Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-6747242-G-A c.*206C>T splice_region ACRBP 1 70592 1.41659E-5 35296 0 NA
12-6747453-C-T p.Gly543Arg missense ACRBP 8 82580 9.68758E-5 41290 0 6.37836E-5
12-6747454-G-T p.Phe542Leu missense ACRBP 86 82532 0.00104202 41266 0 0.00151057
12-6747464-A-G p.Leu539Pro missense ACRBP 1 82370 1.21403E-5 41185 0 3.30136E-5
12-6747476-C-T p.Ser535Asn missense ACRBP 3 82098 3.65417E-5 41049 0 NA
12-6747478-G-A p.Phe534Phe synonymous ACRBP 1 82074 1.21841E-5 41037 0 1.9945E-5
12-6747494-C-T p.Arg529Gln missense ACRBP 2 81514 2.45357E-5 40757 0 2.39877E-5
12-6747495-G-A p.Arg529* stop_gained ACRBP 37 81452 4.54255E-4 40726 0 4.14329E-4
12-6747496-A-C p.Leu528Leu synonymous ACRBP 2 81410 2.4567E-5 40705 0 NA
12-6747504-C-T p.Val526Ile missense ACRBP 1 81244 1.23086E-5 40622 0 1.20066E-5
12-6747507-C-T p.Asp525Asn missense ACRBP 1 81114 1.23283E-5 40557 0 NA
12-6747511-A-T p.Ser523Arg missense ACRBP 2 81078 2.46676E-5 40539 0 8.26624E-6
12-6747520-A-AG p.Gly521fs frameshift ACRBP 1 80906 1.236E-5 40453 0 4.0111E-6
12-6747521-G-A p.Pro520Leu missense ACRBP 1 80910 1.23594E-5 40455 0 1.2036E-5
12-6747528-G-A p.Leu518Leu synonymous ACRBP 2 80732 2.47733E-5 40366 0 NA
12-6747529-C-T p.Ala517Ala synonymous ACRBP 5 80676 6.19763E-5 40338 0 5.03525E-4
12-6747563-C-T p.Arg506His missense ACRBP 1 79234 1.26208E-5 39617 0 7.44836E-5
12-6747578-G-C c.1510-8C>G splice_region ACRBP 53777 71838 0.748587 35919 20253 0.760816
12-6747677-G-T n.837C>A splice_region ACRBP 1 64452 1.55154E-5 32226 0 NA
12-6747841-C-T n.177G>A splice_region ACRBP 1 35426 2.82279E-5 17713 0 NA
12-6747842-G-A n.176C>T splice_region ACRBP 5 35568 1.40576E-4 17784 0 9.55962E-5
12-6748117-C-T c.1509+3G>A splice_region ACRBP 1 83204 1.20187E-5 41602 0 3.18532E-5
12-6748120-C-G p.Lys503Asn missense+splice_region ACRBP 1 83212 1.20175E-5 41606 0 NA
12-6748127-T-C p.Asn501Ser missense ACRBP 2 83228 2.40304E-5 41614 0 8.23723E-6
12-6748130-C-T p.Arg500His missense ACRBP 5 83234 6.00716E-5 41617 0 3.29495E-5
12-6748169-T-A p.Tyr487Phe missense ACRBP 13 83246 1.56164E-4 41623 0 3.50519E-4
12-6748186-A-G p.Tyr481Tyr synonymous ACRBP 1 83198 1.20195E-5 41599 0 3.97649E-6
12-6748210-C-G c.1426-7G>C splice_region ACRBP 2 83086 2.40714E-5 41543 0 7.42231E-5
12-6748211-A-G c.1426-8T>C splice_region ACRBP 1 83074 1.20375E-5 41537 0 NA
12-6749218-G-A c.1425+8C>T splice_region ACRBP 2 83218 2.40333E-5 41609 0 8.38223E-6
12-6749237-A-G p.Phe472Leu missense ACRBP 1 83316 1.20025E-5 41658 0 3.18735E-5
12-6749277-C-T p.Gly458Gly synonymous ACRBP 1 83368 1.1995E-5 41684 0 4.12011E-5
12-6749287-C-T p.Arg455Gln missense ACRBP 3 83366 3.59859E-5 41683 0 3.57907E-5
12-6749288-G-C p.Arg455Gly missense ACRBP 24 83364 2.87894E-4 41682 0 4.78042E-4
12-6749288-G-T p.Arg455Arg synonymous ACRBP 1 83366 1.19953E-5 41683 0 1.64785E-5
12-6749289-G-C p.Val454Val synonymous ACRBP 86 83368 0.00103157 41684 1 0.00197528
12-6749292-A-G p.Asp453Asp synonymous ACRBP 1 83374 1.19941E-5 41687 0 3.18593E-5
12-6749307-C-T p.Thr448Thr synonymous ACRBP 19 83352 2.27949E-4 41676 0 1.59347E-4
12-6749308-G-A p.Thr448Met missense ACRBP 1 83358 1.19964E-5 41679 0 3.97668E-6
12-6749317-C-T p.Arg445Gln missense ACRBP 2 83334 2.39998E-5 41667 0 3.97665E-6
12-6749318-G-A p.Arg445Trp missense ACRBP 2 83338 2.39987E-5 41669 0 2.38607E-5
12-6749344-C-T p.Gly436Glu missense ACRBP 1 83308 1.20036E-5 41654 0 5.03525E-4
12-6749348-C-T p.Gly435Ser missense ACRBP 2 83308 2.40073E-5 41654 0 3.29641E-5
12-6749363-C-T p.Gly430Arg missense ACRBP 6 83244 7.20773E-5 41622 0 6.84559E-4
12-6749364-G-C p.Tyr429* stop_gained ACRBP 22 83236 2.64309E-4 41618 0 1.23371E-4
12-6749364-G-A p.Tyr429Tyr synonymous ACRBP 2 83238 2.40275E-5 41619 0 5.04032E-4
12-6749370-G-A p.Arg427Arg synonymous ACRBP 1 83228 1.20152E-5 41614 0 NA
12-6749371-C-T p.Arg427His missense ACRBP 7 83206 8.41286E-5 41603 0 4.12562E-5
12-6749373-G-A p.Gly426Gly synonymous ACRBP 4 83212 4.807E-5 41606 0 1.5527E-4
12-6749384-G-A p.Pro423Ser missense ACRBP 1 83110 1.20322E-5 41555 0 8.26187E-6
12-6749388-C-G p.Gly421Gly synonymous ACRBP 46 83074 5.53723E-4 41537 0 0.00252016
12-6749388-C-T p.Gly421Gly synonymous ACRBP 1 83074 1.20375E-5 41537 0 6.25E-4
12-6749390-CTACCTGTGGCACAGGAGATAGGGGAGAGGTGCGTGCCCCTCCCCACCTGCTGGCCACCACCACCCCACCCCTGCCACCCAGTTCTGCCTTTCCCACTGCGGGCTGCCGGGCTAGA-C p.Val420_Gly421del splice_acceptor ACRBP 6 83066 7.22317E-5 41533 0 NA
12-6749515-G-T p.Gly417Gly synonymous ACRBP 1 82714 1.20899E-5 41357 0 8.30496E-6
12-6749518-G-A p.Ile416Ile synonymous ACRBP 1 82752 1.20843E-5 41376 0 1.66074E-5
12-6749537-G-A p.Ala410Val missense ACRBP 1 82902 1.20624E-5 41451 0 NA
12-6749545-G-A p.Pro407Pro synonymous ACRBP 1 82954 1.20549E-5 41477 0 3.18431E-5
12-6749564-T-C p.Lys401Arg missense ACRBP 1 83018 1.20456E-5 41509 0 4.9824E-5
12-6749567-T-G p.His400Pro missense ACRBP 4 83004 4.81904E-5 41502 0 1.19409E-5
12-6749572-G-A p.Thr398Thr synonymous ACRBP 2 83000 2.40964E-5 41500 0 3.9807E-6
12-6749577-C-T p.Asp397Asn missense ACRBP 3 82966 3.61594E-5 41483 0 3.32878E-5
12-6749578-G-T p.Cys396* stop_gained ACRBP 1 82972 1.20523E-5 41486 0 NA
12-6749583-G-A p.Gln395* stop_gained ACRBP 1 82968 1.20528E-5 41484 0 NA
12-6749588-C-T p.Arg393Gln missense ACRBP 1 82946 1.2056E-5 41473 0 3.18674E-5
12-6749589-G-A p.Arg393Trp missense ACRBP 1 82932 1.20581E-5 41466 0 7.968E-6
12-6749616-G-A p.Gln384* stop_gained ACRBP 2 82582 2.42184E-5 41291 0 3.98829E-6
12-6749633-C-G p.Cys378Ser missense ACRBP 1 82490 1.21227E-5 41245 0 NA
12-6749655-T-A p.Thr371Ser missense ACRBP 1 82156 1.2172E-5 41078 0 NA
12-6749659-CAT-C p.Met369fs frameshift ACRBP 3 82082 3.65488E-5 41041 0 2.40046E-5
12-6749666-C-T p.Arg367Gln missense ACRBP 2 81702 2.44792E-5 40851 0 5.19436E-5
12-6749668-C-T p.Arg366Arg synonymous ACRBP 7 81536 8.58517E-5 40768 0 0.00151362
12-6749670-G-A p.Arg366Trp missense ACRBP 4 81390 4.91461E-5 40695 0 6.83131E-5
12-6749686-G-C p.Val360Val splice_region+synonymous ACRBP 1 80942 1.23545E-5 40471 0 3.18654E-5
12-6749689-C-CGACTTCCCGAAACCAAGGATCTCCTCCTCCATG c.1078-2_1078-1insCATGGAGGAGGAGATCCTTGGTTTCGGGAAGTC splice_acceptor ACRBP 1 80794 1.23772E-5 40397 0 NA
12-6749689-C-CGACTTCCCGAAACCAAGGATCTCCTCCTCCATGTACTTCCAGGCCTTGGCTG c.1078-2_1078-1insCAGCCAAGGCCTGGAAGTACATGGAGGAGGAGATCCTTGGTTTCGGGAAGTC splice_acceptor ACRBP 1 80792 1.23775E-5 40396 0 NA
12-6749692-G-A c.1078-4C>T splice_region ACRBP 1 80592 1.24082E-5 40296 0 3.18695E-5
12-6752707-A-G p.Ser359Pro missense+splice_region ACRBP 4 83306 4.80158E-5 41653 0 1.98889E-5
12-6752714-G-A p.Phe356Phe synonymous ACRBP 1 83320 1.20019E-5 41660 0 9.55597E-5
12-6752737-T-C p.Met349Val missense ACRBP 6 83380 7.19597E-5 41690 0 1.64758E-5
12-6752738-G-A p.Tyr348Tyr synonymous ACRBP 271 83372 0.00325049 41686 5 0.00448959
12-6752748-G-A p.Ala345Val missense ACRBP 1 83388 1.19921E-5 41694 0 8.2375E-6
12-6752753-G-C p.Ala343Ala synonymous ACRBP 6 83388 7.19528E-5 41694 0 1.4004E-4
12-6752755-C-T p.Ala343Thr missense ACRBP 1 83390 1.19918E-5 41695 0 NA
12-6752758-T-C p.Thr342Ala missense ACRBP 1 83386 1.19924E-5 41693 0 NA
12-6752776-T-C p.Thr336Ala missense ACRBP 17 83380 2.03886E-4 41690 0 0.00151057
12-6752789-C-T p.Ser331Ser synonymous ACRBP 1 83354 1.1997E-5 41677 0 1.98818E-5
12-6752801-C-A p.Val327Val synonymous ACRBP 5 83330 6.00024E-5 41665 0 8.24049E-6
12-6752804-C-CA p.Val327fs frameshift ACRBP 1 83320 1.20019E-5 41660 0 NA
12-6752811-G-T p.Ala324Asp missense ACRBP 1 83312 1.20031E-5 41656 0 3.18492E-5
12-6752813-C-T p.Glu323Glu synonymous ACRBP 1 83312 1.20031E-5 41656 0 8.24294E-6
12-6752813-C-A p.Glu323Asp missense ACRBP 1 83312 1.20031E-5 41656 0 1.19309E-5
12-6752819-G-A p.His321His synonymous ACRBP 1 83268 1.20094E-5 41634 0 7.9552E-6
12-6752820-T-C p.His321Arg missense ACRBP 1 83264 1.201E-5 41632 0 NA
12-6752828-C-T p.Gln318Gln synonymous ACRBP 5 83206 6.00918E-5 41603 0 1.27389E-4
12-6752832-A-G p.Leu317Pro missense ACRBP 4 83184 4.80862E-5 41592 0 8.25096E-6
12-6752833-G-A p.Leu317Leu synonymous ACRBP 2 83182 2.40437E-5 41591 0 1.19415E-5
12-6752835-A-C p.Leu316Arg missense+splice_region ACRBP 6 83144 7.2164E-5 41572 0 8.25273E-6
12-6753293-C-A p.Lys318Asn missense ACRBP 3 82434 3.63928E-5 41217 0 1.9102E-5
12-6753299-A-G c.944+4T>C splice_region ACRBP 1 82584 1.21089E-5 41292 0 NA
12-6753300-T-C p.Tyr316Cys missense ACRBP 2 82630 2.42043E-5 41315 0 NA
12-6753316-G-C p.Gln311Glu missense ACRBP 1 82986 1.20502E-5 41493 0 NA
12-6753317-G-C p.Asn310Lys missense ACRBP 1 83014 1.20462E-5 41507 0 NA
12-6753324-C-T p.Trp308* stop_gained ACRBP 1 83076 1.20372E-5 41538 0 NA
12-6753327-T-C p.Tyr307Cys missense ACRBP 6 83122 7.21831E-5 41561 0 3.18532E-5
12-6753332-G-A p.Asn305Asn synonymous ACRBP 1 83190 1.20207E-5 41595 0 NA
12-6753334-TCTC-T p.Glu304del conservative_inframe_deletion ACRBP 2 83196 2.40396E-5 41598 0 4.35267E-5
12-6753343-A-G p.Tyr302His missense ACRBP 1 83268 1.20094E-5 41634 0 2.5613E-5
12-6753344-T-TATTTCATTC p.Met298_Glu300dup disruptive_inframe_insertion ACRBP 2 83274 2.40171E-5 41637 0 NA
12-6753361-C-T p.Asp296Asn missense ACRBP 1 83318 1.20022E-5 41659 0 NA
12-6753371-G-T p.Ala292Ala synonymous ACRBP 1 83348 1.19979E-5 41674 0 NA
12-6753372-G-A p.Ala292Val missense ACRBP 3 83348 3.59937E-5 41674 0 4.13196E-5
12-6753378-C-T p.Arg290Gln missense ACRBP 8 83356 9.59739E-5 41678 0 4.95221E-5
12-6753402-A-G p.Met282Thr missense ACRBP 1 83374 1.19941E-5 41687 0 1.64818E-5
12-6753409-T-C p.Met280Val missense ACRBP 2 83380 2.39866E-5 41690 0 1.64791E-5
12-6753410-A-T p.Pro279Pro synonymous ACRBP 1 83378 1.19936E-5 41689 0 8.23954E-6
12-6753415-T-G p.Thr278Pro missense ACRBP 1 83376 1.19939E-5 41688 0 6.37674E-5
12-6753424-C-T p.Val275Ile missense ACRBP 6 83386 7.19545E-5 41693 0 4.09585E-4
12-6753434-C-T p.Arg271Arg synonymous ACRBP 1 83384 1.19927E-5 41692 0 3.97655E-6
12-6753435-C-T p.Arg271Gln missense ACRBP 4 83388 4.79685E-5 41694 0 3.18573E-5
12-6753436-G-A p.Arg271Trp missense ACRBP 3 83390 3.59755E-5 41695 0 1.59062E-5
12-6753442-C-T p.Ala269Thr missense ACRBP 1 83398 1.19907E-5 41699 0 NA
12-6753449-G-C p.Ser266Ser synonymous ACRBP 1 83400 1.19904E-5 41700 0 7.95279E-6
12-6753452-A-G p.Pro265Pro synonymous ACRBP 1 83396 1.1991E-5 41698 0 NA
12-6753464-T-C p.Leu261Leu synonymous ACRBP 2 83390 2.39837E-5 41695 0 3.97649E-6
12-6753470-T-C p.Glu259Glu synonymous ACRBP 1 83388 1.19921E-5 41694 0 NA
12-6753471-T-G p.Glu259Ala missense ACRBP 4 83390 4.79674E-5 41695 0 3.18451E-5
12-6753476-G-C p.His257Gln missense ACRBP 2 83386 2.39848E-5 41693 0 3.18613E-5
12-6753476-G-A p.His257His synonymous ACRBP 1 83386 1.19924E-5 41693 0 1.35208E-4
12-6753522-C-T p.Arg242Gln missense ACRBP 3 83344 3.59954E-5 41672 0 6.37796E-5
12-6753522-C-A p.Arg242Leu missense ACRBP 1 83344 1.19985E-5 41672 0 NA
12-6753525-C-T p.Gly241Glu missense ACRBP 13 83338 1.55991E-4 41669 0 6.3875E-4
12-6753537-C-T p.Gly237Glu missense ACRBP 1 83330 1.20005E-5 41665 0 3.19247E-5
12-6753543-CCTT-C p.Glu234del disruptive_inframe_deletion ACRBP 1 83316 1.20025E-5 41658 0 NA
12-6753546-T-C p.Glu234Gly missense ACRBP 2 83310 2.40067E-5 41655 0 NA
12-6753560-CTCCTCTTCCTGT-C p.Gln226_Glu229del disruptive_inframe_deletion ACRBP 2 83298 2.40102E-5 41649 0 1.65983E-5
12-6753570-T-A p.Gln226Leu missense ACRBP 5 83312 6.00154E-5 41656 0 6.36983E-5
12-6753577-C-T p.Glu224Lys missense ACRBP 1 83314 1.20028E-5 41657 0 NA
12-6753597-T-C p.Gln217Arg missense ACRBP 2 83316 2.4005E-5 41658 0 1.64815E-5
12-6753604-C-T p.Glu215Lys missense ACRBP 2 83320 2.40038E-5 41660 0 NA
12-6753612-T-C p.Lys212Arg missense ACRBP 6 83332 7.20012E-5 41666 0 1.59286E-4
12-6753621-T-C p.Gln209Arg missense ACRBP 1 83330 1.20005E-5 41665 0 NA
12-6753622-G-T p.Gln209Lys missense ACRBP 1 83328 1.20008E-5 41664 0 NA
12-6753626-C-T p.Pro207Pro synonymous ACRBP 2 83326 2.40021E-5 41663 0 6.25E-4
12-6753627-G-A p.Pro207Leu missense ACRBP 8 83322 9.60131E-5 41661 0 6.25E-4
12-6753628-G-C p.Pro207Ala missense ACRBP 1 83322 1.20016E-5 41661 0 8.23737E-6
12-6753636-C-T p.Arg204Lys missense ACRBP 1 83330 1.20005E-5 41665 0 8.23737E-6
12-6753642-T-C p.Glu202Gly missense ACRBP 1 83332 1.20002E-5 41666 0 8.2371E-6
12-6753653-C-T p.Glu198Glu synonymous ACRBP 1 83326 1.20011E-5 41663 0 NA
12-6753657-T-G p.Gln197Pro missense ACRBP 3 83320 3.60058E-5 41660 0 1.19292E-5
12-6753667-C-G p.Glu194Gln missense ACRBP 7 83324 8.40094E-5 41662 0 6.37267E-5
12-6753671-C-T p.Ala159Ala splice_region+synonymous ACRBP 4 83316 4.801E-5 41658 0 6.58957E-5
12-6753672-G-A p.Ala159Val missense+splice_region ACRBP 7 83316 8.40175E-5 41658 0 5.03525E-4
12-6753684-C-A p.Gly188Val missense ACRBP 1 83310 1.20034E-5 41655 0 6.58989E-5
12-6753692-G-A p.Ser185Ser synonymous ACRBP 1 83306 1.20039E-5 41653 0 NA
12-6753701-G-T p.Ser182Ser synonymous ACRBP 1 83304 1.20042E-5 41652 0 NA
12-6753705-T-C p.Gln181Arg missense ACRBP 4 83300 4.80192E-5 41650 0 NA
12-6753721-C-T p.Val176Met missense ACRBP 70 83292 8.40417E-4 41646 0 0.00178412
12-6753722-G-A p.Asn173Asn splice_region+synonymous ACRBP 2 83296 2.40108E-5 41648 0 2.38764E-5
12-6753733-G-C p.Leu172Val missense ACRBP 2 83270 2.40183E-5 41635 0 6.25E-4
12-6753734-C-T p.Arg171Arg synonymous ACRBP 1 83262 1.20103E-5 41631 0 NA
12-6753745-A-T p.Trp168Arg missense ACRBP 3 83234 3.6043E-5 41617 0 3.59345E-5
12-6753760-G-T p.Gln163Lys missense ACRBP 2 83142 2.40552E-5 41571 0 NA
12-6753762-C-T p.Arg162His missense ACRBP 6 83106 7.2197E-5 41553 0 6.37349E-5
12-6753763-G-A p.Arg160Cys missense+splice_region ACRBP 1 83098 1.2034E-5 41549 0 8.43711E-6
12-6754396-G-A p.Pro155Pro synonymous ACRBP 2 82832 2.41453E-5 41416 0 6.37105E-5
12-6754415-A-G p.Met149Thr missense ACRBP 1 83072 1.20378E-5 41536 0 NA
12-6754416-T-C p.Met149Val missense ACRBP 3 83082 3.61089E-5 41541 0 3.2969E-5
12-6754417-C-T p.Thr148Thr synonymous ACRBP 6 83092 7.22091E-5 41546 0 4.78145E-5
12-6754418-G-A p.Thr148Met missense ACRBP 16 83118 1.92497E-4 41559 0 5.76948E-5
12-6754427-G-A p.Ser145Leu missense ACRBP 1 83186 1.20213E-5 41593 0 8.24158E-6
12-6754430-A-G p.Val144Ala missense ACRBP 1 83196 1.20198E-5 41598 0 1.1947E-5
12-6754432-T-C p.Glu143Glu synonymous ACRBP 1 83214 1.20172E-5 41607 0 NA
12-6754440-A-C p.Ser141Ala missense ACRBP 5 83242 6.00658E-5 41621 0 7.56634E-5
12-6754452-C-T p.Glu137Lys missense ACRBP 1 83250 1.2012E-5 41625 0 3.18674E-5
12-6754467-G-C p.Pro132Ala missense ACRBP 1 83240 1.20135E-5 41620 0 3.29609E-5
12-6754479-A-T p.Ser128Thr missense ACRBP 419 83228 0.00503436 41614 8 0.00770995
12-6754481-ACTGG-A p.Pro126fs frameshift ACRBP 1 83232 1.20146E-5 41616 0 NA
12-6754490-GA-G p.Ser124fs frameshift ACRBP 1 83164 1.20244E-5 41582 0 NA
12-6754495-C-T p.Val91Met missense ACRBP 639 83088 0.00769064 41544 20 0.0200624
12-6754505-T-TTGGCATAGTAGACGTGGTTGGAGCAACGGTAGTGAGTGAACTG c.358-3_358-2insCAGTTCACTCACTACCGTTGCTCCAACCACGTCTACTATGCCA splice_region ACRBP 1 83050 1.20409E-5 41525 0 NA
12-6755666-G-T p.His114Asn missense ACRBP 2 83298 2.40102E-5 41649 0 1.91266E-4
12-6755677-C-T p.Arg110His missense ACRBP 1 83334 1.19999E-5 41667 0 3.97643E-6
12-6755688-G-A p.Phe106Phe synonymous ACRBP 3 83336 3.59988E-5 41668 0 1.59368E-4
12-6755689-A-C p.Phe106Cys missense ACRBP 1 83332 1.20002E-5 41666 0 7.95279E-6
12-6755692-T-C p.Gln105Arg missense ACRBP 3 83336 3.59988E-5 41668 0 8.23805E-6
12-6755706-A-T p.Phe100Leu missense ACRBP 1 83326 1.20011E-5 41663 0 3.97649E-6
12-6755724-G-A p.Leu94Leu synonymous ACRBP 1 83324 1.20013E-5 41662 0 NA
12-6755728-T-C p.Asn93Ser missense ACRBP 5 83300 6.0024E-5 41650 0 2.55673E-4
12-6755730-G-A p.Ser92Ser synonymous ACRBP 2 83298 2.40102E-5 41649 0 NA
12-6755731-G-A p.Ser92Phe missense ACRBP 1 83296 1.20054E-5 41648 0 NA
12-6755731-G-C p.Ser92Cys missense ACRBP 1 83296 1.20054E-5 41648 0 1.27502E-4
12-6755740-G-C p.Ala89Gly missense ACRBP 1 83260 1.20106E-5 41630 0 NA
12-6755975-C-T p.Gly83Ser missense ACRBP 2 82884 2.41301E-5 41442 0 3.98184E-6
12-6755976-G-T p.His82Gln missense ACRBP 2 82912 2.4122E-5 41456 0 3.98232E-5
12-6755976-G-A p.His82His synonymous ACRBP 1 82912 1.2061E-5 41456 0 3.98232E-6
12-6755985-A-T p.Tyr79* stop_gained ACRBP 1 82986 1.20502E-5 41493 0 8.27828E-6
12-6755996-G-A p.Leu76Leu synonymous ACRBP 2 83016 2.40917E-5 41508 0 3.97969E-6
12-6756002-C-T p.Val74Ile missense ACRBP 1 83026 1.20444E-5 41513 0 1.65344E-5
12-6756003-G-A p.Leu73Leu synonymous ACRBP 5 83046 6.02076E-5 41523 0 6.25E-4
12-6756004-A-G p.Leu73Pro missense ACRBP 1 83030 1.20438E-5 41515 0 NA
12-6756035-G-A p.Arg63Cys missense ACRBP 1 83114 1.20317E-5 41557 0 3.89938E-4
12-6756036-G-A p.Leu62Leu synonymous ACRBP 1 83116 1.20314E-5 41558 0 NA
12-6756040-C-T p.Arg61His missense ACRBP 1 83122 1.20305E-5 41561 0 1.19364E-5
12-6756050-T-C p.Thr58Ala missense ACRBP 1 83114 1.20317E-5 41557 0 1.65142E-5
12-6756065-T-C p.Thr53Ala missense ACRBP 8 83106 9.62626E-5 41553 0 5.17273E-5
12-6756065-T-A p.Thr53Ser missense ACRBP 1 83106 1.20328E-5 41553 0 3.18918E-5
12-6756078-T-G p.Ala48Ala synonymous ACRBP 4 83080 4.81464E-5 41540 0 1.5919E-5
12-6756091-T-C p.Glu44Gly missense ACRBP 1 83096 1.20343E-5 41548 0 3.18898E-5
12-6756092-C-G p.Glu44Gln missense ACRBP 1 83082 1.20363E-5 41541 0 3.9814E-6
12-6756100-G-C p.Thr41Ser missense ACRBP 1 83062 1.20392E-5 41531 0 NA
12-6756101-T-C p.Thr41Ala missense ACRBP 2 83054 2.40807E-5 41527 0 NA
12-6756120-T-G p.Pro34Pro synonymous ACRBP 1 82990 1.20496E-5 41495 0 3.98874E-6
12-6756120-T-C p.Pro34Pro synonymous ACRBP 1 82990 1.20496E-5 41495 0 NA
12-6756130-G-A p.Ala31Val missense ACRBP 2 82900 2.41255E-5 41450 0 3.9968E-6
12-6756138-C-T p.Ser28Ser synonymous ACRBP 1 82808 1.20761E-5 41404 0 NA
12-6756143-C-A p.Asp27Tyr missense ACRBP 1 82792 1.20785E-5 41396 0 1.24707E-4
12-6756145-T-TG p.Gln26fs frameshift ACRBP 2 82774 2.41622E-5 41387 0 NA
12-6756159-T-C p.Ala21Ala synonymous ACRBP 1 82368 1.21406E-5 41184 0 NA
12-6756161-C-T p.Ala21Thr missense ACRBP 1 82304 1.21501E-5 41152 0 NA
12-6756166-G-C p.Pro19Arg missense ACRBP 1 82326 1.21468E-5 41163 0 NA
12-6756167-G-A p.Pro19Ser missense ACRBP 2 82306 2.42996E-5 41153 0 3.18654E-5
12-6756169-A-C p.Leu18Arg missense ACRBP 2 82218 2.43256E-5 41109 0 NA
12-6756176-G-A p.Leu16Leu splice_region+synonymous ACRBP 2 81824 2.44427E-5 40912 0 NA
12-6756185-A-G c.44-7T>C splice_region ACRBP 19 81486 2.33169E-4 40743 0 0.00126263
12-6756185-A-C c.44-7T>G splice_region ACRBP 1 81486 1.2272E-5 40743 0 2.62352E-5
12-6756497-G-T p.Leu12Leu synonymous ACRBP 34 80990 4.19805E-4 40495 0 0.00125
12-6756503-GGGAA-G p.Leu9fs frameshift ACRBP 2 80994 2.46932E-5 40497 0 8.99847E-5
12-6756517-C-T p.Ala6Thr missense ACRBP 27 80886 3.33803E-4 40443 1 3.20225E-5
12-6756518-G-A p.Ala5Ala synonymous ACRBP 7 80920 8.65052E-5 40460 0 1.92994E-4
12-6756518-G-C p.Ala5Ala synonymous ACRBP 3 80920 3.70737E-5 40460 0 6.57212E-6
12-6756525-T-C p.Lys3Arg missense ACRBP 1 80744 1.23848E-5 40372 0 NA
12-6756537-G-A c.-5C>T 5_prime_UTR_premature_start_codon_gain ACRBP 311 80336 0.00387124 40168 2 0.00794108
12-6756558-C-A c.-26G>T 5_prime_UTR_premature_start_codon_gain ACRBP 1 79292 1.26116E-5 39646 0 6.4156E-5
12-6756559-G-A c.-27C>T 5_prime_UTR_premature_start_codon_gain ACRBP 7 79192 8.83928E-5 39596 0 6.41108E-5
12-6756568-A-G c.-36T>C 5_prime_UTR_premature_start_codon_gain ACRBP 1 78714 1.27042E-5 39357 0 2.67165E-5
12-6756587-A-G c.-55T>C 5_prime_UTR_premature_start_codon_gain ACRBP 3 78324 3.83024E-5 39162 0 6.40533E-5
12-6756594-G-A c.-62C>T 5_prime_UTR_premature_start_codon_gain ACRBP 1 78168 1.2793E-5 39084 0 2.56016E-4
12-6756611-G-A c.-79C>T 5_prime_UTR_premature_start_codon_gain ACRBP 1 76604 1.30541E-5 38302 0 NA