Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-147102854-G-C p.Tyr157* stop_gained ACP6 20 66 0.30303 33 5 0.5
1-147119172-T-C n.903A>G splice_region ACP6 2 82248 2.43167E-5 41124 0 NA
1-147119257-T-A p.Thr419Ser missense ACP6 985 83104 0.0118526 41552 10 0.0112474
1-147119272-C-A p.Ala414Ser missense ACP6 1 83128 1.20296E-5 41564 0 NA
1-147119273-G-A p.His413His synonymous ACP6 45778 82780 0.553008 41390 12791 0.540951
1-147119276-G-A p.Tyr412Tyr synonymous ACP6 3 83122 3.60915E-5 41561 0 6.36821E-5
1-147119283-T-C p.Glu410Gly missense ACP6 1 83120 1.20308E-5 41560 0 NA
1-147119285-T-C p.Pro409Pro synonymous ACP6 2 83098 2.4068E-5 41549 0 1.64753E-5
1-147119305-A-C p.Ser403Ala missense ACP6 4 83078 4.81475E-5 41539 0 NA
1-147119308-T-C p.Met402Val missense ACP6 274 83054 0.00329906 41527 5 0.00713149
1-147119308-T-A p.Met402Leu missense ACP6 1 83058 1.20398E-5 41529 0 3.97801E-6
1-147119329-G-C p.Leu395Val missense ACP6 1 82868 1.20674E-5 41434 0 3.98235E-6
1-147119339-C-A p.Gly391Gly synonymous ACP6 1 82724 1.20884E-5 41362 0 NA
1-147119343-T-A p.Asp390Val missense ACP6 2 82676 2.41908E-5 41338 0 2.47664E-5
1-147119357-C-T p.Pro385Pro synonymous ACP6 1 82470 1.21256E-5 41235 0 0.00101626
1-147119370-T-TTCCCGTGGTAATAGA c.1144-3_1144-2insTCTATTACCACGGGA splice_region ACP6 1 82176 1.2169E-5 41088 0 NA
1-147120040-G-A c.1143+8C>T splice_region ACP6 1 83226 1.20155E-5 41613 0 NA
1-147120053-C-T p.Gly380Arg missense ACP6 2 83306 2.40079E-5 41653 0 1.65033E-5
1-147120054-G-A p.His379His synonymous ACP6 1 83312 1.20031E-5 41656 0 5.03525E-4
1-147120057-G-A p.Tyr378Tyr synonymous ACP6 1 83314 1.20028E-5 41657 0 2.38719E-5
1-147120061-T-C p.Tyr377Cys missense ACP6 17 83338 2.03989E-4 41669 0 2.54956E-4
1-147120066-C-T p.Gln375Gln synonymous ACP6 7 83338 8.39953E-5 41669 0 6.37186E-5
1-147120072-A-G p.Phe373Phe synonymous ACP6 6 83362 7.19752E-5 41681 0 1.35229E-4
1-147120077-A-T p.Trp372Arg missense ACP6 1 83368 1.1995E-5 41684 0 NA
1-147120086-A-T p.Ser369Thr missense ACP6 2 83386 2.39848E-5 41693 0 3.97678E-6
1-147120120-A-C p.Val357Val synonymous ACP6 1 83416 1.19881E-5 41708 0 1.64739E-5
1-147120125-C-T p.Ala356Thr missense ACP6 3 83412 3.5966E-5 41706 0 1.40026E-4
1-147120129-C-T p.Pro354Pro synonymous ACP6 2 83410 2.39779E-5 41705 0 1.64737E-5
1-147120136-C-T p.Trp352* stop_gained ACP6 1 83402 1.19901E-5 41701 0 NA
1-147120144-G-A p.Asp349Asp synonymous ACP6 11 83390 1.3191E-4 41695 0 9.88419E-5
1-147120168-G-A p.Leu341Leu synonymous ACP6 3 83374 3.59824E-5 41687 0 NA
1-147120171-C-A p.Pro340Pro synonymous ACP6 115 83350 0.00137972 41675 2 0.00315447
1-147120171-C-T p.Pro340Pro synonymous ACP6 4 83354 4.79881E-5 41677 0 6.37267E-5
1-147120177-G-A p.Phe338Phe synonymous ACP6 1 83358 1.19964E-5 41679 0 8.23832E-6
1-147120183-C-G p.Val336Val synonymous ACP6 1 83332 1.20002E-5 41666 0 NA
1-147120193-G-T p.Ala333Asp missense ACP6 1 83288 1.20065E-5 41644 0 7.95684E-6
1-147120195-C-T p.Ala332Ala synonymous ACP6 1 83270 1.20091E-5 41635 0 1.27453E-4
1-147120196-G-A p.Ala332Val missense ACP6 123 83268 0.00147716 41634 2 0.0030276
1-147120199-T-C p.Tyr331Cys missense ACP6 2 83252 2.40234E-5 41626 0 7.95874E-6
1-147120199-T-G p.Tyr331Ser missense ACP6 5 83252 6.00586E-5 41626 0 3.97937E-6
1-147120216-G-C c.978-3C>G splice_region ACP6 1 83142 1.20276E-5 41571 0 NA
1-147120219-A-T c.978-6T>A splice_region ACP6 2 83108 2.40651E-5 41554 0 NA
1-147120220-G-C c.978-7C>G splice_region ACP6 1 83096 1.20343E-5 41548 0 NA
1-147121941-G-A c.977+5C>T splice_region ACP6 2 82424 2.42648E-5 41212 0 2.05948E-4
1-147121957-G-A p.Pro322Pro synonymous ACP6 2 82590 2.4216E-5 41295 0 8.23723E-6
1-147121958-G-A p.Pro322Leu missense ACP6 1 82610 1.21051E-5 41305 0 4.09742E-6
1-147121974-C-T p.Asp317Asn missense ACP6 1 82744 1.20855E-5 41372 0 2.47117E-5
1-147121977-C-T p.Val316Met missense ACP6 82104 82572 0.994332 41286 40828 1.0
1-147121997-TC-CT p.Glu309Arg missense ACP6 3 82746 3.62555E-5 41373 0 NA
1-147121998-C-A p.Glu309* stop_gained ACP6 1 82744 1.20855E-5 41372 0 NA
1-147121999-T-C p.Leu308Leu synonymous ACP6 1 82736 1.20866E-5 41368 0 NA
1-147122003-A-T p.Ile307Asn missense ACP6 3 82734 3.62608E-5 41367 0 8.24443E-6
1-147122004-T-A p.Ile307Phe missense ACP6 1 82716 1.20896E-5 41358 0 NA
1-147122019-C-T p.Gly302Ser missense ACP6 2 82648 2.4199E-5 41324 0 NA
1-147122030-T-C p.Gln298Arg missense ACP6 1 82544 1.21148E-5 41272 0 NA
1-147122037-T-C p.Ser296Gly missense ACP6 3 82432 3.63936E-5 41216 0 8.3149E-6
1-147122045-TG-T c.882-5delC splice_region ACP6 6 82326 7.2881E-5 41163 0 3.18532E-5
1-147124248-T-G c.881+4A>C splice_region ACP6 1 82416 1.21336E-5 41208 0 8.5778E-6
1-147124258-TC-T p.Glu292fs frameshift ACP6 1 82574 1.21103E-5 41287 0 NA
1-147124262-T-G p.Lys291Gln missense ACP6 1 82636 1.21013E-5 41318 0 3.99131E-6
1-147124271-T-C p.Ile288Val missense ACP6 1 82716 1.20896E-5 41358 0 3.98441E-6
1-147124273-T-C p.Tyr287Cys missense ACP6 1 82754 1.2084E-5 41377 0 NA
1-147124278-G-C p.Ser285Ser synonymous ACP6 1 82818 1.20747E-5 41409 0 6.37349E-5
1-147124281-T-A p.Thr284Thr synonymous ACP6 1 82830 1.20729E-5 41415 0 3.97912E-6
1-147124301-C-T p.Glu278Lys missense ACP6 2 82848 2.41406E-5 41424 0 1.19334E-5
1-147124302-G-A p.Ile277Ile synonymous ACP6 1 82862 1.20683E-5 41431 0 3.30426E-5
1-147124308-CCT-TCG p.Arg275Arg synonymous ACP6 3 82910 3.61838E-5 41455 1 NA
1-147124308-C-T p.Arg275Arg synonymous ACP6 3 82910 3.61838E-5 41455 0 1.59101E-5
1-147124309-C-T p.Arg275Lys missense ACP6 5 82892 6.03195E-5 41446 0 6.25E-4
1-147124309-CT-TG p.Arg275Gln missense ACP6 3 82892 3.61917E-5 41446 0 NA
1-147124310-T-G p.Arg275Arg synonymous ACP6 56802 80812 0.702891 40406 19989 0.731528
1-147124310-T-A p.Arg275Trp missense ACP6 2 82924 2.41185E-5 41462 0 3.20143E-5
1-147124311-T-G p.Ala274Ala synonymous ACP6 1 82896 1.20633E-5 41448 0 8.24253E-6
1-147124321-T-C p.Lys271Arg missense ACP6 2 82900 2.41255E-5 41450 0 NA
1-147124327-A-G p.Met269Thr missense ACP6 1 82912 1.2061E-5 41456 0 NA
1-147124336-C-G p.Ser266Thr missense ACP6 1 82870 1.20671E-5 41435 0 NA
1-147124339-G-A p.Pro265Leu missense ACP6 8 82840 9.65717E-5 41420 0 5.04032E-4
1-147124346-T-C p.Asn263Asp missense ACP6 1 82806 1.20764E-5 41403 0 NA
1-147124350-T-C p.Ala261Ala splice_region+synonymous ACP6 1 82782 1.20799E-5 41391 0 3.9789E-6
1-147124354-T-C c.781-2A>G splice_acceptor ACP6 1 82768 1.2082E-5 41384 0 6.38814E-5
1-147124392-T-C n.137+3A>G splice_region ACP6 208 82220 0.0025298 41110 2 0.00517704
1-147124395-C-T n.137G>A splice_region ACP6 1 82096 1.21809E-5 41048 0 NA
1-147124419-C-A p.Ser271Ile missense ACP6 2 81114 2.46567E-5 40557 0 4.44294E-5
1-147124430-C-A p.Arg267Ser missense ACP6 4 80888 4.94511E-5 40444 0 6.25E-4
1-147124452-T-G c.781-2A>C splice_acceptor ACP6 1 80504 1.24217E-5 40252 0 NA
1-147126301-G-C c.780+8C>G splice_region ACP6 2 83138 2.40564E-5 41569 0 1.59205E-4
1-147126314-C-T p.Glu259Lys missense ACP6 1 83240 1.20135E-5 41620 0 3.18573E-5
1-147126315-G-A p.Ala258Ala synonymous ACP6 5 83230 6.00745E-5 41615 0 3.29962E-5
1-147126317-C-T p.Ala258Thr missense ACP6 1 83244 1.20129E-5 41622 0 NA
1-147126323-C-T p.Val256Met missense ACP6 4 83268 4.80377E-5 41634 0 4.1216E-5
1-147126336-G-A p.Ile251Ile synonymous ACP6 1 83300 1.20048E-5 41650 0 3.97719E-6
1-147126354-A-G p.Asp245Asp synonymous ACP6 1 83340 1.1999E-5 41670 0 7.95305E-6
1-147126374-T-C p.Met239Val missense ACP6 1 83346 1.19982E-5 41673 0 NA
1-147126397-T-C p.Asp231Gly missense ACP6 1 83316 1.20025E-5 41658 0 NA
1-147126401-C-G p.Glu230Gln missense ACP6 1 83306 1.20039E-5 41653 0 NA
1-147126416-G-C p.Gln225Glu missense ACP6 40 83266 4.80388E-4 41633 0 3.14218E-4
1-147126417-T-C p.Leu224Leu synonymous ACP6 439 83266 0.00527226 41633 3 0.0106058
1-147126419-A-C p.Leu224Val missense ACP6 1 83258 1.20109E-5 41629 0 NA
1-147126423-G-C p.Ala222Ala synonymous ACP6 5 83246 6.00629E-5 41623 0 NA
1-147126427-G-A p.Thr221Ile missense ACP6 1 83224 1.20158E-5 41612 0 7.95488E-6
1-147126432-C-T p.Arg219Arg synonymous ACP6 1 83182 1.20218E-5 41591 0 3.97839E-6
1-147126436-C-T p.Arg218Gln missense ACP6 3 83100 3.61011E-5 41550 0 9.55186E-5
1-147126437-G-A p.Arg218Trp missense ACP6 919 83096 0.0110595 41548 4 0.020141
1-147126444-G-GGTTCTCTGCCTCAGGCTCCAGCAGCTTTGGT c.648-4_648-3insACCAAAGCTGCTGGAGCCTGAGGCAGAGAAC splice_region ACP6 2 83038 2.40854E-5 41519 1 NA
1-147126444-G-GGTTCTCTGCCTCAGGCTCCAGCAGCTTTGGTAGTTGGGAT c.648-4_648-3insATCCCAACTACCAAAGCTGCTGGAGCCTGAGGCAGAGAAC splice_region ACP6 2 83038 2.40854E-5 41519 1 NA
1-147127271-G-C c.647+5C>G splice_region ACP6 1 81514 1.22678E-5 40757 0 NA
1-147127287-C-T p.Arg212Arg synonymous ACP6 1 81744 1.22333E-5 40872 0 3.18552E-5
1-147127288-C-T p.Arg212Lys missense ACP6 1 81736 1.22345E-5 40868 0 NA
1-147127293-G-C p.Ser210Arg missense ACP6 15 81746 1.83495E-4 40873 0 5.73431E-4
1-147127303-C-T p.Ser207Asn missense ACP6 1 81854 1.22169E-5 40927 0 NA
1-147127313-T-C p.Asn204Asp missense ACP6 1 81886 1.22121E-5 40943 0 NA
1-147127316-G-A p.Pro203Ser missense ACP6 2 81892 2.44224E-5 40946 0 NA
1-147127318-T-C p.Tyr202Cys missense ACP6 1 81900 1.221E-5 40950 0 NA
1-147127320-C-G p.Leu201Phe missense ACP6 20 81904 2.44188E-4 40952 1 4.14118E-4
1-147127338-T-G p.Glu195Asp missense ACP6 5 81794 6.11292E-5 40897 0 5.93014E-5
1-147127347-G-A p.His192His synonymous ACP6 2 81698 2.44804E-5 40849 0 8.41907E-6
1-147127358-T-C p.Ile189Val missense ACP6 1 81540 1.22639E-5 40770 0 2.09562E-4
1-147127360-G-C p.Pro188Arg missense ACP6 1 81486 1.2272E-5 40743 0 NA
1-147127363-C-T p.Gly187Glu missense+splice_region ACP6 1 81442 1.22787E-5 40721 0 1.66025E-5
1-147131069-A-G c.559+6T>C splice_region ACP6 2 83206 2.40367E-5 41603 0 1.65887E-5
1-147131070-C-T c.559+5G>A splice_region ACP6 2 83208 2.40361E-5 41604 0 8.29394E-6
1-147131071-G-A c.559+4C>T splice_region ACP6 2 83216 2.40338E-5 41608 0 3.18756E-5
1-147131074-C-A c.559+1G>T splice_donor ACP6 1 83254 1.20114E-5 41627 0 NA
1-147131089-T-C p.Gln182Arg missense ACP6 1 83300 1.20048E-5 41650 0 NA
1-147131102-C-A p.Ala178Ser missense ACP6 2 83318 2.40044E-5 41659 0 NA
1-147131103-C-T p.Leu177Leu synonymous ACP6 3236 83204 0.0388924 41602 80 0.040282
1-147131110-C-A p.Cys175Phe missense ACP6 2 83324 2.40027E-5 41662 0 3.98498E-6
1-147131113-C-A p.Arg174Leu missense ACP6 1 83316 1.20025E-5 41658 0 8.24579E-6
1-147131113-C-T p.Arg174His missense ACP6 3 83316 3.60075E-5 41658 0 6.37308E-5
1-147131131-C-T p.Arg168Gln missense ACP6 6 83284 7.20426E-5 41642 0 4.95025E-5
1-147131132-G-A p.Arg168Trp missense ACP6 1 83294 1.20057E-5 41647 0 4.02778E-6
1-147131146-G-A p.Ser163Phe missense ACP6 1 83260 1.20106E-5 41630 0 8.27308E-6
1-147131149-C-T p.Arg162His missense ACP6 2 83228 2.40304E-5 41614 0 5.25516E-5
1-147131150-G-A p.Arg162Cys missense ACP6 2 83236 2.40281E-5 41618 0 1.62213E-5
1-147131157-G-GA c.480-4_480-3insT splice_region ACP6 1 83194 1.20201E-5 41597 0 2.06163E-5
1-147131161-A-G c.480-7T>C splice_region ACP6 3 83196 3.60594E-5 41598 0 3.18471E-5
1-147131516-C-T p.Glu158Glu synonymous ACP6 2 83008 2.40941E-5 41504 0 NA
1-147131530-A-T p.Phe154Ile missense ACP6 12 83040 1.44509E-4 41520 0 1.27356E-4
1-147131532-G-T p.Thr153Asn missense ACP6 19 83040 2.28805E-4 41520 0 0.00203796
1-147131535-G-A p.Pro152Leu missense ACP6 3 83046 3.61246E-5 41523 0 1.03428E-4
1-147131547-G-T p.Pro148His missense ACP6 1 83088 1.20354E-5 41544 0 NA
1-147131552-G-A p.Asp146Asp synonymous ACP6 23 83118 2.76715E-4 41559 0 9.55231E-5
1-147131553-T-C p.Asp146Gly missense ACP6 515 83102 0.0061972 41551 0 0.025625
1-147131570-C-T p.Arg140Arg synonymous ACP6 1 83160 1.2025E-5 41580 0 3.97716E-6
1-147131570-C-G p.Arg140Ser missense ACP6 1 83160 1.2025E-5 41580 0 6.59174E-5
1-147131572-T-A p.Arg140Trp missense ACP6 1 83142 1.20276E-5 41571 0 3.97722E-6
1-147131574-A-G p.Leu139Pro missense ACP6 1 83146 1.2027E-5 41573 0 NA
1-147131578-T-C p.Arg138Gly missense ACP6 2 83150 2.40529E-5 41575 0 8.2394E-6
1-147131581-C-T p.Glu137Lys missense ACP6 1 83160 1.2025E-5 41580 0 1.64799E-5
1-147131590-C-G p.Ala134Pro missense ACP6 1 83186 1.20213E-5 41593 0 3.97769E-6
1-147131590-C-T p.Ala134Thr missense ACP6 1 83184 1.20215E-5 41592 0 NA
1-147131602-G-A p.Gln130* stop_gained ACP6 1 83192 1.20204E-5 41596 0 NA
1-147131602-GC-AA p.MetGln129* stop_gained ACP6 2 83192 2.40408E-5 41596 0 NA
1-147131603-C-A p.Met129Ile missense ACP6 1 83188 1.2021E-5 41594 0 NA
1-147131611-C-T p.Val127Met missense ACP6 36 83182 4.32786E-4 41591 0 4.28513E-4
1-147131629-C-G p.Ala121Pro missense ACP6 1 83176 1.20227E-5 41588 0 1.64872E-5
1-147131635-T-C p.Met119Val missense ACP6 1 83178 1.20224E-5 41589 0 3.19061E-5
1-147131636-G-GC p.Met119fs frameshift ACP6 1 83176 1.20227E-5 41588 0 NA
1-147131637-C-A p.Gly118Val missense ACP6 1 83180 1.20221E-5 41590 0 3.1904E-5
1-147131640-CCCTAAAGTAGGGAAGAAAGAGAAAGAAGAATGAAAACACCTGACAGCCTGCTGAACTCAGCCCAGAGAAAACAACCCAACCTTTGCAGTGGGGCTCCCCAGAGCAAGGAAGCATTGCTCA-C p.Gly118fs frameshift ACP6 4 83174 4.8092E-5 41587 2 NA
1-147131642-C-A c.349-1G>T splice_acceptor ACP6 1 83172 1.20233E-5 41586 0 NA
1-147131757-C-T c.348+5G>A splice_region ACP6 22 83284 2.64156E-4 41642 0 3.87661E-4
1-147131768-G-C p.Thr114Thr synonymous ACP6 1 83324 1.20013E-5 41662 0 8.24552E-6
1-147131783-T-C p.Gln109Gln synonymous ACP6 1 83330 1.20005E-5 41665 0 3.18451E-5
1-147131784-T-C p.Gln109Arg missense ACP6 11 83324 1.32015E-4 41662 0 1.91095E-4
1-147131791-C-T p.Asp107Asn missense ACP6 1 83308 1.20036E-5 41654 0 7.95437E-6
1-147131792-G-A p.Tyr106Tyr synonymous ACP6 2 83310 2.40067E-5 41655 0 5.56815E-5
1-147131794-AAGG-A p.Pro105del conservative_inframe_deletion ACP6 2 83320 2.40038E-5 41660 0 NA
1-147131804-T-C p.Pro102Pro synonymous ACP6 59 83318 7.0813E-4 41659 1 5.03525E-4
1-147131809-T-G p.Lys101Gln missense ACP6 4 83312 4.80123E-5 41656 0 3.18512E-5
1-147131810-C-T p.Pro100Pro synonymous ACP6 7 83314 8.40195E-5 41657 0 5.77148E-4
1-147131811-G-A p.Pro100Leu missense ACP6 41 83318 4.92091E-4 41659 0 0.00136943
1-147131817-C-CCAGCTAG p.Gly98fs frameshift ACP6 10 83316 1.20025E-4 41658 1 8.24552E-5
1-147131817-C-T p.Gly98Asp missense ACP6 2 83316 2.4005E-5 41658 0 NA
1-147131823-A-C p.Leu96Arg missense ACP6 1 83314 1.20028E-5 41657 0 NA
1-147131828-G-T p.Thr94Thr synonymous ACP6 2 83320 2.40038E-5 41660 0 8.24987E-6
1-147131838-T-C p.Tyr91Cys missense ACP6 1 83312 1.20031E-5 41656 0 3.97753E-6
1-147131864-C-G p.Glu82Asp missense ACP6 2 83246 2.40252E-5 41623 0 NA
1-147131870-T-C p.Leu80Leu synonymous ACP6 1 83206 1.20184E-5 41603 0 NA
1-147131879-G-A p.Asn77Asn synonymous ACP6 2 83180 2.40442E-5 41590 0 3.18839E-5
1-147131891-C-T c.220-1G>A splice_acceptor ACP6 3 83078 3.61106E-5 41539 0 NA
1-147131893-G-GCTCCTCCAGCGGGAGCGGC c.220-4_220-3insGCCGCTCCCGCTGGAGGAG splice_region ACP6 4 83040 4.81696E-5 41520 2 NA
1-147131898-T-G c.220-8A>C splice_region ACP6 2 82902 2.41249E-5 41451 0 3.37086E-5
1-147141955-C-T p.Glu72Glu synonymous ACP6 2 54074 3.69864E-5 27037 0 NA
1-147141959-T-C p.Glu71Gly missense ACP6 1 54430 1.83722E-5 27215 0 NA
1-147141966-G-A p.Pro69Ser missense ACP6 1 54994 1.81838E-5 27497 0 NA
1-147141983-C-T p.Ser63Asn missense ACP6 1 54936 1.8203E-5 27468 0 3.18593E-5
1-147141989-G-C p.Ala61Gly missense ACP6 2 55350 3.61337E-5 27675 0 3.18613E-5
1-147141993-C-G p.Gly60Arg missense ACP6 1 55902 1.78884E-5 27951 0 NA
1-147142001-A-G p.Phe57Ser missense ACP6 1 56406 1.77286E-5 28203 0 NA
1-147142004-A-C p.Val56Gly missense ACP6 1 56312 1.77582E-5 28156 0 4.38204E-6
1-147142024-C-T p.Lys49Lys synonymous ACP6 3 55978 5.35925E-5 27989 0 1.18391E-4
1-147142026-T-A p.Lys49* stop_gained ACP6 1 55652 1.79688E-5 27826 0 NA
1-147142046-G-A p.Pro42Leu missense ACP6 1 53060 1.88466E-5 26530 0 2.54453E-5
1-147142052-T-C p.Gln40Arg missense ACP6 2 52516 3.80836E-5 26258 0 5.10725E-4
1-147142054-G-A p.Gly39Gly synonymous ACP6 11 52352 2.10116E-4 26176 0 0.00204499
1-147142059-C-T p.Asp38Asn missense ACP6 4 51818 7.71933E-5 25909 0 2.23143E-4
1-147142060-G-A p.Ala37Ala synonymous ACP6 2 51686 3.86952E-5 25843 0 6.41034E-6
1-147142061-G-C p.Ala37Gly missense ACP6 4 51502 7.76669E-5 25751 0 5.89553E-5
1-147142063-C-G p.Glu36Asp missense ACP6 1 51514 1.94122E-5 25757 0 NA
1-147142096-G-T p.His25Gln missense ACP6 2 50184 3.98533E-5 25092 0 6.67022E-5
1-147142104-AGTAC-A p.Tyr22fs frameshift ACP6 1 49614 2.01556E-5 24807 0 5.66687E-4
1-147142106-T-C p.Tyr22Cys missense ACP6 1 49466 2.02159E-5 24733 0 NA
1-147142138-C-T p.Trp11* stop_gained ACP6 3 46104 6.50703E-5 23052 0 2.89519E-4
1-147142139-CACA-C p.Leu10del disruptive_inframe_deletion ACP6 3 46056 6.51381E-5 23028 0 2.9036E-4
1-147142146-G-T p.Arg9Ser missense ACP6 1 45478 2.19887E-5 22739 0 NA
1-147142149-T-C p.Met8Val missense ACP6 1 45348 2.20517E-5 22674 0 1.38968E-5
1-147142151-C-G p.Ser7Thr missense ACP6 1 45206 2.2121E-5 22603 0 1.39614E-5
1-147142160-C-T p.Gly4Asp missense ACP6 1 44736 2.23534E-5 22368 0 7.1146E-6
1-147142222-A-T c.-52T>A 5_prime_UTR_premature_start_codon_gain ACP6 1 40996 2.43926E-5 20498 0 NA
1-147142307-G-A c.-137C>T 5_prime_UTR_premature_start_codon_gain ACP6 1 31152 3.21007E-5 15576 0 NA
1-147142353-G-A c.-183C>T 5_prime_UTR_premature_start_codon_gain ACP6 7 24258 2.88565E-4 12129 0 NA
1-147142597-A-C c.-427T>G 5_prime_UTR_premature_start_codon_gain ACP6 1 3104 3.22165E-4 1552 0 NA