Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-48503540-C-T c.-83C>T 5_prime_UTR_premature_start_codon_gain ACSF2 1 33640 2.97265E-5 16820 0 3.21213E-5
17-48503563-C-T c.-60C>T 5_prime_UTR_premature_start_codon_gain ACSF2 1 38004 2.6313E-5 19002 0 NA
17-48503634-C-T c.-144C>T 5_prime_UTR_premature_start_codon_gain ACSF2 3 55940 5.36289E-5 27970 0 6.28931E-4
17-48503640-G-T p.Gly6Gly synonymous ACSF2 2 56668 3.52933E-5 28334 0 NA
17-48503650-C-T c.-128C>T 5_prime_UTR_premature_start_codon_gain ACSF2 1 57058 1.7526E-5 28529 0 6.38325E-5
17-48503655-G-A p.Gly11Gly synonymous ACSF2 1 57462 1.74028E-5 28731 0 9.86699E-6
17-48503675-C-T p.Ser18Leu missense ACSF2 1 55922 1.78821E-5 27961 0 9.80604E-6
17-48503676-GG-TT p.SerGly18SerTrp missense ACSF2 695 55916 0.0124294 27958 23 NA
17-48503676-G-T c.-102G>T 5_prime_UTR_premature_start_codon_gain ACSF2 50 55930 8.93975E-4 27965 11 0.0227215
17-48503676-G-A p.Ser18Ser synonymous ACSF2 6 55932 1.07273E-4 27966 0 2.95552E-4
17-48503676-G-C p.Ser18Ser synonymous ACSF2 2 55932 3.57577E-5 27966 0 NA
17-48503677-G-T p.Gly19Trp missense ACSF2 50 56012 8.92666E-4 28006 11 0.0227142
17-48503684-T-A p.Leu21Gln missense ACSF2 203 55468 0.00365977 27734 1 0.0089874
17-48503697-C-T c.-81C>T 5_prime_UTR_premature_start_codon_gain ACSF2 1 54770 1.82582E-5 27385 0 NA
17-48503723-C-T p.Ala34Val missense ACSF2 271 52680 0.00514427 26340 8 0.0108717
17-48503728-T-A p.Leu36Met missense ACSF2 3 52108 5.75727E-5 26054 0 NA
17-48503740-C-T p.Arg40Cys missense ACSF2 3 49010 6.1212E-5 24505 0 5.67859E-5
17-48503746-C-G p.Leu42Val missense ACSF2 1 48056 2.08091E-5 24028 0 NA
17-48503749-A-G p.Ser43Gly missense+splice_region ACSF2 1 47082 2.12395E-5 23541 0 NA
17-48503757-G-GC c.128+7_128+8insC splice_region ACSF2 1 45450 2.20022E-5 22725 0 2.24135E-5
17-48503758-C-T c.128+8C>T splice_region ACSF2 2 45318 4.41326E-5 22659 0 1.52138E-4
17-48504254-TTCTG-T c.129-11_129-8delTCTG splice_region ACSF2 6 34662 1.731E-4 17331 0 6.51284E-4
17-48504263-C-T c.129-3C>T splice_region ACSF2 1 34700 2.88184E-5 17350 0 NA
17-48504265-G-C c.129-1G>C splice_acceptor ACSF2 10 34686 2.88301E-4 17343 0 2.7881E-4
17-48504265-G-A c.129-1G>A splice_acceptor ACSF2 9 34688 2.59456E-4 17344 0 6.25E-4
17-48504272-G-T p.Arg45Ser missense ACSF2 6 34708 1.72871E-4 17354 0 4.67144E-5
17-48504307-T-G p.Val57Gly missense ACSF2 4 34726 1.15187E-4 17363 0 3.18451E-5
17-48504308-T-C p.Val57Val synonymous ACSF2 1 34728 2.87952E-5 17364 0 1.27364E-4
17-48504328-C-T p.Ser64Phe missense ACSF2 18 34710 5.18583E-4 17355 0 0.00127364
17-48504329-T-C p.Ser64Ser synonymous ACSF2 2 34704 5.76302E-5 17352 0 8.39239E-4
17-48504343-A-G c.203+3A>G splice_region ACSF2 1 34632 2.8875E-5 17316 0 NA
17-48537568-C-T p.Ser45Leu missense ACSF2 2 9566 2.09074E-4 4783 0 3.18492E-5
17-48537581-G-T p.Leu49Leu synonymous ACSF2 1 9572 1.04471E-4 4786 0 1.27453E-4
17-48537585-C-T p.His51Tyr missense ACSF2 1 9578 1.04406E-4 4789 0 1.27389E-4
17-48537591-G-A p.Gly53Arg missense ACSF2 1 9576 1.04428E-4 4788 0 NA
17-48538036-A-G c.129-2A>G splice_acceptor ACSF2 16 82554 1.93813E-4 41277 0 2.42966E-4
17-48538036-A-C c.129-2A>C splice_acceptor ACSF2 1 82554 1.21133E-5 41277 0 NA
17-48538054-C-T p.Arg49Cys missense ACSF2 1 82832 1.20726E-5 41416 0 3.18695E-5
17-48538054-C-A p.Arg49Ser missense ACSF2 1 82832 1.20726E-5 41416 0 2.07189E-5
17-48538059-G-T p.Met50Ile missense ACSF2 2 82896 2.41266E-5 41448 0 NA
17-48538067-C-T p.Thr53Met missense ACSF2 9 82948 1.08502E-4 41474 0 0.00100705
17-48538068-G-A p.Thr53Thr synonymous ACSF2 2 82956 2.41092E-5 41478 0 8.02955E-6
17-48538074-C-T p.Ile55Ile synonymous ACSF2 10 83000 1.20482E-4 41500 0 2.54923E-4
17-48538075-G-A p.Gly56Arg missense ACSF2 7 83002 8.43353E-5 41501 0 1.27559E-4
17-48538076-G-C p.Gly56Ala missense ACSF2 3 82998 3.61454E-5 41499 0 2.82247E-5
17-48538089-C-T p.Tyr60Tyr synonymous ACSF2 7 83052 8.42845E-5 41526 0 5.56597E-5
17-48538090-G-A p.Val61Ile missense ACSF2 2 83056 2.40801E-5 41528 0 6.37552E-5
17-48538098-G-A p.Gly63Gly synonymous ACSF2 1 83072 1.20378E-5 41536 0 6.25E-4
17-48538117-A-G p.Asn70Asp missense ACSF2 3 83104 3.60993E-5 41552 0 3.60277E-4
17-48538117-A-C p.Asn70His missense ACSF2 2 83104 2.40662E-5 41552 0 1.2747E-4
17-48538136-A-G p.Gln76Arg missense ACSF2 1 83100 1.20337E-5 41550 0 9.4084E-6
17-48538139-G-A p.Cys77Tyr missense ACSF2 1 83098 1.2034E-5 41549 0 NA
17-48538143-G-A p.Leu78Leu synonymous ACSF2 1 83102 1.20334E-5 41551 0 9.49253E-6
17-48538171-C-T p.Arg88* stop_gained ACSF2 1 83014 1.20462E-5 41507 0 4.03877E-6
17-48538172-G-A p.Arg88Gln missense ACSF2 1 83022 1.2045E-5 41511 0 5.95321E-5
17-48538182-G-T p.Leu91Phe missense ACSF2 1 82982 1.20508E-5 41491 0 2.02045E-5
17-48538186-G-A p.Val93Ile missense ACSF2 29 82960 3.49566E-4 41480 0 0.00251762
17-48538200-C-T p.Asp97Asp synonymous ACSF2 1 82966 1.20531E-5 41483 0 1.06546E-5
17-48538201-G-C p.Val98Leu missense ACSF2 1 82936 1.20575E-5 41468 0 3.18552E-5
17-48538203-C-T p.Val98Val synonymous ACSF2 1 82938 1.20572E-5 41469 0 NA
17-48538212-C-A p.Thr101Thr synonymous ACSF2 1 82912 1.2061E-5 41456 0 NA
17-48538238-G-A c.324+5G>A splice_region ACSF2 2 82586 2.42172E-5 41293 0 4.26814E-6
17-48538241-C-A c.324+8C>A splice_region ACSF2 2 82548 2.42283E-5 41274 1 NA
17-48538409-T-A n.544T>A splice_region ACSF2 2 75272 2.65703E-5 37636 0 3.18756E-5
17-48538619-C-G p.Ser114Cys missense ACSF2 2 82574 2.42207E-5 41287 0 NA
17-48538634-T-C p.Ile119Thr missense ACSF2 1 82516 1.21189E-5 41258 0 3.18532E-5
17-48538646-A-G p.Lys123Arg missense+splice_region ACSF2 3 82456 3.6383E-5 41228 0 3.1834E-5
17-48538655-G-A p.Arg126Gln missense ACSF2 1 82312 1.21489E-5 41156 0 3.31516E-5
17-48538659-G-A p.Leu127Leu synonymous ACSF2 3 82314 3.64458E-5 41157 0 NA
17-48538660-G-A p.Gly128Ser missense ACSF2 1 82276 1.21542E-5 41138 0 NA
17-48538666-T-G p.Trp130Gly missense ACSF2 4 82186 4.86701E-5 41093 0 3.98197E-6
17-48538683-T-C p.Tyr135Tyr synonymous ACSF2 4 81954 4.88079E-5 40977 0 8.31158E-6
17-48538696-A-G p.Met140Val missense ACSF2 3 81588 3.67701E-5 40794 0 NA
17-48538711-G-A p.Ala145Thr missense ACSF2 7 80680 8.67625E-5 40340 0 5.04032E-4
17-48538712-C-T p.Ala145Val missense ACSF2 6 80710 7.43402E-5 40355 0 6.77917E-5
17-48538714-C-G p.Gln146Glu missense+splice_region ACSF2 1 80668 1.23965E-5 40334 0 3.18674E-5
17-48538719-G-A c.438+3G>A splice_region ACSF2 1 80158 1.24754E-5 40079 0 NA
17-48538734-G-GTCTGTGAACCCAGCCTACC c.453+3_453+4insTCTGTGAACCCAGCCTACC splice_region ACSF2 4 79146 5.05395E-5 39573 1 NA
17-48539016-A-G c.439-2A>G splice_acceptor ACSF2 1 81314 1.2298E-5 40657 0 NA
17-48539018-G-C p.Ala147Pro missense+splice_region ACSF2 1 81324 1.22965E-5 40662 0 NA
17-48539019-C-T p.Ala147Val missense+splice_region ACSF2 1 81322 1.22968E-5 40661 0 3.97712E-6
17-48539021-A-G p.Met1? start_lost ACSF2 22 81316 2.70549E-4 40658 0 7.65501E-4
17-48539027-C-T p.Thr135Ile missense ACSF2 1 81410 1.22835E-5 40705 0 8.24348E-6
17-48539032-G-A p.Val137Ile missense ACSF2 1 81396 1.22856E-5 40698 0 NA
17-48539035-T-C p.Cys138Arg missense ACSF2 23922 79574 0.300626 39787 4293 0.354375
17-48539043-A-T p.Lys168Met missense ACSF2 2 81334 2.459E-5 40667 0 NA
17-48539049-T-TGGGCTGC c.507+2_507+3insGGGCTGC splice_region ACSF2 2 81200 2.46305E-5 40600 0 NA
17-48539051-C-T c.507+4C>T splice_region ACSF2 2 81194 2.46324E-5 40597 0 6.25E-4
17-48539538-T-C c.508-7T>C splice_region ACSF2 1 82382 1.21386E-5 41191 0 NA
17-48539539-C-A c.508-6C>A splice_region ACSF2 1 82414 1.21339E-5 41207 0 NA
17-48539548-G-C p.Gly171Arg missense ACSF2 1 82578 1.21098E-5 41289 0 NA
17-48539550-C-T p.Gly171Gly synonymous ACSF2 1 82588 1.21083E-5 41294 0 1.59351E-5
17-48539556-G-A p.Gly146Ser missense ACSF2 1 82766 1.20823E-5 41383 0 NA
17-48539560-C-T p.Leu175Phe missense ACSF2 1 82858 1.20688E-5 41429 0 NA
17-48539565-G-A p.Val149Ile missense ACSF2 2 82918 2.41202E-5 41459 0 2.5507E-4
17-48539570-C-T p.Pro178Leu missense ACSF2 2 82960 2.4108E-5 41480 0 3.9794E-6
17-48539581-A-G p.Lys182Glu missense ACSF2 3 83112 3.60959E-5 41556 0 5.03525E-4
17-48539583-G-A p.Asp155Asn missense ACSF2 2 83134 2.40575E-5 41567 0 3.18715E-5
17-48539585-C-T p.Thr183Ile missense ACSF2 1 83142 1.20276E-5 41571 0 3.18898E-5
17-48539602-G-A p.Val189Ile missense ACSF2 6 83232 7.20877E-5 41616 0 1.98908E-5
17-48539615-T-C p.Ile193Thr missense ACSF2 4 83272 4.80354E-5 41636 0 5.03525E-4
17-48539618-G-A p.Cys194Tyr missense ACSF2 1 83284 1.20071E-5 41642 0 3.18674E-5
17-48539631-GA-AT p.GluAsn198GluTyr missense ACSF2 2 83310 2.40067E-5 41655 0 NA
17-48539631-G-A p.Glu171Lys missense ACSF2 1 83310 1.20034E-5 41655 0 1.64761E-5
17-48539632-A-T p.Asn199Tyr missense ACSF2 1 83306 1.20039E-5 41653 0 1.64761E-5
17-48539634-T-C p.Cys172Arg missense ACSF2 1 83306 1.20039E-5 41653 0 NA
17-48539661-GAGGTGGGTGTGTCCCAGGTTAGTGGGTGGTGCATCATTCAGCATCCCTGATTCCTTCACTTCCTACCCACCCTGCCCCCTCCCTCAGCCCCTGTCTCTCACCATCGTCCCCAACCCC-G p.Arg209fs frameshift ACSF2 6 83314 7.20167E-5 41657 0 NA
17-48539664-G-GCTCCCAGATCTGACCACAGTCATC c.626+1_626+2insCTCCCAGATCTGACCACAGTCATC splice_donor ACSF2 1 83306 1.20039E-5 41653 0 NA
17-48539670-G-A c.626+7G>A splice_region ACSF2 1 83256 1.20111E-5 41628 0 8.23873E-6
17-48539774-AC-A c.627-6delC splice_region ACSF2 10 82696 1.20925E-4 41348 0 1.23713E-4
17-48539784-C-G p.Pro183Ala missense ACSF2 1 82778 1.20805E-5 41389 0 NA
17-48539788-G-A p.Asp212Asn missense ACSF2 2 82786 2.41587E-5 41393 0 8.24593E-6
17-48539800-G-A p.Val216Ile missense ACSF2 1 82870 1.20671E-5 41435 0 NA
17-48539807-C-T p.Ser218Leu missense ACSF2 2 82900 2.41255E-5 41450 0 9.56999E-5
17-48539808-G-A p.Ser218Ser synonymous ACSF2 54 82880 6.51544E-4 41440 1 0.00153276
17-48539814-T-C p.Asp220Asp synonymous ACSF2 1 82950 1.20555E-5 41475 0 NA
17-48539826-G-A p.Pro224Pro synonymous ACSF2 3 83038 3.6128E-5 41519 0 9.15642E-5
17-48539828-G-A p.Gly225Glu missense ACSF2 1 83046 1.20415E-5 41523 0 1.19426E-5
17-48539838-C-T p.Leu228Leu synonymous ACSF2 1 83128 1.20296E-5 41564 0 NA
17-48539848-G-A p.Val232Met missense ACSF2 23 83118 2.76715E-4 41559 0 2.87356E-4
17-48539855-C-T p.Ala234Val missense ACSF2 18 83080 2.16659E-4 41540 0 5.43131E-4
17-48539856-G-A p.Ala234Ala synonymous ACSF2 4 83098 4.81359E-5 41549 0 3.19673E-5
17-48539858-C-A p.Ala235Asp missense ACSF2 95 83066 0.00114367 41533 0 0.00134048
17-48539869-C-T p.Arg239Trp missense ACSF2 10 83020 1.20453E-4 41510 0 1.40357E-4
17-48539889-C-T p.Leu245Leu synonymous ACSF2 3 83044 3.61254E-5 41522 0 3.19122E-5
17-48539898-C-T p.Asn248Asn synonymous ACSF2 1 83016 1.20459E-5 41508 0 NA
17-48539903-A-C p.Gln250Pro missense ACSF2 86 83004 0.00103609 41502 1 0.00498265
17-48539903-A-G p.Gln250Arg missense ACSF2 2 83004 2.40952E-5 41502 0 NA
17-48539925-C-T p.Pro257Pro synonymous ACSF2 62 82962 7.4733E-4 41481 0 0.00181737
17-48539928-C-T p.Ile258Ile synonymous ACSF2 2 82916 2.41208E-5 41458 0 NA
17-48539934-C-T p.Ile260Ile synonymous ACSF2 1 82864 1.2068E-5 41432 0 6.37511E-5
17-48539943-C-T p.Thr263Thr synonymous ACSF2 1 82692 1.20931E-5 41346 0 1.66362E-5
17-48539945-C-T p.Ser264Leu missense+splice_region ACSF2 2 82624 2.4206E-5 41312 0 8.32141E-6
17-48539946-G-A p.Ser264Ser splice_region+synonymous ACSF2 1 82576 1.21101E-5 41288 0 1.99687E-5
17-48539946-G-C p.Ser264Ser splice_region+synonymous ACSF2 1 82576 1.21101E-5 41288 0 NA
17-48539950-G-A c.792+4G>A splice_region ACSF2 1 82480 1.21242E-5 41240 0 NA
17-48540402-A-T n.701A>T splice_region ACSF2 2 71624 2.79236E-5 35812 0 NA
17-48540516-G-A c.793-1G>A splice_acceptor ACSF2 1 82804 1.20767E-5 41402 0 NA
17-48540528-C-G p.Gly268Gly synonymous ACSF2 1 82896 1.20633E-5 41448 0 NA
17-48540530-G-A p.Ser269Asn missense ACSF2 1 82894 1.20636E-5 41447 0 NA
17-48540537-G-A p.Lys271Lys synonymous ACSF2 2 82970 2.41051E-5 41485 0 NA
17-48540539-G-A p.Gly272Glu missense ACSF2 1 82970 1.20525E-5 41485 0 NA
17-48540543-C-T p.Ala273Ala synonymous ACSF2 1 82978 1.20514E-5 41489 0 3.98029E-6
17-48540580-A-G p.Ile286Val missense ACSF2 18 82982 2.16915E-4 41491 0 0.00125
17-48540591-G-A p.Glu289Glu synonymous ACSF2 1 82950 1.20555E-5 41475 0 NA
17-48540592-C-T p.Arg290Cys missense ACSF2 1 82928 1.20587E-5 41464 0 NA
17-48540593-G-A p.Arg290His missense ACSF2 1 82926 1.20589E-5 41463 0 1.65319E-5
17-48540605-A-C p.His294Pro missense ACSF2 3 82912 3.61829E-5 41456 0 NA
17-48540612-G-GACACCAGAGCAGTTGCGGATGATCCTGCCCAACCCCCT c.888_888+1insACACCAGAGCAGTTGCGGATGATCCTGCCCAACCCCCT splice_donor ACSF2 1 82858 1.20688E-5 41429 0 NA
17-48540619-C-T c.888+7C>T splice_region ACSF2 1 82634 1.21016E-5 41317 0 3.31543E-5
17-48540620-G-A c.888+8G>A splice_region ACSF2 3 82654 3.62959E-5 41327 0 1.32624E-4
17-48540750-C-G c.889-6C>G splice_region ACSF2 81 82384 9.83201E-4 41192 1 0.00213444
17-48540752-C-T c.889-4C>T splice_region ACSF2 3 82390 3.64122E-5 41195 0 9.55901E-5
17-48540771-C-T p.Arg302Trp missense ACSF2 1 82524 1.21177E-5 41262 0 5.03525E-4
17-48540772-G-A p.Arg302Gln missense ACSF2 2 82554 2.42266E-5 41277 0 3.18613E-5
17-48540780-C-G p.Leu305Val missense ACSF2 1 82610 1.21051E-5 41305 0 7.96864E-6
17-48540791-C-A p.Pro308Pro synonymous ACSF2 1 82704 1.20913E-5 41352 0 NA
17-48540812-C-T p.Ser315Ser synonymous ACSF2 28 82810 3.38123E-4 41405 0 0.00100705
17-48540822-A-G p.Thr319Ala missense ACSF2 1 82830 1.20729E-5 41415 0 3.18532E-5
17-48540837-A-G p.Met324Val missense ACSF2 1 82870 1.20671E-5 41435 0 NA
17-48540842-C-T p.Thr1Met missense ACSF2 2 82886 2.41295E-5 41443 0 3.98073E-6
17-48540843-G-A p.Gly326Ser missense ACSF2 1 82880 1.20656E-5 41440 0 3.18573E-5
17-48540843-G-C p.Gly326Arg missense ACSF2 1 82880 1.20656E-5 41440 0 NA
17-48540868-C-A p.Pro334His missense ACSF2 1 83044 1.20418E-5 41522 0 1.65115E-5
17-48540870-A-G p.Ile335Val missense ACSF2 1 83062 1.20392E-5 41531 0 NA
17-48540872-C-G p.Ile335Met missense ACSF2 1 83074 1.20375E-5 41537 0 NA
17-48540877-A-G p.Asn337Ser missense ACSF2 3 83092 3.61046E-5 41546 0 5.03525E-4
17-48540878-T-C p.Met13Thr missense ACSF2 1 83092 1.20349E-5 41546 0 NA
17-48540888-G-A p.Ala341Thr missense ACSF2 1 83062 1.20392E-5 41531 0 1.65423E-5
17-48540890-A-C p.His17Pro missense ACSF2 5 83076 6.01859E-5 41538 0 5.03525E-4
17-48540913-G-GAGGCACCTTCCTGTATGGTACCCCCACGATGTTC c.1046_1046+1insAGGCACCTTCCTGTATGGTACCCCCACGATGTTC splice_donor ACSF2 1 82974 1.2052E-5 41487 0 NA
17-48541173-A-G c.1047-6A>G splice_region ACSF2 1 82846 1.20706E-5 41423 0 3.18837E-5
17-48541203-C-A p.Pro357Pro synonymous ACSF2 1 83064 1.20389E-5 41532 0 1.64889E-5
17-48541205-C-T p.Thr358Met missense ACSF2 1 83070 1.2038E-5 41535 0 7.9533E-6
17-48541206-G-A p.Thr358Thr synonymous ACSF2 3 83072 3.61133E-5 41536 0 9.5584E-5
17-48541213-G-A p.Val361Met missense ACSF2 1 83056 1.20401E-5 41528 0 8.24348E-6
17-48541236-C-A p.Asp368Glu missense ACSF2 9 82988 1.08449E-4 41494 0 1.31226E-4
17-48541256-C-T p.Ser375Leu missense ACSF2 2 82772 2.41628E-5 41386 0 3.30715E-5
17-48541257-G-A p.Ser375Ser synonymous ACSF2 2 82756 2.41674E-5 41378 0 9.5584E-5
17-48541261-A-G p.Met377Val missense ACSF2 1 82676 1.20954E-5 41338 0 6.37755E-5
17-48541275-G-A c.1138+5G>A splice_region ACSF2 2 82502 2.42418E-5 41251 0 3.18573E-5
17-48541277-TGGGGCCAAGGGCAGCCAGGCTTGGGGAG-T c.1138+8_1138+35delGGGGCCAAGGGCAGCCAGGCTTGGGGAG splice_region ACSF2 1 82416 1.21336E-5 41208 0 NA
17-48541588-C-G p.Ala383Gly missense ACSF2 1 82932 1.20581E-5 41466 0 8.23696E-6
17-48541607-A-G p.Pro389Pro synonymous ACSF2 1 82954 1.20549E-5 41477 0 NA
17-48541618-G-A p.Arg393Gln missense ACSF2 1 82966 1.20531E-5 41483 0 8.23737E-6
17-48541621-C-A p.Ala394Asp missense ACSF2 1 82960 1.2054E-5 41480 0 NA
17-48541650-CTGG-C c.1215+1_1215+3delGTG splice_donor ACSF2 1 82792 1.20785E-5 41396 0 NA
17-48541659-AGTGGTG-A c.1215+5_1215+10delGTGGTG splice_region ACSF2 1 82670 1.20963E-5 41335 0 NA
17-48541661-T-C c.1215+6T>C splice_region ACSF2 1 82616 1.21042E-5 41308 0 NA
17-48541934-C-T p.Thr66Thr synonymous ACSF2 6 16194 3.70508E-4 8097 0 4.46628E-4
17-48541950-C-T p.Arg72Cys missense ACSF2 2 14848 1.34698E-4 7424 0 9.26097E-5
17-48541950-C-A p.Arg72Ser missense ACSF2 1 14848 6.73491E-5 7424 0 3.18776E-5
17-48541961-G-C n.222+1G>C splice_donor ACSF2 1 14270 7.00771E-5 7135 0 1.27486E-4
17-48545440-G-T n.239+1G>T splice_donor ACSF2 1 82878 1.20659E-5 41439 0 2.54929E-5
17-48545800-C-T n.90+7C>T splice_region ACSF2 4 83082 4.81452E-5 41541 0 3.18451E-5
17-48545942-A-G n.75-5A>G splice_region ACSF2 2 82770 2.41633E-5 41385 0 NA
17-48547547-G-A n.124G>A splice_region ACSF2 5 24 0.208333 12 0 0.188278
17-48548383-C-T c.1216-6C>T splice_region ACSF2 1 83066 1.20386E-5 41533 0 3.18613E-5
17-48548388-G-C c.1216-1G>C splice_acceptor ACSF2 3 83122 3.60915E-5 41561 0 3.18776E-5
17-48548393-C-T p.Ala407Val missense ACSF2 1 83176 1.20227E-5 41588 0 NA
17-48548397-T-A p.Tyr408* stop_gained ACSF2 1 83176 1.20227E-5 41588 0 3.97712E-6
17-48548419-G-A p.Val416Met missense ACSF2 193 83232 0.00231882 41616 0 0.00188664
17-48548428-G-A p.Ala419Thr missense ACSF2 2 83244 2.40258E-5 41622 0 4.77183E-5
17-48548429-C-T p.Ala419Val missense ACSF2 1 83244 1.20129E-5 41622 0 3.97652E-6
17-48548430-G-A p.Ala419Ala synonymous ACSF2 1 83246 1.20126E-5 41623 0 3.57896E-5
17-48548437-C-T p.Pro422Ser missense ACSF2 3 83268 3.60282E-5 41634 0 4.94299E-5
17-48548455-CAG-C p.Lys429fs frameshift ACSF2 1 83220 1.20163E-5 41610 0 3.18837E-5
17-48548457-G-C p.Gln428His missense ACSF2 1 83224 1.20158E-5 41612 0 NA
17-48548469-C-T p.Ser432Ser synonymous ACSF2 5 83188 6.01048E-5 41594 0 0.00125
17-48548470-G-A p.Val433Met missense ACSF2 3 83180 3.60664E-5 41590 0 3.18979E-5
17-48548483-T-C p.Met437Thr missense ACSF2 1 83120 1.20308E-5 41560 0 3.97735E-6
17-48548535-TCACCCAGCTGGGGTG-T n.563_*13delGTGCACCCAGCTGGG splice_region ACSF2 34 81532 4.17014E-4 40766 0 2.08757E-4
17-48549791-C-G p.Ala442Ala splice_region+synonymous ACSF2 22306 81982 0.272084 40991 3147 0.334844
17-48549792-C-T p.Arg443Trp missense ACSF2 1 82724 1.20884E-5 41362 0 1.66061E-5
17-48549793-G-A p.Arg443Gln missense ACSF2 2 82742 2.41715E-5 41371 0 2.48938E-5
17-48549794-G-A p.Arg443Arg synonymous ACSF2 1 82748 1.20849E-5 41374 0 4.01616E-6
17-48549807-G-A p.Glu448Lys missense ACSF2 27 82790 3.26126E-4 41395 0 5.03525E-4
17-48549810-G-T p.Ala449Ser missense ACSF2 1 82792 1.20785E-5 41396 0 NA
17-48549814-G-T p.Gly450Val missense ACSF2 1 82810 1.20758E-5 41405 0 NA
17-48549817-C-T p.Thr451Met missense ACSF2 1 82752 1.20843E-5 41376 0 9.55475E-5
17-48549833-C-T p.Asn456Asn synonymous ACSF2 4 82820 4.82975E-5 41410 0 0.00125
17-48549836-G-A p.Thr457Thr synonymous ACSF2 5 82832 6.03631E-5 41416 0 2.47885E-5
17-48549839-C-T p.Pro458Pro synonymous ACSF2 3 82850 3.621E-5 41425 0 1.27421E-4
17-48549839-C-G p.Pro458Pro synonymous ACSF2 2 82850 2.414E-5 41425 0 2.47917E-5
17-48549840-G-A p.Gly459Arg missense ACSF2 1 82864 1.2068E-5 41432 0 8.26296E-6
17-48549855-C-T p.Arg464* stop_gained ACSF2 1 82886 1.20648E-5 41443 0 6.37227E-5
17-48549860-G-T p.Gly465Gly synonymous ACSF2 1 82892 1.20639E-5 41446 0 NA
17-48549902-A-T n.131A>T splice_region ACSF2 1 82780 1.20802E-5 41390 0 NA
17-48549903-G-A p.Glu480Lys missense ACSF2 1 82782 1.20799E-5 41391 0 NA
17-48549904-A-T p.Glu480Val missense ACSF2 4 82776 4.83232E-5 41388 0 3.30322E-5
17-48549909-G-A p.Ala482Thr missense ACSF2 2 82756 2.41674E-5 41378 0 1.61225E-5
17-48549918-C-T p.Gln485* stop_gained ACSF2 1 82618 1.21039E-5 41309 0 NA
17-48549921-G-A p.Asp486Asn missense ACSF2 1 82568 1.21112E-5 41284 0 8.26747E-6
17-48549932-T-C p.Tyr489Tyr synonymous ACSF2 3 82356 3.64272E-5 41178 0 1.91449E-4
17-48549940-G-A p.Gly492Glu missense+splice_region ACSF2 1 82124 1.21767E-5 41062 0 NA
17-48551023-C-T c.1476-3C>T splice_region ACSF2 2 83150 2.40529E-5 41575 0 NA
17-48551032-C-T p.Val494Val synonymous ACSF2 4 83234 4.80573E-5 41617 0 3.18512E-5
17-48551033-G-A p.Ala495Thr missense ACSF2 1 83236 1.2014E-5 41618 0 1.59094E-5
17-48551037-C-A p.Thr496Lys missense ACSF2 1 83274 1.20085E-5 41637 0 NA
17-48551041-G-C p.Met497Ile missense ACSF2 1 83284 1.20071E-5 41642 0 NA
17-48551065-C-T p.Ile505Ile synonymous ACSF2 4 83342 4.7995E-5 41671 0 3.18492E-5
17-48551066-G-A p.Val506Met missense ACSF2 13 83342 1.55984E-4 41671 0 1.91071E-4
17-48551073-G-A p.Arg508His missense ACSF2 2 83352 2.39946E-5 41676 0 3.97643E-6
17-48551089-C-T p.Ile513Ile synonymous ACSF2 1 83374 1.19941E-5 41687 0 NA
17-48551092-C-A p.Ile514Ile synonymous ACSF2 21 83364 2.51907E-4 41682 0 1.23569E-4
17-48551093-C-T p.Arg515Trp missense ACSF2 2 83368 2.399E-5 41684 0 1.98815E-5
17-48551094-G-C p.Arg515Pro missense ACSF2 1 83370 1.19947E-5 41685 0 1.19288E-5
17-48551097-G-T p.Gly516Val missense ACSF2 1 83374 1.19941E-5 41687 0 NA
17-48551109-T-C p.Ile520Thr missense ACSF2 1 83386 1.19924E-5 41693 0 NA
17-48551116-C-T p.Pro522Pro synonymous ACSF2 2 83372 2.39889E-5 41686 0 1.1929E-5
17-48551122-G-T p.Glu524Asp missense ACSF2 1 83378 1.19936E-5 41689 0 NA
17-48551125-C-T p.Leu525Leu synonymous ACSF2 2 83380 2.39866E-5 41690 0 1.86885E-4
17-48551126-G-A p.Glu526Lys missense ACSF2 1 83380 1.19933E-5 41690 0 1.64742E-5
17-48551148-C-T p.Pro533Leu missense ACSF2 4 83378 4.79743E-5 41689 0 2.47105E-5
17-48551149-G-A n.481G>A splice_region ACSF2 4 83372 4.79777E-5 41686 0 3.1841E-5
17-48551165-CAGGTGAGGCACTTGGCTCAGGTGAGCCCCCAGAAACAAGAAACACACATGAACACGGTGATGTCTGATATTTTTCTTTGGCCCTGGA-C p.Gln539fs frameshift ACSF2 10 83366 1.19953E-4 41683 3 NA
17-48551169-T-C c.1617+2T>C splice_donor ACSF2 2 83366 2.39906E-5 41683 0 NA
17-48551259-T-C p.Val541Ala missense ACSF2 1 83316 1.20025E-5 41658 0 4.13654E-6
17-48551272-C-T p.Asp545Asp synonymous ACSF2 6 83214 7.21032E-5 41607 0 6.37349E-5
17-48551276-C-T p.Arg547Trp missense ACSF2 6 83184 7.21293E-5 41592 0 1.27462E-4
17-48551276-C-A p.Arg547Arg synonymous ACSF2 2 83184 2.40431E-5 41592 0 1.13861E-5
17-48551277-G-A p.Arg547Gln missense ACSF2 1 83178 1.20224E-5 41589 0 4.41213E-6
17-48551284-G-T p.Gly549Gly synonymous ACSF2 1 83120 1.20308E-5 41560 0 1.21572E-5
17-48551286-A-C p.Glu550Ala missense ACSF2 1 83106 1.20328E-5 41553 0 NA
17-48551298-C-T p.Ala554Val missense ACSF2 1 83032 1.20435E-5 41516 0 NA
17-48551302-C-T p.Cys555Cys synonymous ACSF2 1 82996 1.20488E-5 41498 0 1.46126E-5
17-48551306-C-T p.Arg557Trp missense ACSF2 1 82922 1.20595E-5 41461 0 6.11976E-5
17-48551318-G-T p.Gly561Trp missense ACSF2 15 82788 1.81186E-4 41394 0 NA
17-48551328-C-A p.Thr564Asn missense ACSF2 2 82662 2.41949E-5 41331 0 NA
17-48551332-G-A p.Thr565Thr synonymous ACSF2 9 82600 1.08959E-4 41300 1 4.29535E-5
17-48551336-G-A p.Glu567Lys missense ACSF2 1 82534 1.21162E-5 41267 0 NA
17-48551348-G-A p.Ala571Thr missense ACSF2 2 82280 2.43072E-5 41140 0 1.42898E-4
17-48551562-C-T p.Ile577Ile splice_region+synonymous ACSF2 86 83314 0.00103224 41657 1 0.00241992
17-48551567-A-C p.His579Pro missense ACSF2 1 83316 1.20025E-5 41658 0 NA
17-48551579-C-T p.Pro583Leu missense ACSF2 2 83308 2.40073E-5 41654 0 1.59052E-5
17-48551580-G-A p.Pro583Pro synonymous ACSF2 1 83310 1.20034E-5 41655 0 3.9763E-6
17-48551587-A-G p.Ile586Val missense ACSF2 2 83310 2.40067E-5 41655 0 3.18613E-4
17-48551590-G-A p.Val587Met missense ACSF2 1 83306 1.20039E-5 41653 0 8.23655E-6
17-48551628-G-GATCCAGAAATTCAAACTTCGAGAGCAGATGGAACGAC c.1797_1797+1insATCCAGAAATTCAAACTTCGAGAGCAGATGGAACGAC splice_donor ACSF2 1 83204 1.20187E-5 41602 0 NA
17-48551858-T-C c.1798-5T>C splice_region ACSF2 1 82852 1.20697E-5 41426 0 8.02015E-6
17-48551882-G-A p.Arg606Gln missense ACSF2 2 82698 2.41844E-5 41349 0 3.18431E-5
17-48551884-G-C p.Glu607Gln missense ACSF2 1 82690 1.20934E-5 41345 0 NA
17-48551893-G-A p.Glu610Lys missense ACSF2 3 82492 3.63672E-5 41246 0 8.239E-5
17-48551900-A-G p.His612Arg missense ACSF2 3 82208 3.64928E-5 41104 0 6.36902E-5