.59971E-5 41670 0 1.27247E-4
10-114136133-G-T c.-103G>T 5_prime_UTR_premature_start_codon_gain ACSL5 2 83340 2.39981E-5 41670 0 NA
10-114136144-A-G p.Lys26Arg missense ACSL5 2 83334 2.39998E-5 41667 0 NA
10-114136154-G-T p.Glu29Asp missense ACSL5 25 83324 3.00034E-4 41662 0 3.82531E-4
10-114136155-C-T p.Pro30Ser missense ACSL5 4 83320 4.80077E-5 41660 0 5.96507E-5
10-114136157-G-A p.Pro30Pro synonymous ACSL5 1 83318 1.20022E-5 41659 0 0.00100705
10-114136163-C-G p.Ser32Arg missense ACSL5 1 83296 1.20054E-5 41648 0 5.03525E-4
10-114136173-C-T p.Leu36Leu synonymous ACSL5 1 83294 1.20057E-5 41647 0 1.98866E-5
10-114136175-A-G c.-61A>G 5_prime_UTR_premature_start_codon_gain ACSL5 1 83298 1.20051E-5 41649 0 NA
10-114136187-A-AGAT p.Asp41dup disruptive_inframe_insertion ACSL5 4 83282 4.80296E-5 41641 0 5.77977E-5
10-114136190-T-C p.Asp41Asp synonymous ACSL5 2 83274 2.40171E-5 41637 0 7.95817E-6
10-114136191-G-T p.Ala42Ser missense ACSL5 26 83260 3.12275E-4 41630 0 7.64721E-4
10-114136192-C-T p.Ala42Val missense ACSL5 28 83252 3.36328E-4 41626 0 5.10009E-4
10-114136193-G-A p.Ala42Ala synonymous ACSL5 1 83248 1.20123E-5 41624 0 4.13278E-5
10-114136196-C-T p.Ala43Ala synonymous ACSL5 210 83202 0.00252398 41601 1 0.00177141
10-114136202-G-A p.Ser45Ser synonymous ACSL5 68 83104 8.18252E-4 41552 1 0.00352467
10-114136202-G-T p.Ser45Ser synonymous ACSL5 1 83104 1.20331E-5 41552 0 NA
10-114136208-T-C c.-30+2T>C splice_donor ACSL5 1 83100 1.20337E-5 41550 0 NA
10-114136213-G-C c.-30+7G>C splice_region ACSL5 4 83104 4.81325E-5 41552 0 8.30648E-6
10-114136213-G-A c.-30+7G>A splice_region ACSL5 3 83104 3.60993E-5 41552 0 NA
10-114154689-G-C p.Leu51Leu synonymous ACSL5 2 83268 2.40188E-5 41634 0 NA
10-114154698-C-T p.Phe54Phe synonymous ACSL5 1 83316 1.20025E-5 41658 0 9.59939E-5
10-114154707-G-A p.Met1? start_lost ACSL5 1 83352 1.19973E-5 41676 0 NA
10-114154743-G-A p.Pro13Pro synonymous ACSL5 9 83380 1.0794E-4 41690 0 1.07434E-4
10-114154744-AC-A p.Pro15fs frameshift ACSL5 2 83376 2.39877E-5 41688 0 3.22893E-5
10-114154748-C-T p.Pro15Leu missense ACSL5 3 83382 3.5979E-5 41691 0 5.03525E-4
10-114154749-G-A p.Pro15Pro synonymous ACSL5 4 83378 4.79743E-5 41689 0 5.03525E-4
10-114154751-C-T p.Ala16Val missense ACSL5 1 83378 1.19936E-5 41689 0 6.37755E-5
10-114154752-G-A p.Ala16Ala synonymous ACSL5 1392 83352 0.0167003 41676 24 0.01625
10-114154788-C-G p.Phe28Leu missense ACSL5 34 83336 4.07987E-4 41668 0 0.00124275
10-114154792-T-C p.Trp30Arg missense ACSL5 3 83326 3.60032E-5 41663 0 3.18674E-5
10-114154793-G-A p.Trp30* stop_gained ACSL5 3 83328 3.60023E-5 41664 0 3.97893E-6
10-114154807-C-A p.Pro35Thr missense ACSL5 2 83300 2.40096E-5 41650 0 1.64799E-5
10-114154810-C-A p.Gln36Lys missense ACSL5 1 83290 1.20062E-5 41645 0 NA
10-114154812-A-G p.Gln36Gln synonymous ACSL5 1 83280 1.20077E-5 41640 0 NA
10-114154815-C-T p.Pro37Pro synonymous ACSL5 8179 83072 0.0984568 41536 423 0.0977912
10-114154816-G-A p.Val38Ile missense ACSL5 3 83264 3.603E-5 41632 0 2.38808E-5
10-114154821-A-G p.Leu39Leu synonymous ACSL5 1 83248 1.20123E-5 41624 0 6.38081E-5
10-114154823-C-A p.Pro40His missense ACSL5 92 83234 0.00110532 41617 1 0.00280505
10-114154831-G-C p.Asp43His missense ACSL5 1 83198 1.20195E-5 41599 0 6.25E-4
10-114154833-C-T p.Asp43Asp synonymous ACSL5 1 83182 1.20218E-5 41591 0 NA
10-114154865-T-C c.156+5T>C splice_region ACSL5 1 82898 1.2063E-5 41449 0 NA
10-114158662-G-A p.Gly54Arg missense ACSL5 1 83064 1.20389E-5 41532 0 NA
10-114158678-T-A p.Val59Asp missense ACSL5 1 83138 1.20282E-5 41569 0 8.2371E-6
10-114158683-CAGA-C p.Lys62del disruptive_inframe_deletion ACSL5 2 83142 2.40552E-5 41571 0 1.31789E-4
10-114158690-A-T p.Asn63Ile missense ACSL5 1 83166 1.20241E-5 41583 0 NA
10-114158695-G-A p.Asp65Asn missense ACSL5 1 83160 1.2025E-5 41580 0 NA
10-114158702-C-T p.Thr67Ile missense ACSL5 1 83156 1.20256E-5 41578 0 3.97706E-6
10-114158705-G-C p.Ser68Thr missense ACSL5 5 83156 6.0128E-5 41578 0 1.19311E-5
10-114158708-G-A p.Cys69Tyr missense ACSL5 1 83148 1.20267E-5 41574 0 1.19314E-5
10-114158726-A-AGACTAT p.Thr76_Met77dup conservative_inframe_insertion ACSL5 6 83090 7.22109E-5 41545 0 4.77262E-5
10-114158732-T-C p.Met77Thr missense ACSL5 28 83060 3.37106E-4 41530 0 0.00100806
10-114158758-G-A p.Ala86Thr missense ACSL5 1 82776 1.20808E-5 41388 0 1.99008E-5
10-114158763-G-A p.Val87Val synonymous ACSL5 1 82712 1.20901E-5 41356 0 NA
10-114158767-G-GACAATGGGCCCTGCTTGGGATATA c.265_265+1insACAATGGGCCCTGCTTGGGATATA splice_donor ACSL5 2 82646 2.41996E-5 41323 0 NA
10-114158769-T-C c.265+2T>C splice_donor ACSL5 1 82600 1.21065E-5 41300 0 NA
10-114164262-T-C c.266-7T>C splice_region ACSL5 1 82248 1.21584E-5 41124 0 NA
10-114164273-T-G p.Asn90Lys missense ACSL5 1 82422 1.21327E-5 41211 0 1.71424E-5
10-114164276-G-A p.Gly91Gly synonymous ACSL5 6 82454 7.27678E-5 41227 0 4.2567E-5
10-114164287-G-A p.Gly95Glu missense ACSL5 1 82484 1.21236E-5 41242 0 NA
10-114164298-C-A p.Pro99Thr missense ACSL5 1 82404 1.21353E-5 41202 0 2.22916E-4
10-114164308-C-G p.Pro102Arg missense ACSL5 3 82400 3.64078E-5 41200 0 NA
10-114164323-C-G p.Ser107Cys missense ACSL5 2 82326 2.42937E-5 41163 0 NA
10-114164328-A-G p.Lys109Glu missense ACSL5 1 82294 1.21516E-5 41147 0 NA
10-114164331-CAGGTAAGTTGAGTCCATGTTTTTAGACAGATTCTTTCTAACATAGTATTCTGAACTACAGGATACGATATTGGTCAGTTTTTGGTCTTGACCTCTTCTCTCTCTCTCTCACCCCATCTCTCTTTTTTGT-C p.Gln110fs frameshift ACSL5 10 82250 1.21581E-4 41125 3 NA
10-114164473-G-C p.Arg114Thr missense ACSL5 1 82770 1.20817E-5 41385 0 NA
10-114164475-G-A p.Ala115Thr missense ACSL5 3 82794 3.62345E-5 41397 0 3.18634E-5
10-114164488-GT-G p.Ser120fs frameshift ACSL5 1 82806 1.20764E-5 41403 0 3.98216E-6
10-114164537-C-T p.Val135Val synonymous ACSL5 11 82528 1.33288E-4 41264 0 5.04032E-4
10-114164538-G-A p.Gly136Ser missense ACSL5 2 82492 2.42448E-5 41246 0 1.65E-5
10-114164541-A-G p.Ile137Val missense ACSL5 10 82456 1.21277E-4 41228 0 2.22916E-4
10-114164563-A-AGTGGATCATCTCCGAATTGGCTTGTTACACGTACTCTAT c.432_432+1insTGGATCATCTCCGAATTGGCTTGTTACACGTACTCTATG splice_donor ACSL5 2 82008 2.43879E-5 41004 1 NA
10-114164564-G-GTGGATCATCTCCGAATTGGCTTGTTACACGTACTCTATGGTAGCT c.432_432+1insTGGATCATCTCCGAATTGGCTTGTTACACGTACTCTATGGTAGCT splice_donor ACSL5 5 81978 6.0992E-5 40989 2 NA
10-114164570-T-G c.432+6T>G splice_region ACSL5 2 81756 2.4463E-5 40878 0 8.2824E-6
10-114164572-T-C c.432+8T>C splice_region ACSL5 1 81700 1.22399E-5 40850 0 8.09795E-6
10-114168174-G-A c.433-6G>A splice_region ACSL5 1 82374 1.21398E-5 41187 0 4.94552E-5
10-114168178-A-G c.433-2A>G splice_acceptor ACSL5 1 82476 1.21247E-5 41238 0 NA
10-114168182-G-A p.Trp145* stop_gained ACSL5 3 82582 3.63275E-5 41291 0 1.98923E-5
10-114168191-C-T p.Ser148Ser synonymous ACSL5 3 82660 3.62932E-5 41330 0 3.29592E-5
10-114168208-C-T p.Thr154Met missense ACSL5 4 82760 4.83325E-5 41380 0 4.37508E-5
10-114168209-G-A p.Thr154Thr synonymous ACSL5 1 82748 1.20849E-5 41374 0 2.78427E-5
10-114168228-C-G p.Pro161Ala missense ACSL5 2 82784 2.41593E-5 41392 0 3.18776E-5
10-114168249-C-T p.Pro168Ser missense ACSL5 1 82714 1.20899E-5 41357 0 NA
10-114168253-A-G p.Glu169Gly missense ACSL5 1 82684 1.20942E-5 41342 0 NA
10-114168258-A-G p.Ile171Val missense ACSL5 5 82600 6.05327E-5 41300 0 6.37633E-5
10-114168260-C-T p.Ile171Ile synonymous ACSL5 12 82562 1.45345E-4 41281 0 3.54283E-4
10-114168261-G-A p.Val172Ile missense ACSL5 1 82558 1.21127E-5 41279 0 4.37585E-5
10-114169257-G-A c.533-8G>A splice_region ACSL5 1 82664 1.20972E-5 41332 0 8.26692E-6
10-114169261-C-T c.533-4C>T splice_region ACSL5 1 82764 1.20825E-5 41382 0 4.95712E-5
10-114169273-G-A p.Ala181Thr missense ACSL5 6 82984 7.23031E-5 41492 0 4.38226E-5
10-114169276-A-G p.Met182Val missense ACSL5 8152 82782 0.0984755 41391 428 0.0979967
10-114169290-C-G p.Asp186Glu missense ACSL5 1 83210 1.20178E-5 41605 0 NA
10-114169309-G-T p.Val193Leu missense ACSL5 7 83276 8.40578E-5 41638 0 1.82987E-4
10-114169313-T-C p.Leu194Pro missense ACSL5 1 83276 1.20083E-5 41638 0 NA
10-114169316-T-C p.Ile195Thr missense ACSL5 1 83268 1.20094E-5 41634 0 NA
10-114169336-T-C p.Phe202Leu missense ACSL5 2 83262 2.40206E-5 41631 0 8.23737E-6
10-114169340-C-T p.Thr203Ile missense ACSL5 21 83258 2.52228E-4 41629 0 6.76213E-5
10-114169341-C-A p.Thr203Thr synonymous ACSL5 1 83252 1.20117E-5 41626 0 3.97763E-6
10-114169343-C-T p.Pro204Leu missense ACSL5 5 83258 6.00543E-5 41629 0 6.25E-4
10-114169344-G-A p.Pro204Pro synonymous ACSL5 5 83254 6.00572E-5 41627 0 9.55779E-5
10-114169346-G-T p.Ser205Ile missense ACSL5 1 83266 1.20097E-5 41633 0 NA
10-114169346-GC-CA p.Ser205Thr missense ACSL5 1 83266 1.20097E-5 41633 0 NA
10-114169353-G-A p.Lys207Lys synonymous ACSL5 8 83256 9.60892E-5 41628 0 5.931E-4
10-114169355-T-A p.Val208Glu missense ACSL5 1 83256 1.20111E-5 41628 0 1.6475E-5
10-114169360-A-G p.Ile210Val missense ACSL5 2 83256 2.40223E-5 41628 0 NA
10-114169371-C-T p.Asp213Asp synonymous ACSL5 2 83240 2.40269E-5 41620 0 8.23737E-6
10-114169377-T-C p.Phe215Phe synonymous ACSL5 3 83244 3.60386E-5 41622 0 1.19325E-5
10-114169395-A-C p.Gln221His missense ACSL5 2 83242 2.40263E-5 41621 0 NA
10-114169402-G-A p.Glu224Lys missense ACSL5 4 83226 4.80619E-5 41613 0 2.38686E-5
10-114169418-A-T p.Glu229Val missense ACSL5 1 83218 1.20166E-5 41609 0 3.97934E-6
10-114169424-T-C p.Leu231Ser missense ACSL5 2 83214 2.40344E-5 41607 0 3.18431E-5
10-114169424-T-A p.Leu231* stop_gained ACSL5 2 83214 2.40344E-5 41607 0 NA
10-114169437-T-A p.Asp235Glu missense ACSL5 1 83190 1.20207E-5 41595 0 3.98587E-6
10-114169440-T-A p.Ala236Ala synonymous ACSL5 3 83176 3.60681E-5 41588 0 7.44269E-5
10-114169441-G-A p.Glu237Lys missense+splice_region ACSL5 1 83170 1.20236E-5 41585 0 3.9875E-6
10-114169443-G-GTACCTGATT c.711_711+1insTACCTGATT splice_donor ACSL5 1 83172 1.20233E-5 41586 0 3.99033E-6
10-114169444-G-A c.711+1G>A splice_donor ACSL5 2 83154 2.40518E-5 41577 0 8.28034E-6
10-114170042-T-G p.Met1? start_lost ACSL5 2 77194 2.59088E-5 38597 0 3.18654E-5
10-114170046-C-G p.Leu2Leu synonymous ACSL5 1 77994 1.28215E-5 38997 0 NA
10-114170055-G-C p.Gly5Gly synonymous ACSL5 2 79118 2.52787E-5 39559 0 7.11339E-5
10-114170085-G-A p.Leu15Leu synonymous ACSL5 7 81180 8.62281E-5 40590 0 2.40316E-4
10-114170094-C-T p.Ile18Ile synonymous ACSL5 5 81582 6.1288E-5 40791 0 5.956E-6
10-114170097-G-T p.Gln19His missense+splice_region ACSL5 2 81724 2.44726E-5 40862 0 NA
10-114170098-G-A c.57+1G>A splice_donor ACSL5 8 81764 9.78426E-5 40882 0 6.37308E-5
10-114170100-T-G c.57+3T>G splice_region ACSL5 1 81842 1.22187E-5 40921 0 NA
10-114170233-G-C p.Glu242Gln missense ACSL5 1 83310 1.20034E-5 41655 0 3.97826E-6
10-114170235-G-A p.Glu242Glu synonymous ACSL5 1 83308 1.20036E-5 41654 0 NA
10-114170252-TGGTAAGTTTTCTTCTGCCTGAATTTGAGCCTTGCCATAGTCAACTCTCAAAGTTCATGGTGGAATAAGCCCTTGTGCTTCCTCCTCCA-T p.Pro249fs frameshift ACSL5 2 83298 2.40102E-5 41649 0 NA
10-114170258-G-C c.744+5G>C splice_region ACSL5 1 83300 1.20048E-5 41650 0 NA
10-114170260-T-C c.744+7T>C splice_region ACSL5 2 83302 2.4009E-5 41651 0 1.65082E-5
10-114170350-C-G p.Ser251Arg missense ACSL5 1 83216 1.20169E-5 41608 0 3.3465E-5
10-114170351-C-G p.Pro252Ala missense ACSL5 5 83210 6.00889E-5 41605 0 3.98038E-6
10-114170362-G-C p.Leu255Leu synonymous ACSL5 1 83150 1.20265E-5 41575 0 NA
10-114170365-C-T p.Ser256Ser synonymous ACSL5 3 83114 3.6095E-5 41557 0 3.18674E-5
10-114170366-G-A p.Val257Ile missense ACSL5 12 83104 1.44397E-4 41552 0 1.19495E-4
10-114170386-G-T p.Gly263Gly synonymous ACSL5 2 82870 2.41342E-5 41435 0 3.99361E-6
10-114171208-CT-C c.797-5delT splice_region ACSL5 1 82570 1.21109E-5 41285 0 9.55475E-5
10-114171217-A-C p.Asp267Ala missense ACSL5 1 82716 1.20896E-5 41358 0 NA
10-114171229-C-G p.Ala271Gly missense ACSL5 1 82852 1.20697E-5 41426 0 NA
10-114171255-T-G p.Ser280Ala missense ACSL5 3 82882 3.6196E-5 41441 0 NA
10-114171280-G-A p.Cys288Tyr missense ACSL5 1 82738 1.20863E-5 41369 0 NA
10-114171290-C-T c.870+3C>T splice_region ACSL5 1 82620 1.21036E-5 41310 0 3.98029E-6
10-114171655-C-T c.871-5C>T splice_region ACSL5 1 79370 1.25992E-5 39685 0 3.18471E-5
10-114171676-C-A p.Thr296Asn missense ACSL5 1 80456 1.24292E-5 40228 0 1.64745E-5
10-114171678-C-G p.Pro297Ala missense ACSL5 1 80546 1.24153E-5 40273 0 3.9794E-6
10-114171686-T-C p.Asp299Asp synonymous ACSL5 1 80750 1.23839E-5 40375 0 1.19367E-5
10-114171727-G-T p.Arg313Met missense ACSL5 1 80990 1.23472E-5 40495 0 2.38675E-5
10-114171733-T-C p.Val315Ala missense ACSL5 5 80826 6.18613E-5 40413 0 3.18431E-5
10-114171736-A-G p.Gln316Arg missense+splice_region ACSL5 1 80724 1.23879E-5 40362 0 NA
10-114172923-G-A c.949-8G>A splice_region ACSL5 1 83348 1.19979E-5 41674 0 3.98473E-6
10-114172938-T-C p.Val319Ala missense ACSL5 1 83408 1.19893E-5 41704 0 3.97785E-6
10-114172941-A-G p.Tyr320Cys missense ACSL5 1 83408 1.19893E-5 41704 0 NA
10-114172976-G-T p.Asp332Tyr missense ACSL5 1 83422 1.19872E-5 41711 0 3.18117E-5
10-114172982-C-T p.Arg334Trp missense ACSL5 1 83416 1.19881E-5 41708 0 2.47133E-5
10-114172983-G-A p.Arg334Gln missense ACSL5 4 83418 4.79513E-5 41709 0 8.59708E-4
10-114172984-G-A p.Arg334Arg synonymous ACSL5 1 83420 1.19875E-5 41710 0 NA
10-114172991-G-A p.Ala337Thr missense ACSL5 1 83422 1.19872E-5 41711 0 NA
10-114173000-A-T p.Met340Leu missense ACSL5 1 83414 1.19884E-5 41707 0 2.47109E-5
10-114173001-T-C p.Met340Thr missense ACSL5 1 83414 1.19884E-5 41707 0 3.97643E-6
10-114173002-G-A p.Met340Ile missense ACSL5 1 83416 1.19881E-5 41708 0 1.19294E-5
10-114173007-C-CAGATA p.Leu343fs frameshift ACSL5 1 83416 1.19881E-5 41708 0 NA
10-114173020-A-G p.Thr346Thr synonymous ACSL5 3 83414 3.59652E-5 41707 0 3.97636E-6
10-114173029-C-T p.Pro349Pro synonymous ACSL5 13 83408 1.5586E-4 41704 0 5.56731E-5
10-114173030-G-A p.Ala350Thr missense ACSL5 1 83414 1.19884E-5 41707 0 2.47145E-5
10-114173031-C-T p.Ala350Val missense ACSL5 16 83410 1.91824E-4 41705 0 0.0025
10-114173032-G-A p.Ala350Ala synonymous ACSL5 3 83412 3.5966E-5 41706 0 1.64761E-5
10-114173042-C-T p.Leu354Phe missense ACSL5 2 83390 2.39837E-5 41695 0 1.64775E-5
10-114173052-G-T p.Arg357Met missense ACSL5 2 83382 2.3986E-5 41691 0 NA
10-114173058-A-G p.Tyr359Cys missense ACSL5 1 83366 1.19953E-5 41683 0 3.18512E-5
10-114173059-C-T p.Tyr359Tyr synonymous ACSL5 7 83356 8.39772E-5 41678 0 4.37574E-5
10-114173060-G-C p.Asp360His missense ACSL5 1 83354 1.1997E-5 41677 0 NA
10-114173070-T-C c.1083+5T>C splice_region ACSL5 3 83344 3.59954E-5 41672 0 NA
10-114176648-A-G p.Val362Val splice_region+synonymous ACSL5 1 83316 1.20025E-5 41658 0 3.97697E-6
10-114176651-A-G p.Gln363Gln synonymous ACSL5 1 83326 1.20011E-5 41663 0 4.12086E-5
10-114176677-A-G p.Lys372Arg missense ACSL5 4 83368 4.798E-5 41684 1 1.19298E-5
10-114176683-T-C p.Leu374Ser missense ACSL5 2 83372 2.39889E-5 41686 0 1.64745E-5
10-114176693-G-A p.Leu377Leu synonymous ACSL5 387 83360 0.00464251 41680 4 0.00924686
10-114176693-G-C p.Leu377Leu synonymous ACSL5 4 83368 4.798E-5 41684 0 3.18857E-5
10-114176715-G-A p.Glu385Lys missense ACSL5 2 83376 2.39877E-5 41688 0 9.56877E-5
10-114176723-A-G p.Gln387Gln synonymous ACSL5 1 83380 1.19933E-5 41690 0 8.2371E-6
10-114176732-C-T p.Ile390Ile synonymous ACSL5 1 83380 1.19933E-5 41690 0 8.23723E-6
10-114176744-T-C p.Asp394Asp synonymous ACSL5 2 83368 2.399E-5 41684 0 2.78354E-5
10-114176760-C-T p.Leu400Phe missense ACSL5 1 83354 1.1997E-5 41677 0 8.23913E-6
10-114177607-A-C p.Ser408Arg missense ACSL5 1 83354 1.1997E-5 41677 0 3.18431E-5
10-114177615-C-T p.Gly410Gly synonymous ACSL5 1 83356 1.19967E-5 41678 0 5.76815E-5
10-114177616-G-A p.Gly411Arg missense ACSL5 283 83344 0.00339557 41672 1 0.0130916
10-114177620-G-GGGTTC p.Val415fs frameshift ACSL5 1 83362 1.19959E-5 41681 0 NA
10-114177625-C-T p.Arg414Cys missense ACSL5 1 83378 1.19936E-5 41689 0 1.64818E-5
10-114177625-C-A p.Arg414Ser missense ACSL5 3 83378 3.59807E-5 41689 0 5.03525E-4
10-114177626-G-A p.Arg414His missense ACSL5 3 83378 3.59807E-5 41689 0 4.9447E-5
10-114177631-A-G p.Ile416Val missense ACSL5 1 83382 1.1993E-5 41691 0 3.97928E-6
10-114177651-C-T p.Pro422Pro synonymous ACSL5 1 83380 1.19933E-5 41690 0 NA
10-114177654-G-A p.Met423Ile missense ACSL5 1 83386 1.19924E-5 41693 0 NA
10-114177663-A-G p.Ser426Ser synonymous ACSL5 2 83382 2.3986E-5 41691 0 8.26351E-6
10-114177669-G-A p.Met428Ile missense ACSL5 1 83372 1.19944E-5 41686 0 NA
10-114177688-A-G p.Met435Val missense ACSL5 1 83336 1.19996E-5 41668 0 NA
10-114177689-T-C p.Met435Thr missense ACSL5 1 83332 1.20002E-5 41666 0 NA
10-114177705-C-A c.1314+6C>A splice_region ACSL5 2 83254 2.40229E-5 41627 0 NA
10-114181346-C-T c.1315-5C>T splice_region ACSL5 1 83138 1.20282E-5 41569 0 NA
10-114181346-C-A c.1315-5C>A splice_region ACSL5 1 83138 1.20282E-5 41569 0 3.18471E-5
10-114181355-A-T p.Tyr440Phe missense ACSL5 50 83188 6.01048E-4 41594 0 0.00111451
10-114181365-T-C p.Tyr443Tyr synonymous ACSL5 2 83230 2.40298E-5 41615 0 3.29484E-5
10-114181374-A-T p.Thr446Thr synonymous ACSL5 5 83242 6.00658E-5 41621 0 1.98831E-5
10-114181401-A-G p.Thr455Thr synonymous ACSL5 1 83216 1.20169E-5 41608 0 1.98834E-5
10-114181417-A-G p.Thr461Ala missense ACSL5 2 83160 2.405E-5 41580 0 3.1839E-5
10-114181418-C-T p.Thr461Ile missense ACSL5 5 83150 6.01323E-5 41575 0 8.23845E-6
10-114181424-G-A c.1387+1G>A splice_donor ACSL5 1 83108 1.20325E-5 41554 0 NA
10-114181698-G-A c.1388-7G>A splice_region ACSL5 1 83234 1.20143E-5 41617 0 NA
10-114181708-A-G p.His464Arg missense ACSL5 2 83268 2.40188E-5 41634 0 3.18492E-5
10-114181709-C-T p.His464His synonymous ACSL5 3 83270 3.60274E-5 41635 0 6.36862E-5
10-114181710-G-A p.Val465Ile missense ACSL5 1 83272 1.20088E-5 41636 0 1.59072E-5
10-114181710-G-C p.Val465Leu missense ACSL5 2 83272 2.40177E-5 41636 0 NA
10-114181736-C-T p.Tyr473Tyr synonymous ACSL5 7 83326 8.40074E-5 41663 0 9.06081E-5
10-114181737-G-A p.Val474Met missense ACSL5 1 83328 1.20008E-5 41664 0 3.29478E-5
10-114181773-A-G p.Thr486Ala missense ACSL5 531 83292 0.00637516 41646 8 0.0130246
10-114181775-A-G p.Thr486Thr synonymous ACSL5 1 83306 1.20039E-5 41653 0 1.64742E-5
10-114181778-G-T p.Val487Val synonymous ACSL5 1 83304 1.20042E-5 41652 0 NA
10-114181782-A-G p.Asn489Asp missense ACSL5 3 83286 3.60205E-5 41643 0 NA
10-114181800-A-G c.1476+7A>G splice_region ACSL5 1 83250 1.2012E-5 41625 0 NA
10-114182069-TGTCTGCTGTG-T c.1477-13_1477-4delGTCTGCTGTG splice_region ACSL5 26 83086 3.12929E-4 41543 0 2.16202E-4
10-114182076-T-C c.1477-7T>C splice_region ACSL5 2 83098 2.4068E-5 41549 0 8.0098E-6
10-114182103-C-T p.Asn499Asn synonymous ACSL5 2 83274 2.40171E-5 41637 0 2.47443E-5
10-114182104-G-A p.Val500Met missense ACSL5 3 83270 3.60274E-5 41635 0 9.55718E-5
10-114182108-T-G p.Phe501Cys missense ACSL5 3 83282 3.60222E-5 41641 0 5.03525E-4
10-114182111-A-T p.Lys502Ile missense ACSL5 1 83302 1.20045E-5 41651 0 3.97833E-6
10-114182112-A-C p.Lys502Asn missense ACSL5 1 83304 1.20042E-5 41652 0 NA
10-114182129-C-T p.Pro508Leu missense ACSL5 1 83312 1.20031E-5 41656 0 2.47223E-5
10-114182142-G-C p.Gln512His missense ACSL5 1 83328 1.20008E-5 41664 0 6.37105E-5
10-114182154-C-T p.Asp516Asp synonymous ACSL5 2 83324 2.40027E-5 41662 0 NA
10-114182181-C-T p.Asp525Asp synonymous ACSL5 1 83294 1.20057E-5 41647 0 NA
10-114182183-T-C p.Ile526Thr missense ACSL5 1 83288 1.20065E-5 41644 0 1.65123E-5
10-114182189-G-A p.Arg528His missense ACSL5 2 83260 2.40211E-5 41630 0 7.97308E-6
10-114182197-C-T p.Pro531Ser missense+splice_region ACSL5 1 83250 1.2012E-5 41625 0 NA
10-114182198-C-T p.Pro531Leu missense+splice_region ACSL5 2 83236 2.40281E-5 41618 0 3.19099E-5
10-114182199-G-A p.Pro531Pro splice_region+synonymous ACSL5 2 83206 2.40367E-5 41603 0 6.37064E-5
10-114182202-A-G c.1593+3A>G splice_region ACSL5 3 83178 3.60672E-5 41589 0 5.58802E-5
10-114185091-T-C c.1594-5T>C splice_region ACSL5 5 83134 6.01439E-5 41567 0 8.33597E-6
10-114185102-ACT-A p.Leu535fs frameshift ACSL5 2 83210 2.40356E-5 41605 0 NA
10-114185116-C-T p.Ile538Ile synonymous ACSL5 1 83208 1.20181E-5 41604 0 6.25E-4
10-114185121-G-A p.Arg540His missense ACSL5 3 83212 3.60525E-5 41606 0 3.29886E-5
10-114185151-G-C p.Gly550Ala missense ACSL5 2 83248 2.40246E-5 41624 0 NA
10-114185156-T-C p.Tyr552His missense ACSL5 1 83250 1.2012E-5 41625 0 8.24063E-6
10-114185162-G-A p.Ala554Thr missense ACSL5 2 83238 2.40275E-5 41619 0 1.19528E-5
10-114185175-T-C p.Ile558Thr missense ACSL5 10 83226 1.20155E-4 41613 0 1.03544E-4
10-114185182-T-C p.Asn560Asn synonymous ACSL5 25 83214 3.0043E-4 41607 0 0.0020141
10-114185187-A-G p.Tyr562Cys missense ACSL5 1 83210 1.20178E-5 41605 0 3.98375E-6
10-114185188-C-T p.Tyr562Tyr synonymous ACSL5 1 83212 1.20175E-5 41606 0 3.29734E-5
10-114185222-C-T p.His574Tyr missense ACSL5 2 83196 2.40396E-5 41598 0 8.01077E-6
10-114185224-C-T p.His574His synonymous ACSL5 6 83182 7.2131E-5 41591 0 0.00151057
10-114185231-A-C p.Ser577Arg missense ACSL5 1 83174 1.2023E-5 41587 0 8.10898E-6
10-114185237-C-T p.Arg579Trp missense+splice_region ACSL5 2 83086 2.40714E-5 41543 0 6.38366E-5
10-114185238-G-A p.Arg579Gln missense+splice_region ACSL5 2 83086 2.40714E-5 41543 0 3.19061E-5
10-114185238-G-T p.Arg579Leu missense+splice_region ACSL5 1 83086 1.20357E-5 41543 0 NA
10-114186009-T-A c.1738-7T>A splice_region ACSL5 1 82984 1.20505E-5 41492 0 3.58312E-5
10-114186034-G-A p.Val586Met missense ACSL5 1 83186 1.20213E-5 41593 0 6.36821E-5
10-114186050-A-C p.Asp591Ala missense ACSL5 2 83206 2.40367E-5 41603 0 NA
10-114186051-T-A p.Asp591Glu missense ACSL5 1 83224 1.20158E-5 41612 0 NA
10-114186065-T-C p.Phe596Ser missense ACSL5 1 83226 1.20155E-5 41613 0 NA
10-114186072-C-T p.Ala598Ala synonymous ACSL5 1 83234 1.20143E-5 41617 0 NA
10-114186099-G-A p.Glu607Glu synonymous ACSL5 1 83094 1.20346E-5 41547 0 3.97697E-6
10-114186102-A-G p.Glu608Glu synonymous ACSL5 2 83040 2.40848E-5 41520 0 3.18634E-5
10-114186365-C-T n.666C>T splice_region ACSL5 1 63298 1.57983E-5 31649 0 NA
10-114186552-A-G p.Arg616Gly missense ACSL5 1 82768 1.2082E-5 41384 0 NA
10-114186558-G-C p.Ala618Pro missense ACSL5 1 82802 1.2077E-5 41401 0 1.64753E-5
10-114186563-T-G p.Ile619Met missense ACSL5 1 82818 1.20747E-5 41409 0 NA
10-114186576-C-A p.Gln624Lys missense ACSL5 2 82854 2.41388E-5 41427 0 3.18431E-5
10-114186586-GGAAA-G p.Glu629fs frameshift ACSL5 1 82850 1.207E-5 41425 0 8.23764E-6
10-114186600-C-T p.Leu632Phe missense ACSL5 1 82802 1.2077E-5 41401 0 7.95501E-6
10-114186612-G-A p.Glu636Lys missense ACSL5 1 82756 1.20837E-5 41378 0 3.18532E-5
10-114186624-G-A c.1911+7G>A splice_region ACSL5 73463 78410 0.936909 39205 34440 0.98
10-114186624-G-T c.1911+7G>T splice_region ACSL5 1 82650 1.20992E-5 41325 0 NA
10-114186990-T-TCTTCATCCAGAGCCATTTTC p.Ile650fs frameshift ACSL5 1 83216 1.20169E-5 41608 0 NA
10-114187005-A-C p.Pro647Pro synonymous ACSL5 1 83222 1.20161E-5 41611 0 1.6542E-5
10-114187013-T-C p.Ile650Thr missense ACSL5 4 83236 4.80561E-5 41618 0 0.00100705
10-114187018-A-C p.Asn652His missense ACSL5 6 83254 7.20686E-5 41627 0 2.78907E-5
10-114187029-G-T p.Leu655Phe missense ACSL5 2 83252 2.40234E-5 41626 0 NA
10-114187036-A-C p.Thr658Pro missense ACSL5 1 83256 1.20111E-5 41628 0 1.98975E-5
10-114187039-T-C p.Leu659Leu synonymous ACSL5 6 83260 7.20634E-5 41630 0 4.12188E-5
10-114187051-C-T p.Arg663* stop_gained ACSL5 1 83252 1.20117E-5 41626 0 4.12283E-5
10-114187059-G-A p.Glu665Glu synonymous ACSL5 2 83256 2.40223E-5 41628 0 NA
10-114187066-A-C p.Lys668Gln missense ACSL5 17 83262 2.04175E-4 41631 0 0.00110674
10-114187075-C-T p.Arg671Trp missense ACSL5 2 83250 2.4024E-5 41625 0 6.37511E-5
10-114187075-C-A p.Arg671Arg synonymous ACSL5 1 83250 1.2012E-5 41625 0 2.47623E-5
10-114187076-G-A p.Arg671Gln missense ACSL5 1 83240 1.20135E-5 41620 0 6.60349E-5
10-114187092-C-T p.Ser676Ser synonymous ACSL5 2 83206 2.40367E-5 41603 0 3.18512E-5
10-114187102-C-G p.His680Asp missense ACSL5 1 83158 1.20253E-5 41579 0 3.18552E-5
10-114187104-C-T p.His680His synonymous ACSL5 11 83146 1.32297E-4 41573 0 5.03525E-4
10-114187111-G-T p.Asp683Tyr missense ACSL5 2 83098 2.4068E-5 41549 0 3.18593E-5