Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
4-185678290-T-G p.Ile696Leu missense ACSL1 1 83134 1.20288E-5 41567 0 3.1837E-5
4-185678290-T-C p.Ile696Val missense ACSL1 3 83134 3.60863E-5 41567 0 NA
4-185678296-A-T p.Ser694Thr missense ACSL1 1 83266 1.20097E-5 41633 0 NA
4-185678300-G-C p.Leu692Leu synonymous ACSL1 2 83258 2.40217E-5 41629 0 NA
4-185678311-T-C p.Ile689Val missense ACSL1 2 83262 2.40206E-5 41631 0 1.99008E-5
4-185678315-C-T p.Ser687Ser synonymous ACSL1 5 83244 6.00644E-5 41622 0 3.1839E-5
4-185678316-G-A p.Ser687Leu missense ACSL1 1 83228 1.20152E-5 41614 0 1.59213E-5
4-185678318-C-A p.Arg686Ser missense ACSL1 14 83250 1.68168E-4 41625 0 1.40218E-4
4-185678320-T-G p.Arg686Arg synonymous ACSL1 1 83254 1.20114E-5 41627 0 3.97953E-6
4-185678331-C-T p.Arg682Gln missense ACSL1 2 83210 2.40356E-5 41605 0 1.2738E-4
4-185678332-G-A p.Arg682Trp missense ACSL1 2 83198 2.4039E-5 41599 0 9.55353E-5
4-185678348-C-T p.Ala676Ala synonymous ACSL1 2 83164 2.40489E-5 41582 0 3.18451E-5
4-185678361-G-T p.Pro672Gln missense ACSL1 2 83150 2.40529E-5 41575 1 NA
4-185678376-T-C p.Asn667Ser missense ACSL1 1 83122 1.20305E-5 41561 0 6.25E-4
4-185678380-C-T p.Asp666Asn missense ACSL1 22 83084 2.64792E-4 41542 0 0.001875
4-185678785-A-C c.1956+4T>G splice_region ACSL1 2 82846 2.41412E-5 41423 0 1.20242E-5
4-185678800-GT-G p.Lys648fs frameshift ACSL1 2 82876 2.41324E-5 41438 0 NA
4-185678800-G-A p.Pro649Ser missense ACSL1 1 82876 1.20662E-5 41438 0 NA
4-185678837-T-C p.Glu636Glu synonymous ACSL1 1 82988 1.20499E-5 41494 0 8.24375E-6
4-185678839-C-T p.Glu636Lys missense ACSL1 1 82998 1.20485E-5 41499 0 3.98191E-6
4-185678840-G-A p.Leu635Leu synonymous ACSL1 76 82988 9.15795E-4 41494 1 0.00729671
4-185678840-G-C p.Leu635Leu synonymous ACSL1 1 82988 1.20499E-5 41494 0 NA
4-185678844-A-G p.Ile634Thr missense ACSL1 1 83002 1.20479E-5 41501 0 NA
4-185678848-C-A p.Ala633Ser missense ACSL1 1 83012 1.20465E-5 41506 0 NA
4-185678849-T-C p.Lys632Lys synonymous ACSL1 36 83034 4.33557E-4 41517 0 6.68619E-4
4-185678859-TCCTAAAAGGGTAAGAAAAATAAATTACTTCCTCTGTTAGAGGTCCCTGAATATCTACAGGTACATTTAATGCCAAGTTATGATGAGGACAGACTGGACCCTTCAGAACCTTA-T p.Asp629fs frameshift ACSL1 7 83064 8.42724E-5 41532 3 NA
4-185678859-T-A p.Asp629Val missense+splice_region ACSL1 2 83064 2.40778E-5 41532 0 5.97743E-5
4-185678860-CCT-C c.1885-2_1885-1delAG splice_acceptor ACSL1 1 83064 1.20389E-5 41532 0 NA
4-185678863-AAAAGGGTAAGAAAAATAAATTACTTCCTCTGTTAGAGGTCCCTGAATATCTACAGGTACATTTAATGCCAAGTTATGATGAGGACAGACTGGACCCTTCAGAACCTTACC-A p.Asp629fs frameshift ACSL1 1 83084 1.2036E-5 41542 0 NA
4-185678975-T-C p.Lys628Glu missense+splice_region ACSL1 3 83288 3.60196E-5 41644 0 NA
4-185678997-C-T p.Ser620Ser synonymous ACSL1 12 83294 1.44068E-4 41647 0 1.91095E-4
4-185678998-G-A p.Ser620Leu missense ACSL1 6 83286 7.20409E-5 41643 0 1.03424E-4
4-185679001-C-T p.Gly619Glu missense ACSL1 2 83310 2.40067E-5 41655 0 8.23655E-6
4-185679010-C-A p.Gly616Val missense ACSL1 1 83308 1.20036E-5 41654 0 7.95475E-6
4-185679011-C-T p.Gly616Arg missense ACSL1 4 83308 4.80146E-5 41654 0 5.03525E-4
4-185679013-C-G p.Arg615Thr missense ACSL1 2 83306 2.40079E-5 41653 0 8.23642E-6
4-185679021-G-A p.Ala612Ala synonymous ACSL1 4 83300 4.80192E-5 41650 0 3.29457E-5
4-185679059-T-C p.Ile600Val missense ACSL1 1 83276 1.20083E-5 41638 0 NA
4-185679065-T-C p.Ile598Val missense ACSL1 1 83262 1.20103E-5 41631 0 NA
4-185679066-G-A p.Leu597Leu synonymous ACSL1 3 83256 3.60334E-5 41628 0 NA
4-185679077-T-A c.1783-3A>T splice_region ACSL1 1 83188 1.2021E-5 41594 0 NA
4-185681506-C-T c.1782+5G>A splice_region ACSL1 1 83104 1.20331E-5 41552 0 NA
4-185681508-T-C c.1782+3A>G splice_region ACSL1 1 83134 1.20288E-5 41567 0 1.59236E-4
4-185681508-T-G c.1782+3A>C splice_region ACSL1 1 83134 1.20288E-5 41567 0 7.95874E-6
4-185681509-A-G c.1782+2T>C splice_donor ACSL1 1 83120 1.20308E-5 41560 0 NA
4-185681514-C-A p.Leu593Leu synonymous ACSL1 126 83172 0.00151493 41586 0 0.00135286
4-185681516-G-A p.Leu593Leu synonymous ACSL1 1 83184 1.20215E-5 41592 0 8.24198E-6
4-185681519-T-C p.Ser592Gly missense ACSL1 2 83190 2.40414E-5 41595 0 NA
4-185681525-C-T p.Gly590Arg missense ACSL1 1 83202 1.20189E-5 41601 0 8.24076E-6
4-185681526-G-A p.His589His synonymous ACSL1 3 83202 3.60568E-5 41601 0 1.19348E-4
4-185681555-T-C p.Ser580Gly missense ACSL1 1 83260 1.20106E-5 41630 0 NA
4-185681557-C-T p.Arg579Gln missense ACSL1 10 83256 1.20111E-4 41628 0 6.36983E-5
4-185681560-A-G p.Met578Thr missense ACSL1 5 83278 6.00399E-5 41639 0 1.64742E-5
4-185681575-A-G p.Ile573Thr missense ACSL1 4 83240 4.80538E-5 41620 0 3.97735E-5
4-185681583-A-G p.Pro570Pro synonymous ACSL1 7 83236 8.40982E-5 41618 0 1.07075E-4
4-185681586-G-A p.Ala569Ala synonymous ACSL1 1 83210 1.20178E-5 41605 0 8.23655E-6
4-185681593-T-C p.Tyr567Cys missense ACSL1 1 83204 1.20187E-5 41602 0 NA
4-185681595-T-C p.Glu566Glu synonymous ACSL1 1 83204 1.20187E-5 41602 0 NA
4-185681601-T-C p.Gln564Gln synonymous ACSL1 14 83178 1.68314E-4 41589 0 4.03598E-4
4-185681606-C-A p.Ala563Ser missense ACSL1 1 83146 1.2027E-5 41573 0 3.18512E-5
4-185681619-G-A p.His558His synonymous ACSL1 1 83072 1.20378E-5 41536 0 NA
4-185681633-C-T p.Asp554Asn missense ACSL1 1 82972 1.20523E-5 41486 0 NA
4-185681634-G-A p.Ile553Ile synonymous ACSL1 4 82980 4.82044E-5 41490 0 2.47207E-5
4-185681646-G-A p.Thr549Thr synonymous ACSL1 3 82994 3.61472E-5 41497 0 8.24552E-5
4-185681652-A-G p.Asn547Asn splice_region+synonymous ACSL1 5 83010 6.02337E-5 41505 0 3.29989E-5
4-185683561-T-A p.Pro546Pro splice_region+synonymous ACSL1 1 83390 1.19918E-5 41695 0 0.00125
4-185683570-T-G p.Lys543Asn missense ACSL1 1 83404 1.19898E-5 41702 0 NA
4-185683579-G-A p.Asp540Asp synonymous ACSL1 1 83412 1.19887E-5 41706 0 NA
4-185683600-G-A p.Asp533Asp synonymous ACSL1 57 83424 6.83257E-4 41712 0 0.00100705
4-185683627-C-T p.Ala524Ala synonymous ACSL1 174 83416 0.00208593 41708 0 0.00388486
4-185683628-G-T p.Ala524Glu missense ACSL1 4 83416 4.79524E-5 41708 0 6.25E-4
4-185683628-G-C p.Ala524Gly missense ACSL1 1 83416 1.19881E-5 41708 0 1.19292E-5
4-185683630-T-C p.Pro523Pro synonymous ACSL1 1 83420 1.19875E-5 41710 0 NA
4-185683682-A-C c.1522-5T>G splice_region ACSL1 1 83334 1.19999E-5 41667 0 NA
4-185684324-G-A p.Gly506Gly synonymous ACSL1 930 83084 0.0111935 41542 7 0.0206445
4-185684330-G-A p.Gly504Gly synonymous ACSL1 15 83142 1.80414E-4 41571 0 1.91156E-4
4-185684335-C-T p.Glu503Lys missense ACSL1 1 83192 1.20204E-5 41596 0 3.98232E-6
4-185684336-G-A p.Ala502Ala synonymous ACSL1 1 83198 1.20195E-5 41599 0 1.99176E-5
4-185684339-A-T p.Ala501Ala synonymous ACSL1 1 83222 1.20161E-5 41611 0 3.98197E-6
4-185684353-T-C p.Met497Val missense ACSL1 1 83294 1.20057E-5 41647 0 NA
4-185684354-T-G p.Glu496Asp missense ACSL1 3 83290 3.60187E-5 41645 0 3.18471E-5
4-185684384-G-T p.Cys486* stop_gained ACSL1 1 83324 1.20013E-5 41662 0 NA
4-185684387-C-T p.Pro485Pro synonymous ACSL1 6 83312 7.20184E-5 41656 0 6.25E-4
4-185684388-G-A p.Pro485Leu missense ACSL1 1 83306 1.20039E-5 41653 0 1.65096E-5
4-185684393-C-T p.Pro483Pro synonymous ACSL1 4 83292 4.80238E-5 41646 0 2.47746E-5
4-185684398-C-T p.Ala482Thr missense ACSL1 1 83278 1.2008E-5 41639 0 6.3674E-5
4-185684405-A-G p.His479His synonymous ACSL1 11 83256 1.32123E-4 41628 0 4.77973E-5
4-185684415-T-C c.1433-6A>G splice_region ACSL1 4 83194 4.80804E-5 41597 0 3.1839E-5
4-185686010-C-T p.Ala477Thr missense ACSL1 3 83062 3.61176E-5 41531 0 4.39315E-5
4-185686011-G-A p.Thr476Thr synonymous ACSL1 42 83080 5.05537E-4 41540 0 8.34035E-4
4-185686012-G-A p.Thr476Ile missense ACSL1 1 83094 1.20346E-5 41547 0 8.41085E-6
4-185686014-C-G p.Trp475Cys missense ACSL1 1 83104 1.20331E-5 41552 0 NA
4-185686032-C-T p.Leu469Leu synonymous ACSL1 59024 82722 0.713522 41361 21452 0.743422
4-185686036-CA-C p.Cys468fs frameshift ACSL1 1 83092 1.20349E-5 41546 0 NA
4-185686044-G-A p.Ala465Ala synonymous ACSL1 5 83114 6.01583E-5 41557 0 1.27429E-4
4-185686049-T-C p.Thr464Ala missense ACSL1 2 83124 2.40604E-5 41562 0 3.18573E-5
4-185686062-T-C p.Gly459Gly synonymous ACSL1 1 83138 1.20282E-5 41569 0 2.48616E-5
4-185686065-G-A p.Tyr458Tyr synonymous ACSL1 2046 83062 0.0246322 41531 48 0.045625
4-185686082-G-A c.1360-3C>T splice_region ACSL1 2 83124 2.40604E-5 41562 0 8.34098E-6
4-185687050-A-G p.Cys452Arg missense ACSL1 1 82906 1.20619E-5 41453 0 NA
4-185687056-G-T p.Leu450Met missense ACSL1 2 82990 2.40993E-5 41495 0 3.99135E-6
4-185687093-C-A p.Pro437Pro synonymous ACSL1 2 83096 2.40685E-5 41548 0 3.98591E-5
4-185687093-C-T p.Pro437Pro synonymous ACSL1 1 83096 1.20343E-5 41548 0 2.48579E-5
4-185687096-G-A p.Ala436Ala synonymous ACSL1 3 83080 3.61098E-5 41540 0 3.98562E-6
4-185687097-G-A p.Ala436Val missense ACSL1 1 83058 1.20398E-5 41529 0 NA
4-185687099-G-A p.Ala435Ala synonymous ACSL1 1 83032 1.20435E-5 41516 0 6.25E-4
4-185687118-C-T p.Arg429Gln missense ACSL1 1 82984 1.20505E-5 41492 0 8.30772E-6
4-185687128-C-T p.Gly426Arg missense ACSL1 1 82958 1.20543E-5 41479 0 3.33283E-5
4-185687129-G-A p.Gly425Gly synonymous ACSL1 1130 82868 0.0136361 41434 86 0.0329822
4-185687135-G-A p.Ser423Ser synonymous ACSL1 2 82862 2.41365E-5 41431 0 8.34098E-6
4-185687138-C-T p.Ser422Ser splice_region+synonymous ACSL1 10 82852 1.20697E-4 41426 0 0.0010101
4-185687139-G-A p.Ser422Leu missense+splice_region ACSL1 4 82822 4.82963E-5 41411 0 8.00602E-5
4-185687144-T-C c.1264-4A>G splice_region ACSL1 6 82812 7.24533E-5 41406 0 9.55657E-5
4-185687769-G-A c.1263+7C>T splice_region ACSL1 6 82898 7.23781E-5 41449 0 6.25E-4
4-185687783-T-C p.Lys419Arg missense ACSL1 1 83062 1.20392E-5 41531 0 NA
4-185687788-G-C p.Phe417Leu missense ACSL1 2 83098 2.4068E-5 41549 0 6.37064E-5
4-185687806-C-T p.Leu411Leu synonymous ACSL1 1 83300 1.20048E-5 41650 0 1.64908E-5
4-185687830-G-T p.Ser403Arg missense ACSL1 2 83350 2.39952E-5 41675 0 8.2409E-6
4-185687835-G-A p.Arg402Cys missense ACSL1 1 83360 1.19962E-5 41680 0 3.18532E-5
4-185687863-A-G p.Phe392Phe synonymous ACSL1 19580 82670 0.236845 41335 2258 0.264854
4-185687871-A-G p.Leu390Leu synonymous ACSL1 5 83346 5.99909E-5 41673 0 6.25E-4
4-185687872-G-C p.Leu389Leu synonymous ACSL1 1 83348 1.19979E-5 41674 0 NA
4-185687877-A-G p.Trp388Arg missense ACSL1 1 83334 1.19999E-5 41667 0 NA
4-185687880-G-A p.Arg387* stop_gained ACSL1 1 83316 1.20025E-5 41658 0 NA
4-185687882-T-C p.Lys386Arg missense ACSL1 4 83314 4.80111E-5 41657 0 1.59195E-4
4-185687887-C-T p.Thr384Thr synonymous ACSL1 4 83314 4.80111E-5 41657 0 8.25682E-6
4-185687888-G-A p.Thr384Met missense ACSL1 2 83316 2.4005E-5 41658 0 3.9795E-5
4-185687889-T-C p.Thr384Ala missense ACSL1 5 83312 6.00154E-5 41656 0 1.65191E-5
4-185687890-G-C p.Thr383Thr synonymous ACSL1 5 83310 6.00168E-5 41655 0 NA
4-185687892-T-C p.Thr383Ala missense ACSL1 2 83314 2.40056E-5 41657 0 NA
4-185687900-T-C p.Gln380Arg missense ACSL1 3 83290 3.60187E-5 41645 0 8.28089E-6
4-185687909-A-ATTCGG p.Ile377fs frameshift ACSL1 1 83252 1.20117E-5 41626 0 NA
4-185687915-T-C c.1129-5A>G splice_region ACSL1 1 83210 1.20178E-5 41605 0 NA
4-185689435-T-C p.His388Arg missense ACSL1 2 82958 2.41086E-5 41479 0 8.53053E-6
4-185689438-T-C p.Glu387Gly missense ACSL1 1 82984 1.20505E-5 41492 0 8.53862E-6
4-185689439-C-T p.Glu387Lys missense ACSL1 2 82996 2.40975E-5 41498 0 1.6954E-5
4-185689440-A-C p.Thr386Thr synonymous ACSL1 1 83018 1.20456E-5 41509 0 3.18451E-5
4-185689449-A-G p.Ser383Ser synonymous ACSL1 2 83136 2.4057E-5 41568 0 4.10587E-6
4-185689453-C-T p.Arg382Gln missense ACSL1 8 83162 9.61978E-5 41581 0 9.55901E-5
4-185689454-G-A p.Arg382* stop_gained ACSL1 19 83172 2.28442E-4 41586 0 0.005
4-185689459-T-G p.Lys380Thr missense ACSL1 5 83218 6.00832E-5 41609 0 1.21575E-5
4-185689471-C-T p.Arg376Gln missense+splice_region ACSL1 12 83296 1.44065E-4 41648 0 0.00100705
4-185689472-G-A p.Arg376* stop_gained ACSL1 1 83298 1.20051E-5 41649 0 8.24701E-6
4-185689483-C-T p.Arg93Gln missense+splice_region ACSL1 1 83316 1.20025E-5 41658 0 6.25E-4
4-185689505-C-T p.Val365Met missense ACSL1 2 83360 2.39923E-5 41680 0 3.18492E-5
4-185689506-G-A p.Pro364Pro synonymous ACSL1 13 83356 1.55958E-4 41678 2 3.21246E-4
4-185689531-T-C p.Lys356Arg missense ACSL1 2 83380 2.39866E-5 41690 0 3.18512E-5
4-185689533-G-C p.Leu355Leu synonymous ACSL1 1 83378 1.19936E-5 41689 0 8.23669E-6
4-185689551-C-T p.Arg349Arg synonymous ACSL1 1 83392 1.19916E-5 41696 0 7.56653E-5
4-185689574-C-T p.Gly342Arg missense ACSL1 2 83384 2.39854E-5 41692 0 3.98597E-6
4-185689575-G-A p.Ile341Ile synonymous ACSL1 7 83386 8.39469E-5 41693 0 4.11821E-5
4-185689601-C-T p.Val333Ile missense ACSL1 1 83378 1.19936E-5 41689 0 NA
4-185689609-A-G c.994-5T>C splice_region ACSL1 1 83378 1.19936E-5 41689 0 NA
4-185689611-G-T c.994-7C>A splice_region ACSL1 1 83372 1.19944E-5 41686 0 8.37353E-6
4-185691414-A-G p.Leu330Leu synonymous ACSL1 1 81818 1.22222E-5 40909 0 2.53631E-4
4-185691429-T-C p.Ile325Val missense ACSL1 1 82264 1.2156E-5 41132 0 3.18512E-5
4-185691432-G-A p.His324Tyr missense ACSL1 1 82330 1.21462E-5 41165 0 NA
4-185691436-A-C p.Leu322Leu synonymous ACSL1 1 82422 1.21327E-5 41211 0 1.27626E-5
4-185691449-G-C p.Ser318* stop_gained ACSL1 1 82684 1.20942E-5 41342 0 NA
4-185691475-G-A p.Pro309Pro synonymous ACSL1 1 82926 1.20589E-5 41463 0 NA
4-185691477-G-T p.Pro309Thr missense ACSL1 1 82932 1.20581E-5 41466 0 4.87059E-6
4-185691481-T-C p.Ala307Ala synonymous ACSL1 2 82938 2.41144E-5 41469 0 NA
4-185691548-C-T c.993+5G>A splice_region ACSL1 1 83202 1.20189E-5 41601 0 NA
4-185691580-G-A p.Leu322Leu synonymous ACSL1 1 83220 1.20163E-5 41610 0 3.18674E-5
4-185691601-A-G p.Thr315Thr synonymous ACSL1 1 83232 1.20146E-5 41616 0 3.58551E-5
4-185691630-T-G p.Asn306His missense+splice_region ACSL1 1 83206 1.20184E-5 41603 0 7.98524E-6
4-185694234-C-T c.915+1G>A splice_donor ACSL1 1 83210 1.20178E-5 41605 0 NA
4-185694256-T-G p.Ser298Ser synonymous ACSL1 1 83296 1.20054E-5 41648 0 NA
4-185694273-T-C p.Ile293Val missense ACSL1 2 83286 2.40136E-5 41643 0 6.25E-4
4-185694275-T-C p.Asn292Ser missense ACSL1 3 83284 3.60213E-5 41642 0 9.55231E-5
4-185694278-C-T p.Arg291Gln missense ACSL1 1 83282 1.20074E-5 41641 0 4.37571E-5
4-185694283-A-G p.Thr289Thr synonymous ACSL1 1 83280 1.20077E-5 41640 0 1.19337E-5
4-185694287-A-T p.Val288Asp missense ACSL1 1 83280 1.20077E-5 41640 0 8.25846E-6
4-185694816-C-T c.841+1G>A splice_donor ACSL1 1 83144 1.20273E-5 41572 0 NA
4-185694838-A-C p.Cys274Gly missense ACSL1 1 83134 1.20288E-5 41567 0 5.04541E-4
4-185694871-A-G c.790-3T>C splice_region ACSL1 1 82966 1.20531E-5 41483 0 NA
4-185694872-A-ACAGT c.790-5_790-4insACTG splice_region ACSL1 1 82948 1.20557E-5 41474 0 NA
4-185694991-G-A c.789+6C>T splice_region ACSL1 1 82724 1.20884E-5 41362 0 NA
4-185694994-T-C c.789+3A>G splice_region ACSL1 2 82698 2.41844E-5 41349 0 NA
4-185695007-C-T p.Arg260Gln missense ACSL1 2 82542 2.42301E-5 41271 0 4.94984E-5
4-185695008-G-A p.Arg260Trp missense ACSL1 1 82530 1.21168E-5 41265 0 3.29973E-5
4-185695013-T-A p.Asn258Ile missense ACSL1 15 82484 1.81853E-4 41242 0 2.47578E-5
4-185695014-T-C p.Asn258Asp missense ACSL1 1 82464 1.21265E-5 41232 0 8.25396E-6
4-185695016-G-A p.Ala257Val missense ACSL1 2 82440 2.42601E-5 41220 0 NA
4-185695017-C-T p.Ala257Thr missense ACSL1 2 82426 2.42642E-5 41213 0 3.18654E-5
4-185697645-G-A p.Ala250Val missense ACSL1 1 82818 1.20747E-5 41409 0 3.6164E-5
4-185697653-G-C p.Ser247Arg missense ACSL1 1 82982 1.20508E-5 41491 0 8.31228E-6
4-185697657-G-C p.Thr246Ser missense ACSL1 1 83034 1.20433E-5 41517 0 NA
4-185697657-G-A p.Thr246Ile missense ACSL1 6 83034 7.22596E-5 41517 0 9.19647E-5
4-185697674-C-T p.Arg240Arg synonymous ACSL1 1 83192 1.20204E-5 41596 0 NA
4-185697684-C-T p.Arg237Gln missense ACSL1 69 83262 8.28709E-4 41631 0 6.09997E-4
4-185697685-G-A p.Arg237* stop_gained ACSL1 1 83266 1.20097E-5 41633 0 7.95817E-6
4-185697694-G-T p.Leu234Met missense ACSL1 2 83312 2.40061E-5 41656 0 NA
4-185697702-C-A p.Gly231Val missense ACSL1 6 83332 7.20012E-5 41666 0 3.18431E-5
4-185697703-C-T p.Gly231Ser missense ACSL1 4 83336 4.79985E-5 41668 0 4.94348E-5
4-185697704-G-A p.Tyr230Tyr synonymous ACSL1 4 83338 4.79973E-5 41669 0 1.59109E-5
4-185697709-C-T p.Ala229Thr missense ACSL1 33 83342 3.95959E-4 41671 0 9.55657E-4
4-185697714-A-T p.Met227Lys missense ACSL1 1 83352 1.19973E-5 41676 0 NA
4-185697715-T-C p.Met227Val missense ACSL1 1 83354 1.1997E-5 41677 0 1.59093E-5
4-185697719-A-C p.Val225Val synonymous ACSL1 14 83358 1.6795E-4 41679 0 4.45456E-4
4-185697723-A-G p.Ile224Thr missense ACSL1 3 83358 3.59893E-5 41679 0 1.1932E-5
4-185697734-G-T p.Gly220Gly synonymous ACSL1 1 83360 1.19962E-5 41680 0 NA
4-185697738-G-C p.Pro219Arg missense ACSL1 2 83362 2.39917E-5 41681 0 NA
4-185697756-A-G p.Val213Ala missense ACSL1 1 83346 1.19982E-5 41673 0 6.36983E-5
4-185697761-C-T p.Glu211Glu synonymous ACSL1 1 83334 1.19999E-5 41667 0 NA
4-185697767-T-C p.Leu209Leu synonymous ACSL1 253 83306 0.003037 41653 1 0.0024584
4-185697770-G-T p.Leu208Leu synonymous ACSL1 1 83296 1.20054E-5 41648 0 1.65267E-5
4-185697773-T-A p.Lys207Asn missense ACSL1 1 83290 1.20062E-5 41645 0 1.65423E-5
4-185697777-G-A p.Ala206Val missense ACSL1 5 83264 6.005E-5 41632 0 NA
4-185697789-T-C p.Lys202Arg missense ACSL1 1 83218 1.20166E-5 41609 0 NA
4-185697803-C-CAG p.Val198fs frameshift ACSL1 1 83160 1.2025E-5 41580 0 NA
4-185697820-T-C c.578-4A>G splice_region ACSL1 55 82992 6.62714E-4 41496 0 6.58176E-4
4-185698033-C-T c.577+5G>A splice_region ACSL1 3 83118 3.60933E-5 41559 0 9.22772E-5
4-185698054-C-T p.Thr187Thr synonymous ACSL1 1 83152 1.20262E-5 41576 0 3.31526E-5
4-185698065-C-T p.Glu184Lys missense ACSL1 4 83132 4.81162E-5 41566 0 8.26925E-6
4-185698072-A-G p.Leu181Leu synonymous ACSL1 2 83126 2.40599E-5 41563 0 NA
4-185698079-T-C p.Asp179Gly missense ACSL1 3 83098 3.6102E-5 41549 0 3.30524E-5
4-185698092-C-T p.Val175Ile missense ACSL1 7 83086 8.42501E-5 41543 0 2.22958E-4
4-185698092-C-A p.Val175Phe missense ACSL1 2 83084 2.4072E-5 41542 0 NA
4-185698093-G-A p.Ile174Ile synonymous ACSL1 1 83090 1.20351E-5 41545 0 3.97978E-6
4-185698093-G-T p.Ile174Ile synonymous ACSL1 1 83090 1.20351E-5 41545 0 3.18451E-5
4-185698094-A-C p.Ile174Ser missense ACSL1 40 83086 4.81429E-4 41543 0 4.6304E-4
4-185698102-C-A p.Ser171Ser synonymous ACSL1 2 83062 2.40784E-5 41531 0 NA
4-185698103-G-C p.Ser171Trp missense ACSL1 1 83046 1.20415E-5 41523 0 NA
4-185698115-C-A p.Cys167Phe missense ACSL1 2 83020 2.40906E-5 41510 0 NA
4-185698122-G-C p.Gln165Glu missense ACSL1 2 83006 2.40946E-5 41503 0 NA
4-185698128-T-C p.Ile163Val missense ACSL1 2 82972 2.41045E-5 41486 0 NA
4-185698144-A-G c.478-7T>C splice_region ACSL1 1 82914 1.20607E-5 41457 0 NA
4-185701478-G-A c.477+8C>T splice_region ACSL1 1 83066 1.20386E-5 41533 0 3.99882E-6
4-185701494-T-C p.Arg157Gly missense ACSL1 1 83102 1.20334E-5 41551 0 NA
4-185701503-C-T p.Ala154Thr missense ACSL1 7 83082 8.42541E-5 41541 0 4.7805E-5
4-185701525-T-C p.Pro146Pro synonymous ACSL1 4 83108 4.81301E-5 41554 0 NA
4-185701531-A-C p.Thr144Thr synonymous ACSL1 4 83086 4.81429E-5 41543 0 8.23995E-6
4-185701544-T-G p.Lys140Thr missense ACSL1 1 83052 1.20406E-5 41526 0 NA
4-185701549-G-T p.Ile138Ile synonymous ACSL1 22894 82516 0.277449 41258 3560 0.28125
4-185701549-G-A p.Ile138Ile synonymous ACSL1 3 83052 3.61219E-5 41526 0 3.1901E-5
4-185701557-C-T p.Ala136Thr missense ACSL1 1 83000 1.20482E-5 41500 0 NA
4-185701560-A-C p.Ser135Ala missense ACSL1 1 82986 1.20502E-5 41493 0 NA
4-185701566-T-C p.Ile133Val missense ACSL1 1 82938 1.20572E-5 41469 0 1.59831E-5
4-185701567-G-A p.Cys132Cys synonymous ACSL1 2 82930 2.41167E-5 41465 0 3.18471E-5
4-185701572-C-G p.Glu131Gln missense ACSL1 2 82876 2.41324E-5 41438 0 8.26241E-6
4-185701573-C-T p.Ser130Ser synonymous ACSL1 10 82870 1.20671E-4 41435 0 9.55292E-5
4-185701574-G-A p.Ser130Leu missense ACSL1 1 82854 1.20694E-5 41427 0 8.26446E-6
4-185701576-C-T p.Leu129Leu synonymous ACSL1 3 82836 3.62161E-5 41418 0 8.01301E-6
4-185701584-C-T p.Ala127Thr missense ACSL1 1 82694 1.20928E-5 41347 0 NA
4-185701590-A-G c.376-3T>C splice_region ACSL1 52 82590 6.29616E-4 41295 0 0.00108253
4-185701590-A-C c.376-3T>G splice_region ACSL1 1 82592 1.21077E-5 41296 0 2.48398E-5
4-185705081-C-T p.Gln125Gln splice_region+synonymous ACSL1 5 83366 5.99765E-5 41683 0 3.18552E-5
4-185705096-C-T p.Trp120* stop_gained ACSL1 1 83372 1.19944E-5 41686 0 NA
4-185705104-A-G p.Tyr118His missense ACSL1 2 83372 2.39889E-5 41686 0 NA
4-185705106-G-C p.Pro117Arg missense ACSL1 2 83364 2.39912E-5 41682 0 NA
4-185705115-G-T p.Pro114Gln missense ACSL1 1 83360 1.19962E-5 41680 0 NA
4-185705126-G-T p.Gly110Gly synonymous ACSL1 2 83344 2.39969E-5 41672 1 NA
4-185705142-T-C p.Asn105Ser missense ACSL1 1 83304 1.20042E-5 41652 0 3.99116E-6
4-185705145-T-C p.Asn104Ser missense+splice_region ACSL1 1 83284 1.20071E-5 41642 0 3.99524E-6
4-185709596-T-A c.-267A>T 5_prime_UTR_premature_start_codon_gain ACSL1 1 58982 1.69543E-5 29491 0 7.79059E-5
4-185709599-A-G p.Ter127Glnext*? stop_lost ACSL1 1 60006 1.6665E-5 30003 0 3.18634E-5
4-185709602-G-A p.Leu126Phe missense ACSL1 2 60874 3.28548E-5 30437 0 2.19112E-5
4-185709622-C-A p.Gly119Val missense ACSL1 1 65648 1.52328E-5 32824 0 7.11582E-6
4-185709623-C-T p.Gly119Ser missense ACSL1 2 65852 3.03711E-5 32926 0 NA
4-185709624-G-A c.-295C>T 5_prime_UTR_premature_start_codon_gain ACSL1 31 66448 4.6653E-4 33224 0 9.55779E-4
4-185709624-G-T p.Val118Val synonymous ACSL1 4 66450 6.01956E-5 33225 0 3.18593E-5
4-185709627-TC-AA p.Arg117Ile missense ACSL1 1 67482 1.48188E-5 33741 0 NA
4-185709632-G-T p.Pro116Thr missense ACSL1 1 68812 1.45323E-5 34406 0 NA
4-185709635-A-C p.Phe115Val missense ACSL1 2 69434 2.88043E-5 34717 0 NA
4-185709643-T-C p.His112Arg missense ACSL1 10 70780 1.41283E-4 35390 0 6.25E-4
4-185709649-C-T p.Cys110Tyr missense ACSL1 2 71792 2.78583E-5 35896 0 NA
4-185709653-G-A p.Leu109Phe missense ACSL1 1 72980 1.37024E-5 36490 0 1.52517E-4
4-185709656-G-A p.Pro108Ser missense ACSL1 29 73288 3.95699E-4 36644 0 8.68139E-4
4-185709664-G-A p.Ser105Leu missense ACSL1 122 75016 0.00162632 37508 0 0.0029677
4-185709671-A-G c.-338-4T>C splice_region ACSL1 24 76764 3.12647E-4 38382 0 2.51921E-4
4-185709770-C-T c.310+1G>A splice_donor ACSL1 2 83172 2.40466E-5 41586 0 NA
4-185709783-T-A p.Ile100Leu missense ACSL1 1 83196 1.20198E-5 41598 0 6.36862E-5
4-185709790-C-G p.Gln97His missense ACSL1 1 83214 1.20172E-5 41607 0 NA
4-185709793-G-C p.Phe96Leu missense ACSL1 1 83206 1.20184E-5 41603 0 8.24239E-6
4-185709802-G-A c.-370C>T 5_prime_UTR_premature_start_codon_gain ACSL1 1 83216 1.20169E-5 41608 0 1.59163E-5
4-185709805-T-A p.Leu92Phe missense ACSL1 7 83222 8.41124E-5 41611 0 1.15376E-4
4-185709832-C-T p.Val83Val synonymous ACSL1 1 83258 1.20109E-5 41629 0 NA
4-185709843-C-T p.Glu80Lys missense ACSL1 2 83254 2.40229E-5 41627 0 1.43205E-4
4-185709844-G-A c.-412C>T 5_prime_UTR_premature_start_codon_gain ACSL1 2 83246 2.40252E-5 41623 0 3.29609E-5
4-185709847-G-A p.Ser78Ser synonymous ACSL1 11 83256 1.32123E-4 41628 0 5.03525E-4
4-185709848-C-A p.Ser78Ile missense ACSL1 1 83252 1.20117E-5 41626 0 NA
4-185709862-G-A c.-430C>T 5_prime_UTR_premature_start_codon_gain ACSL1 7 83256 8.4078E-5 41628 0 2.1483E-4
4-185709863-G-A p.Ser73Phe missense ACSL1 1 83258 1.20109E-5 41629 0 NA
4-185709874-A-G p.Gly69Gly synonymous ACSL1 1 83240 1.20135E-5 41620 0 7.95653E-6
4-185709891-A-G c.196-6T>C splice_region ACSL1 5523 82998 0.0665438 41499 198 0.06125
4-185724473-C-T c.195+1G>A splice_donor ACSL1 1 82398 1.21362E-5 41199 0 3.18471E-5
4-185724474-C-T p.Ala65Ala splice_region+synonymous ACSL1 1 82422 1.21327E-5 41211 0 7.74214E-5
4-185724475-G-A p.Ala65Val missense+splice_region ACSL1 63 82428 7.64303E-4 41214 0 0.0025
4-185724503-C-T p.Asp56Asn missense ACSL1 220 82848 0.00265547 41424 0 0.00220936
4-185724504-G-A p.Cys55Cys synonymous ACSL1 3 82890 3.61925E-5 41445 0 1.43666E-4
4-185724513-C-A p.Lys52Asn missense ACSL1 2 83008 2.40941E-5 41504 0 1.59246E-4
4-185724514-T-C p.Lys52Arg missense ACSL1 1 83030 1.20438E-5 41515 0 3.18552E-5
4-185724521-G-C p.Pro50Ala missense ACSL1 1 83108 1.20325E-5 41554 0 3.18593E-5
4-185724525-G-A p.Pro48Pro synonymous ACSL1 1 83114 1.20317E-5 41557 0 9.17633E-6
4-185724531-C-T p.Thr46Thr synonymous ACSL1 1 83154 1.20259E-5 41577 0 4.50402E-5
4-185724537-G-A c.-517C>T 5_prime_UTR_premature_start_codon_gain ACSL1 36 83184 4.32776E-4 41592 0 5.09587E-4
4-185724543-G-T p.Phe42Leu missense ACSL1 1 83242 1.20132E-5 41621 0 3.18471E-5
4-185724567-T-C p.Gly34Gly synonymous ACSL1 1 83312 1.20031E-5 41656 0 NA
4-185724570-G-A c.-550C>T 5_prime_UTR_premature_start_codon_gain ACSL1 23 83316 2.76057E-4 41658 0 6.25E-4
4-185724585-G-A p.Asn28Asn synonymous ACSL1 1 83350 1.19976E-5 41675 0 NA
4-185724589-G-A p.Thr27Ile missense ACSL1 3 83340 3.59971E-5 41670 0 NA
4-185724598-G-A p.Thr24Ile missense ACSL1 35 83346 4.19936E-4 41673 0 1.83327E-4
4-185724601-C-T p.Arg23His missense ACSL1 3 83336 3.59988E-5 41668 0 NA
4-185724602-G-T p.Arg23Ser missense ACSL1 3 83332 3.60006E-5 41666 0 1.1973E-5
4-185724606-G-A c.-586C>T 5_prime_UTR_premature_start_codon_gain ACSL1 6 83334 7.19994E-5 41667 0 6.25E-4
4-185724609-C-T p.Gln20Gln synonymous ACSL1 1 83324 1.20013E-5 41662 0 1.19772E-5
4-185724613-C-A p.Arg19Leu missense ACSL1 4 83310 4.80134E-5 41655 0 2.00237E-5
4-185724627-C-T p.Glu14Glu synonymous ACSL1 3 83298 3.60153E-5 41649 0 0.00100705
4-185724646-C-T p.Arg8Gln missense ACSL1 2 83238 2.40275E-5 41619 0 3.18613E-5
4-185724647-G-A p.Arg8Trp missense ACSL1 1 83234 1.20143E-5 41617 0 4.339E-5
4-185724648-G-C p.Phe7Leu missense ACSL1 1 83228 1.20152E-5 41614 0 NA
4-185724658-T-A p.His4Leu missense ACSL1 1 83194 1.20201E-5 41597 0 1.49411E-4
4-185724702-T-TCCTCC c.-32-3_-32-2insGGAGG splice_region ACSL1 1 80240 1.24626E-5 40120 0 NA
4-185726760-G-A c.-112C>T 5_prime_UTR_premature_start_codon_gain ACSL1 2 23656 8.45452E-5 11828 0 NA
4-185726864-T-C c.-216A>G 5_prime_UTR_premature_start_codon_gain ACSL1 1 14052 7.11642E-5 7026 0 4.45945E-4
4-185726914-T-C c.-266A>G 5_prime_UTR_premature_start_codon_gain ACSL1 1009 9154 0.110225 4577 0 0.105443
4-185729443-T-C c.-681+3A>G splice_region ACSL1 2 24258 8.2447E-5 12129 0 NA
4-185729553-G-A c.-788C>T 5_prime_UTR_premature_start_codon_gain ACSL1 56 24276 0.0023068 12138 0 0.00197377
4-185729582-G-A c.-817C>T 5_prime_UTR_premature_start_codon_gain ACSL1 1 24276 4.11929E-5 12138 0 NA
4-185733309-C-T c.-33+5G>A splice_region ACSL1 1 24244 4.12473E-5 12122 0 NA
4-185733317-G-A c.-36C>T 5_prime_UTR_premature_start_codon_gain ACSL1 1 24240 4.12541E-5 12120 0 3.18613E-5
4-185733359-G-A c.-78C>T 5_prime_UTR_premature_start_codon_gain ACSL1 4 24252 1.64935E-4 12126 0 NA
4-185747140-G-C c.-103C>G 5_prime_UTR_premature_start_codon_gain ACSL1 1 88 0.0113636 44 0 8.18331E-4