Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-11685830-G-A p.Pro325Ser missense ACP5 2 83000 2.40964E-5 41500 0 3.18593E-5
19-11685832-C-T p.Arg324Lys missense ACP5 7 83024 8.4313E-5 41512 0 9.55779E-5
19-11685832-C-A p.Arg324Met missense ACP5 1 83024 1.20447E-5 41512 0 8.29765E-6
19-11685839-G-A p.Arg322* stop_gained ACP5 2 82858 2.41377E-5 41429 0 2.79069E-5
19-11685844-G-A p.Pro320Leu missense ACP5 1 82834 1.20723E-5 41417 0 2.48649E-5
19-11685848-G-A p.Leu319Leu synonymous ACP5 60 82962 7.23223E-4 41481 0 0.00140163
19-11685865-G-A p.Ser313Phe missense ACP5 1 83194 1.20201E-5 41597 0 8.26829E-6
19-11685873-C-T p.Ser310Ser synonymous ACP5 3 83232 3.60438E-5 41616 0 2.47926E-5
19-11685885-G-A p.Tyr306Tyr synonymous ACP5 2 83300 2.40096E-5 41650 0 8.25314E-6
19-11685891-G-A p.Val304Val synonymous ACP5 3 83300 3.60144E-5 41650 0 NA
19-11685896-T-C p.Ter60Trpext*? stop_lost ACP5 1 83296 1.20054E-5 41648 0 NA
19-11685901-T-C p.Glu301Gly missense ACP5 2 83310 2.40067E-5 41655 0 3.18451E-5
19-11685911-T-C p.Ser298Gly missense ACP5 1 83302 1.20045E-5 41651 0 NA
19-11685930-GCC-G p.Gly291fs frameshift ACP5 1 83292 1.2006E-5 41646 0 NA
19-11685932-C-T p.Gly291Ser missense ACP5 1 83286 1.20068E-5 41643 0 NA
19-11685933-A-G p.Val48Ala missense ACP5 1 83272 1.20088E-5 41636 0 3.97674E-6
19-11685942-G-A p.Thr45Ile missense ACP5 129 83278 0.00154903 41639 0 0.00453172
19-11685943-T-G p.Asp287Ala missense ACP5 93 83280 0.00111671 41640 1 0.00162503
19-11685944-C-T p.Asp287Asn missense ACP5 2 83280 2.40154E-5 41640 0 NA
19-11685948-A-G p.Leu43Pro missense ACP5 1210 83230 0.014538 41615 57 0.0330297
19-11685949-G-A p.Thr285Ile missense ACP5 1 83260 1.20106E-5 41630 0 3.97703E-6
19-11685955-T-C p.Tyr283Cys missense ACP5 1 83244 1.20129E-5 41622 0 3.97728E-6
19-11685957-G-C p.His282Gln missense ACP5 1 83238 1.20137E-5 41619 0 8.25887E-6
19-11685958-T-C p.His282Arg missense ACP5 1 83224 1.20158E-5 41612 0 3.97753E-6
19-11685964-C-T p.Arg280His missense ACP5 2 83172 2.40466E-5 41586 0 3.1839E-5
19-11685965-G-A p.Arg280Cys missense ACP5 1 83174 1.2023E-5 41587 0 6.36862E-5
19-11685974-C-T p.Gly277Ser missense ACP5 2 83120 2.40616E-5 41560 0 3.58086E-5
19-11685975-G-A p.Thr34Met missense ACP5 3 83096 3.61028E-5 41548 0 2.38741E-5
19-11685978-G-T p.Pro33Gln missense ACP5 2 83070 2.40761E-5 41535 0 3.97934E-6
19-11685981-G-T p.Ser32Tyr missense ACP5 1 83032 1.20435E-5 41516 0 NA
19-11685988-C-T p.Arg272His missense ACP5 21 82904 2.53305E-4 41452 0 2.07331E-4
19-11685989-G-A p.Arg272Cys missense ACP5 335 82874 0.00404228 41437 2 0.00352467
19-11685998-G-A p.Arg269Trp missense ACP5 18 82668 2.17738E-4 41334 0 2.65873E-4
19-11686001-T-C p.Lys268Glu missense ACP5 3 82636 3.63038E-5 41318 0 7.9734E-6
19-11686003-GA-G p.Ser267fs frameshift ACP5 1 82530 1.21168E-5 41265 0 3.98839E-6
19-11686007-G-T p.Pro266Thr missense ACP5 1 82442 1.21297E-5 41221 0 NA
19-11686020-C-T p.Gly19Glu missense+splice_region ACP5 3 81966 3.66005E-5 40983 0 3.18674E-5
19-11686037-C-T p.Val256Met missense ACP5 10 80868 1.23658E-4 40434 0 6.26959E-4
19-11686037-C-G p.Val256Leu missense ACP5 70 80868 8.65608E-4 40434 0 0.00312695
19-11686038-G-A p.Tyr255Tyr synonymous ACP5 2 80644 2.48004E-5 40322 0 1.6075E-5
19-11686046-C-T p.Val253Met missense ACP5 2 79428 2.518E-5 39714 0 6.37227E-5
19-11686047-G-A p.Gly252Gly synonymous ACP5 1 79044 1.26512E-5 39522 0 6.37308E-5
19-11686053-C-G p.Glu250Asp missense ACP5 1 78320 1.27681E-5 39160 0 NA
19-11686064-G-A p.Leu247Leu synonymous ACP5 1 76434 1.30832E-5 38217 0 NA
19-11686065-G-A p.Tyr246Tyr splice_region+synonymous ACP5 1 76112 1.31385E-5 38056 0 NA
19-11686070-G-GCAGATTGTGATCGTGGCCGCAC c.736-4_736-3insGTGCGGCCACGATCACAATCTG splice_region ACP5 1 75100 1.33156E-5 37550 0 NA
19-11687050-G-T c.735+8C>A splice_region ACP5 2 81682 2.44852E-5 40841 0 9.58571E-6
19-11687058-C-A p.Gln245His missense+splice_region ACP5 1 82136 1.21749E-5 41068 0 NA
19-11687063-G-A p.Leu244Leu synonymous ACP5 1 82250 1.21581E-5 41125 0 9.01632E-6
19-11687073-G-A p.His240His synonymous ACP5 3 82458 3.63822E-5 41229 0 1.14634E-4
19-11687078-C-T p.Gly239Ser missense ACP5 10 82562 1.21121E-4 41281 1 4.36735E-5
19-11687079-G-A p.Cys238Cys synonymous ACP5 7 82560 8.47868E-5 41280 0 0.00100806
19-11687097-C-T p.Gly232Gly synonymous ACP5 1 82710 1.20904E-5 41355 0 NA
19-11687099-C-T p.Gly232Arg missense ACP5 3 82722 3.6266E-5 41361 0 4.27899E-5
19-11687100-G-A p.Tyr231Tyr synonymous ACP5 29 82730 3.50538E-4 41365 0 0.00185495
19-11687114-G-T p.Leu227Met missense ACP5 1 82766 1.20823E-5 41383 0 4.03184E-6
19-11687119-C-T p.Arg225Gln missense ACP5 2 82784 2.41593E-5 41392 0 1.20885E-5
19-11687120-G-A p.Arg225Trp missense ACP5 4 82794 4.83127E-5 41397 0 9.55779E-5
19-11687132-C-T p.Val221Ile missense ACP5 1316 82770 0.0158995 41385 52 0.0355754
19-11687135-G-A p.Leu220Leu synonymous ACP5 1 82816 1.2075E-5 41408 0 3.18552E-5
19-11687141-G-A p.His218Tyr missense ACP5 2 82790 2.41575E-5 41395 0 1.69469E-5
19-11687145-A-T p.Pro216Pro synonymous ACP5 1 82784 1.20796E-5 41392 0 NA
19-11687150-C-G p.Gly215Arg missense ACP5 2 82756 2.41674E-5 41378 0 NA
19-11687151-G-A p.His214His synonymous ACP5 3 82746 3.62555E-5 41373 0 3.22406E-5
19-11687156-C-G p.Glu213Gln missense ACP5 18 82734 2.17565E-4 41367 0 2.05574E-4
19-11687157-G-A p.Ala212Ala synonymous ACP5 3 82736 3.62599E-5 41368 0 9.56206E-5
19-11687171-C-T p.Val208Met missense ACP5 4 82730 4.83501E-5 41365 1 5.07726E-5
19-11687172-G-A p.Pro207Pro synonymous ACP5 3 82748 3.62547E-5 41374 0 1.44817E-4
19-11687177-A-G p.Tyr206His missense ACP5 1 82664 1.20972E-5 41332 0 NA
19-11687184-A-G p.Ala203Ala synonymous ACP5 1 82596 1.21071E-5 41298 0 NA
19-11687192-G-A p.Leu201Leu synonymous ACP5 25 82490 3.03067E-4 41245 1 0.005
19-11687195-C-T p.Val200Met missense ACP5 8198 82302 0.0996088 41151 462 0.1425
19-11687196-G-A n.436C>T splice_region ACP5 2 82464 2.4253E-5 41232 0 5.04541E-4
19-11687204-C-A p.Glu197* stop_gained ACP5 1 82516 1.21189E-5 41258 0 NA
19-11687211-C-T p.Ala194Ala synonymous ACP5 4 82484 4.84943E-5 41242 0 6.00226E-5
19-11687213-C-A p.Ala194Ser missense ACP5 1 82534 1.21162E-5 41267 0 8.379E-6
19-11687215-G-A p.Ala193Val missense ACP5 1 82512 1.21194E-5 41256 0 1.67386E-5
19-11687226-C-A p.Lys189Asn missense ACP5 1 82620 1.21036E-5 41310 0 3.18593E-5
19-11687248-C-T p.Arg182His missense ACP5 2 82622 2.42066E-5 41311 0 3.18756E-5
19-11687249-G-A p.Arg182Cys missense ACP5 27 82648 3.26687E-4 41324 0 2.31965E-4
19-11687250-G-T p.Ala181Ala synonymous ACP5 28 82626 3.38876E-4 41313 0 1.95621E-4
19-11687251-G-T p.Ala181Asp missense ACP5 1 82616 1.21042E-5 41308 0 7.98748E-6
19-11687261-C-T p.Val178Met missense ACP5 6 82806 7.24585E-5 41403 0 3.59396E-5
19-11687262-G-A p.Asp177Asp synonymous ACP5 5 82810 6.03792E-5 41405 0 9.56023E-5
19-11687264-C-T p.Asp177Asn missense ACP5 2 82818 2.41493E-5 41409 0 2.7962E-5
19-11687270-G-A p.Pro175Ser missense ACP5 1 82874 1.20665E-5 41437 0 NA
19-11687271-C-T p.Arg174Arg synonymous ACP5 1 82868 1.20674E-5 41434 0 6.39294E-5
19-11687298-A-G p.Asp165Asp synonymous ACP5 3 83120 3.60924E-5 41560 0 5.03525E-4
19-11687300-C-T p.Asp165Asn missense ACP5 1 83134 1.20288E-5 41567 0 3.99853E-6
19-11687312-A-G p.Cys161Arg missense ACP5 1 83196 1.20198E-5 41598 0 8.24008E-6
19-11687313-T-C p.Leu160Leu synonymous ACP5 1 83198 1.20195E-5 41599 0 9.56206E-5
19-11687316-T-G p.Thr159Thr synonymous ACP5 1 83202 1.20189E-5 41601 0 9.56511E-5
19-11687324-T-C p.Thr157Ala missense ACP5 1 83214 1.20172E-5 41607 0 7.99706E-6
19-11687351-C-T p.Val148Met missense ACP5 9171 82928 0.11059 41464 579 0.155625
19-11687372-A-C p.Phe141Val missense ACP5 7 83176 8.41589E-5 41588 0 0.00125
19-11687380-C-T p.Arg138His missense ACP5 7 83122 8.42136E-5 41561 0 1.91485E-4
19-11687393-T-C p.Ser134Gly missense ACP5 4 83112 4.81278E-5 41556 0 3.98654E-6
19-11687395-G-C p.Pro133Arg missense ACP5 2 83098 2.4068E-5 41549 0 NA
19-11687396-G-A p.Pro133Ser missense ACP5 1 83094 1.20346E-5 41547 0 NA
19-11687415-ATAGAGGT-A n.1004_1010delACCTCTA splice_region ACP5 3 83020 3.61359E-5 41510 0 NA
19-11687544-T-TTA p.Ile126fs frameshift ACP5 2 83298 2.40102E-5 41649 0 NA
19-11687547-T-TA p.Lys125fs frameshift ACP5 3 83296 3.60161E-5 41648 0 8.23642E-6
19-11687551-G-T p.Tyr123* stop_gained ACP5 2 83306 2.40079E-5 41653 0 NA
19-11687561-T-C p.Gln120Arg missense ACP5 1 83302 1.20045E-5 41651 0 NA
19-11687584-G-A p.Asp112Asp synonymous ACP5 1 83344 1.19985E-5 41672 0 NA
19-11687595-C-T p.Gly109Arg missense ACP5 2 83342 2.39975E-5 41671 0 3.29462E-5
19-11687596-G-A p.Ala108Ala synonymous ACP5 1 83334 1.19999E-5 41667 0 8.23655E-6
19-11687604-C-T p.Val106Met missense ACP5 19 83340 2.27982E-4 41670 0 2.0279E-4
19-11687605-G-A p.Tyr105Tyr synonymous ACP5 4 83334 4.79996E-5 41667 0 1.59052E-5
19-11687621-C-T p.Arg100His missense ACP5 171 83336 0.00205193 41668 0 0.010625
19-11687621-C-A p.Arg100Leu missense ACP5 1 83336 1.19996E-5 41668 0 3.29468E-5
19-11687627-G-T p.Ser98Tyr missense ACP5 4 83342 4.7995E-5 41671 0 1.64739E-5
19-11687630-C-T p.Arg97His missense ACP5 6 83342 7.19925E-5 41671 0 7.15734E-5
19-11687631-G-A p.Arg97Cys missense ACP5 2 83338 2.39987E-5 41669 0 3.18898E-5
19-11687638-G-A p.Phe94Phe synonymous ACP5 1 83330 1.20005E-5 41665 0 NA
19-11687643-C-T p.Val93Ile missense ACP5 3 83324 3.6004E-5 41662 0 6.38081E-5
19-11687644-G-A p.Asp92Asp synonymous ACP5 209 83316 0.00250852 41658 3 0.00536056
19-11687647-CTCAAAGG-C p.Thr89fs frameshift ACP5 2 83322 2.40033E-5 41661 0 NA
19-11687649-C-T p.Glu91Lys missense ACP5 1 83322 1.20016E-5 41661 0 NA
19-11687866-A-G c.261+6T>C splice_region ACP5 9 82862 1.08614E-4 41431 0 1.65478E-5
19-11687872-C-G p.Gln87His missense+splice_region ACP5 1 82988 1.20499E-5 41494 0 NA
19-11687884-G-C p.Asp83Glu missense ACP5 4 83144 4.81093E-5 41572 0 2.38688E-5
19-11687895-C-T p.Asp80Asn missense ACP5 6 83230 7.20894E-5 41615 0 1.98848E-5
19-11687908-G-A p.Phe75Phe synonymous ACP5 9054 83020 0.109058 41510 574 0.154375
19-11687911-G-T p.Tyr74* stop_gained ACP5 1 83268 1.20094E-5 41634 0 NA
19-11687959-C-T p.Val58Val synonymous ACP5 1 83286 1.20068E-5 41643 0 NA
19-11687967-G-A p.Arg56Trp missense ACP5 7 83270 8.40639E-5 41635 0 6.37146E-5
19-11687970-C-T p.Ala55Thr missense ACP5 1 83276 1.20083E-5 41638 0 3.18471E-5
19-11687984-T-C p.Asn50Ser missense ACP5 10 83246 1.20126E-4 41623 0 3.97728E-5
19-11687996-C-T p.Arg46Gln missense ACP5 7 83212 8.41225E-5 41606 0 6.25E-4
19-11688001-C-T p.Thr44Thr synonymous ACP5 15 83196 1.80297E-4 41598 0 1.91131E-4
19-11688002-G-A p.Thr44Met missense ACP5 1 83190 1.20207E-5 41595 0 6.37105E-5
19-11688006-G-A p.His43Tyr missense ACP5 1 83192 1.20204E-5 41596 0 NA
19-11688019-G-A p.Pro38Pro synonymous ACP5 2 83148 2.40535E-5 41574 0 NA
19-11688022-G-T p.Val37Val synonymous ACP5 1 83140 1.20279E-5 41570 0 NA
19-11688025-C-T p.Gly36Gly synonymous ACP5 1 83104 1.20331E-5 41552 0 NA
19-11688036-C-T p.Asp33Asn missense ACP5 2 83100 2.40674E-5 41550 0 NA
19-11688042-C-T p.Val31Met missense ACP5 1 83090 1.20351E-5 41545 0 1.99016E-5
19-11688043-G-A p.Ala30Ala synonymous ACP5 1 83084 1.2036E-5 41542 0 9.5584E-5
19-11688047-A-G p.Val29Ala missense ACP5 1 83088 1.20354E-5 41544 0 3.98E-6
19-11688053-C-T p.Arg27His missense ACP5 4 83014 4.81846E-5 41507 0 3.98108E-5
19-11688054-G-A p.Arg27Cys missense ACP5 6 82994 7.22944E-5 41497 0 4.97901E-5
19-11688065-G-A p.Thr23Ile missense ACP5 4 82996 4.81951E-5 41498 0 NA
19-11688072-C-G p.Gly21Arg missense ACP5 1 82974 1.2052E-5 41487 0 4.1625E-5
19-11688086-G-T p.Pro16His missense ACP5 1 82914 1.20607E-5 41457 0 6.68449E-5
19-11688087-G-T p.Pro16Thr missense ACP5 3 82906 3.61856E-5 41453 0 NA
19-11688091-C-T p.Leu14Leu synonymous ACP5 2 82878 2.41319E-5 41439 0 5.03525E-4
19-11688094-C-G p.Leu13Phe missense ACP5 2 82886 2.41295E-5 41443 0 1.19603E-5
19-11688098-GC-G p.Ala12fs frameshift ACP5 1 82858 1.20688E-5 41429 0 NA
19-11688103-C-A p.Leu10Leu synonymous ACP5 20 82822 2.41482E-4 41411 0 2.43505E-4
19-11688116-G-A p.Ala6Val missense ACP5 9 82612 1.08943E-4 41306 0 1.15992E-4
19-11688118-C-G p.Thr5Thr splice_region+synonymous ACP5 3 82610 3.63152E-5 41305 0 NA
19-11688119-G-A p.Thr5Met missense ACP5 4 82598 4.84273E-5 41299 1 0.00251762
19-11688120-T-C p.Thr5Ala missense ACP5 1 82552 1.21136E-5 41276 0 NA
19-11688125-A-G p.Met3Thr missense ACP5 1 82512 1.21194E-5 41256 0 1.77201E-5
19-11688126-T-G p.Met3Leu missense ACP5 1 82502 1.21209E-5 41251 0 NA
19-11688127-G-A p.Asp2Asp synonymous ACP5 1 82452 1.21283E-5 41226 0 8.95175E-6
19-11688136-G-T c.1-4C>A splice_region ACP5 2 82232 2.43214E-5 41116 0 2.77203E-5
19-11688215-G-C c.-83C>G 5_prime_UTR_premature_start_codon_gain ACP5 4 78052 5.12479E-5 39026 0 NA
19-11688247-G-A c.-115C>T 5_prime_UTR_premature_start_codon_gain ACP5 39 72026 5.41471E-4 36013 0 0.00200803
19-11688279-C-T c.-147G>A 5_prime_UTR_premature_start_codon_gain ACP5 1 60190 1.66141E-5 30095 0 NA
19-11688300-C-G c.-168G>C 5_prime_UTR_premature_start_codon_gain ACP5 1 50788 1.96897E-5 25394 0 NA
19-11688326-G-A c.-194C>T 5_prime_UTR_premature_start_codon_gain ACP5 3 33710 8.89944E-5 16855 0 3.18654E-5
19-11688407-C-T c.-1+1G>A splice_donor ACP5 2 18226 1.09733E-4 9113 0 NA
19-11688428-G-A c.-21C>T 5_prime_UTR_premature_start_codon_gain ACP5 1 15888 6.29406E-5 7944 0 NA
19-11688434-G-A c.-27C>T 5_prime_UTR_premature_start_codon_gain ACP5 1 15030 6.65336E-5 7515 0 3.18715E-5
19-11688460-T-C c.-53A>G 5_prime_UTR_premature_start_codon_gain ACP5 3299 10820 0.304898 5410 173 0.424235
19-11688493-C-G c.-86G>C splice_region ACP5 1 10558 9.47149E-5 5279 0 NA
19-11688497-G-GCCGTCGCGGGGCGGGCGTTGCGGCCGGTGCCCAGCTGCAGATCCGC c.-87-4_-87-3insGCGGATCTGCAGCTGGGCACCGGCCGCAACGCCCGCCCCGCGACGG splice_region ACP5 1 10222 9.78282E-5 5111 0 NA
19-11688551-G-A c.-144C>T 5_prime_UTR_premature_start_codon_gain ACP5 1 7518 1.33014E-4 3759 0 NA
19-11688889-A-T c.-88+2T>A splice_donor ACP5 2 26 0.0769231 13 0 0.0924319
19-11689578-CCCTGCAGCAGCAACAAACGGGAAGGAAGTGGGTGACGAGGACAGGCAGAGACCCCTCCCACGGGGCCGCCCGCATCTCA-C c.-268+2_-267delTGAGATGCGGGCGGCCCCGTGGGAGGGGTCTCTGCCTGTCCTCGTCACCCACTTCCTTCCCGTTTGTTGCTGCTGCAGG splice_acceptor ACP5 1 2800 3.57143E-4 1400 0 NA