Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
11-47261603-C-G c.*64G>C splice_region ACP2 2 79394 2.51908E-5 39697 0 NA
11-47261673-G-A p.His422His synonymous ACP2 62 82500 7.51515E-4 41250 1 8.28448E-4
11-47261682-C-A p.Gly419Gly synonymous ACP2 1 82618 1.21039E-5 41309 0 NA
11-47261684-C-G p.Gly419Arg missense ACP2 1 82626 1.21027E-5 41313 0 6.37227E-5
11-47261690-C-T p.Ala417Thr missense ACP2 1 82652 1.20989E-5 41326 0 8.3131E-6
11-47261691-G-A p.Val416Val synonymous ACP2 286 82668 0.00345962 41334 6 0.00723437
11-47261694-G-A p.His415His synonymous ACP2 2 82702 2.41832E-5 41351 0 1.19628E-5
11-47261698-C-T p.Arg414His missense ACP2 1 82688 1.20937E-5 41344 0 8.29807E-6
11-47261699-G-A p.Arg414Cys missense ACP2 2 82722 2.41774E-5 41361 0 3.18552E-5
11-47261713-T-TGGGCCTGCATCCGGAAGAGGAC p.Gln409fs frameshift ACP2 1 82756 1.20837E-5 41378 0 NA
11-47261717-C-T p.Ala408Thr missense ACP2 1 82764 1.20825E-5 41382 0 NA
11-47261722-A-G p.Met406Thr missense ACP2 2 82786 2.41587E-5 41393 0 NA
11-47261735-C-T p.Val402Ile missense ACP2 1 82766 1.20823E-5 41383 0 3.58432E-5
11-47261736-G-A p.Thr401Thr synonymous ACP2 1 82812 1.20755E-5 41406 0 6.37024E-5
11-47261739-G-T p.Leu400Leu synonymous ACP2 13 82824 1.56959E-4 41412 0 2.5641E-4
11-47261744-G-A p.Leu399Phe missense ACP2 2 82772 2.41628E-5 41386 0 3.98229E-5
11-47261755-A-G p.Leu395Pro missense ACP2 1 82764 1.20825E-5 41382 0 NA
11-47261757-G-A p.Leu394Leu synonymous ACP2 1 82774 1.20811E-5 41387 0 8.2728E-6
11-47261760-G-A p.Phe393Phe synonymous ACP2 1 82748 1.20849E-5 41374 0 3.98368E-6
11-47261762-A-G p.Phe393Leu missense ACP2 650 82708 0.00785897 41354 3 0.0100908
11-47261763-G-T p.Leu392Leu synonymous ACP2 1 82732 1.20872E-5 41366 0 NA
11-47261768-T-A p.Ile391Phe missense ACP2 1 82684 1.20942E-5 41342 0 NA
11-47261784-C-T p.Leu385Leu synonymous ACP2 3 82508 3.63601E-5 41254 0 NA
11-47261794-A-G p.Ile382Thr missense ACP2 1 82206 1.21646E-5 41103 0 6.37105E-5
11-47261797-A-G p.Val381Ala missense ACP2 4 82106 4.87175E-5 41053 0 9.56572E-5
11-47261798-C-A p.Val381Leu missense+splice_region ACP2 7 82126 8.52349E-5 41063 0 9.55292E-5
11-47261800-T-C p.Glu380Gly missense+splice_region ACP2 1 82014 1.2193E-5 41007 0 3.18573E-5
11-47264270-T-C c.1138+4A>G splice_region ACP2 97 82342 0.00117801 41171 1 0.00261346
11-47264276-G-A p.Thr379Ile missense+splice_region ACP2 7 82496 8.48526E-5 41248 0 6.37105E-5
11-47264289-C-T p.Gly375Ser missense ACP2 4 82682 4.83781E-5 41341 0 9.55718E-5
11-47264290-G-A p.Ser374Ser synonymous ACP2 2 82698 2.41844E-5 41349 0 9.55901E-5
11-47264298-G-A p.Leu372Leu synonymous ACP2 1 82768 1.2082E-5 41384 0 NA
11-47264301-G-A p.Gln371* stop_gained ACP2 1 82808 1.20761E-5 41404 0 NA
11-47264320-C-T p.Lys364Lys synonymous ACP2 1 83014 1.20462E-5 41507 0 NA
11-47264326-C-A p.Val362Val synonymous ACP2 2 82980 2.41022E-5 41490 0 NA
11-47264329-G-A p.Val361Val synonymous ACP2 5 83012 6.02323E-5 41506 0 8.29848E-6
11-47264331-C-T p.Val361Ile missense ACP2 8 83036 9.63438E-5 41518 0 9.55657E-5
11-47264334-G-C p.Pro360Ala missense ACP2 1 83064 1.20389E-5 41532 0 NA
11-47264335-C-T p.Glu359Glu synonymous ACP2 1 83062 1.20392E-5 41531 0 NA
11-47264339-G-A p.Thr358Ile missense ACP2 3 83062 3.61176E-5 41531 0 6.37064E-5
11-47264343-G-A p.Leu357Phe missense ACP2 1 83070 1.2038E-5 41535 0 NA
11-47264345-C-T p.Arg356His missense ACP2 2 83062 2.40784E-5 41531 0 3.3151E-5
11-47264346-G-A p.Arg356Cys missense ACP2 5 83084 6.01801E-5 41542 0 3.18492E-5
11-47264347-A-G p.Leu355Leu synonymous ACP2 1 83084 1.2036E-5 41542 0 NA
11-47264353-G-C p.Asp353Glu missense ACP2 227 83096 0.00273178 41548 2 0.00503525
11-47264360-A-C p.Leu351Arg missense ACP2 3 83098 3.6102E-5 41549 0 1.07657E-4
11-47264366-C-T p.Cys349Tyr missense ACP2 1 83106 1.20328E-5 41553 0 NA
11-47264369-C-T p.Arg348His missense ACP2 3 83108 3.60976E-5 41554 0 3.18695E-5
11-47264370-G-A p.Arg348Cys missense ACP2 2 83126 2.40599E-5 41563 0 3.18552E-5
11-47264371-G-A p.His347His synonymous ACP2 3 83134 3.60863E-5 41567 0 NA
11-47264374-A-C p.Pro346Pro synonymous ACP2 2 83132 2.40581E-5 41566 0 3.98108E-6
11-47264386-C-T p.Leu342Leu synonymous ACP2 29 83124 3.48876E-4 41562 0 5.73358E-4
11-47264395-C-T p.Pro339Pro synonymous ACP2 1 83086 1.20357E-5 41543 0 3.98216E-6
11-47264396-G-A p.Pro339Leu missense ACP2 1 83090 1.20351E-5 41545 0 1.91168E-4
11-47264405-G-A p.Ala336Val missense ACP2 1 83090 1.20351E-5 41545 0 8.27842E-5
11-47264416-C-G p.Glu332Asp missense ACP2 1 83088 1.20354E-5 41544 0 NA
11-47264419-G-T p.Asn331Lys missense ACP2 3 83064 3.61167E-5 41532 0 NA
11-47264419-G-A p.Asn331Asn synonymous ACP2 2 83064 2.40778E-5 41532 0 1.19536E-5
11-47264423-C-T p.Arg330Gln missense ACP2 1 83070 1.2038E-5 41535 0 1.65774E-5
11-47264424-G-A p.Arg330Trp missense ACP2 1 83062 1.20392E-5 41531 0 1.59429E-5
11-47264448-TCCTGAGGGTCGACAGGAGGCAACATGGGAGCTGCTCAGCCTGCCCATCATGGGGTCCTTGGGCTGCCCCGAGCCACCTCCCGAGGGCCCCCCTCCAGAGGACACTGCTAGCTCCACTCA-T p.Asn322fs frameshift ACP2 6 83080 7.22195E-5 41540 1 NA
11-47264579-C-G p.Glu318Gln missense ACP2 1 83344 1.19985E-5 41672 0 8.23968E-6
11-47264579-C-T p.Glu318Lys missense ACP2 2 83344 2.39969E-5 41672 0 NA
11-47264589-T-A p.Glu314Asp missense ACP2 1 83356 1.19967E-5 41678 0 NA
11-47264597-T-C p.Ile312Val missense ACP2 1 83364 1.19956E-5 41682 0 NA
11-47264598-G-A p.His311His synonymous ACP2 1 83364 1.19956E-5 41682 0 5.03525E-4
11-47264610-G-A p.Tyr307Tyr synonymous ACP2 3 83340 3.59971E-5 41670 0 1.19299E-5
11-47264629-T-G p.Asn301Thr missense ACP2 2 83352 2.39946E-5 41676 0 NA
11-47264649-T-C p.Gln294Gln synonymous ACP2 1 83348 1.19979E-5 41674 0 NA
11-47264665-GT-G p.Thr289fs frameshift ACP2 2 83342 2.39975E-5 41671 0 NA
11-47264672-C-T p.Asp287Asn missense ACP2 2 83314 2.40056E-5 41657 0 3.9775E-6
11-47264673-G-A p.His286His splice_region+synonymous ACP2 1 83302 1.20045E-5 41651 0 NA
11-47264675-GCTGCGGGGGAGAGGGGCTGCCCGTCAGCATTGTTCCCCACACCCGCAGGAACCGAACAGAGAAGAAATCCAGCTCCTTGCCTGACACAGCACGCTAGGGAGCGCAGGCACTCAC-G c.855+1_856-1del splice_acceptor ACP2 3 83284 3.60213E-5 41642 0 NA
11-47264679-C-T c.856-4G>A splice_region ACP2 288 83236 0.00346004 41618 6 0.00713467
11-47264787-C-T c.855+3G>A splice_region ACP2 1 83216 1.20169E-5 41608 0 NA
11-47264787-C-G c.855+3G>C splice_region ACP2 1 83216 1.20169E-5 41608 0 NA
11-47264791-G-A p.Ala285Val missense+splice_region ACP2 2 83214 2.40344E-5 41607 0 8.24348E-6
11-47264802-C-T p.Leu281Leu synonymous ACP2 1 83232 1.20146E-5 41616 0 3.97782E-6
11-47264812-G-A p.Pro278Leu missense ACP2 1 83196 1.20198E-5 41598 0 2.47545E-5
11-47264830-G-A p.Ala272Val missense ACP2 6 83106 7.2197E-5 41553 0 1.19368E-5
11-47264833-A-G p.Met271Thr missense ACP2 2 83134 2.40575E-5 41567 0 NA
11-47264835-T-A p.Leu270Leu synonymous ACP2 2 83118 2.40622E-5 41559 0 NA
11-47264876-AAGG-A c.773-7_773-5delCCT splice_region ACP2 1 82642 1.21004E-5 41321 0 NA
11-47264877-A-G c.773-5T>C splice_region ACP2 1 82620 1.21036E-5 41310 0 NA
11-47266284-A-AC c.772+1_772+2insG splice_donor ACP2 1 79800 1.25313E-5 39900 0 NA
11-47266287-C-T p.Gly257Gly splice_region+synonymous ACP2 1 79896 1.25163E-5 39948 0 4.10968E-6
11-47266288-C-T p.Gly257Glu missense+splice_region ACP2 7 79894 8.76161E-5 39947 0 7.80072E-5
11-47266289-CCT-C p.Gln256fs frameshift ACP2 1 79866 1.2521E-5 39933 0 9.55475E-5
11-47266290-CT-C p.Gln256fs frameshift ACP2 2 79872 2.50401E-5 39936 0 8.64259E-6
11-47266292-G-A p.Gln256* stop_gained ACP2 1 79888 1.25175E-5 39944 0 NA
11-47266297-C-T p.Arg254Gln missense ACP2 1 79906 1.25147E-5 39953 0 1.21975E-5
11-47266298-G-A p.Arg254Trp missense ACP2 1 79918 1.25128E-5 39959 0 8.53315E-6
11-47266308-C-T p.Ala250Ala synonymous ACP2 4 79990 5.00063E-5 39995 0 4.44265E-5
11-47266309-G-A p.Ala250Val missense ACP2 25 79996 3.12516E-4 39998 0 1.91119E-4
11-47266315-T-C p.Gln248Arg missense ACP2 9 80096 1.12365E-4 40048 0 8.05601E-5
11-47266325-C-T p.Gly245Arg missense ACP2 2 80150 2.49532E-5 40075 0 1.27356E-4
11-47266336-C-T p.Arg241His missense ACP2 4 80218 4.98641E-5 40109 0 4.14312E-5
11-47266342-C-T p.Ser239Asn missense ACP2 2 80226 2.49296E-5 40113 0 NA
11-47266349-C-G p.Asp237His missense ACP2 1 80294 1.24542E-5 40147 0 NA
11-47266357-C-T p.Arg234Gln missense ACP2 40 80296 4.98157E-4 40148 0 6.37064E-5
11-47266364-G-A p.Leu232Phe missense ACP2 8 80290 9.96388E-5 40145 0 9.55475E-5
11-47266366-C-T p.Arg231His missense ACP2 1 80280 1.24564E-5 40140 0 1.65862E-5
11-47266367-G-A p.Arg231Cys missense ACP2 5 80278 6.22836E-5 40139 0 6.36983E-5
11-47266369-T-C p.Gln230Arg missense ACP2 1 80260 1.24595E-5 40130 0 5.04541E-4
11-47266372-A-G p.Met229Thr missense ACP2 2 80252 2.49215E-5 40126 0 3.32143E-5
11-47266374-G-C p.Thr228Thr synonymous ACP2 5 80258 6.22991E-5 40129 0 3.18492E-5
11-47266374-G-A p.Thr228Thr synonymous ACP2 1 80258 1.24598E-5 40129 0 NA
11-47266379-G-C p.Gln227Glu missense ACP2 1 80244 1.2462E-5 40122 0 NA
11-47266392-G-A p.Pro222Pro synonymous ACP2 1 80110 1.24828E-5 40055 0 3.63305E-5
11-47266395-C-T p.Pro221Pro synonymous ACP2 1 80050 1.24922E-5 40025 0 1.70192E-5
11-47266397-G-A p.Pro221Ser missense ACP2 1 80044 1.24931E-5 40022 0 NA
11-47266402-C-T p.Arg219His missense ACP2 3 79946 3.75253E-5 39973 0 1.59266E-4
11-47266409-C-A p.Gly217Trp missense ACP2 1 79800 1.25313E-5 39900 0 8.99248E-6
11-47266413-C-T p.Thr215Thr synonymous ACP2 2 79742 2.50809E-5 39871 0 3.64505E-5
11-47266414-G-A p.Thr215Met missense ACP2 1 79736 1.25414E-5 39868 0 3.21372E-4
11-47266416-T-TTGCTG p.Gln214fs frameshift ACP2 1 79748 1.25395E-5 39874 0 1.23272E-5
11-47266418-G-GCT c.640-2_640-1dupAG splice_acceptor ACP2 6 79708 7.52748E-5 39854 0 3.18552E-5
11-47266419-C-CTG c.640-3_640-2dupCA splice_acceptor ACP2 1 79696 1.25477E-5 39848 0 1.98548E-4
11-47266451-G-C c.*320C>G splice_region ACP2 2 79100 2.52844E-5 39550 0 4.62396E-5
11-47266782-G-A p.His160Tyr missense ACP2 1 81998 1.21954E-5 40999 0 3.31066E-5
11-47266788-C-A p.Val158Leu missense ACP2 5 82328 6.07327E-5 41164 0 6.37471E-5
11-47266789-C-T p.Thr157Thr synonymous ACP2 5 82396 6.06826E-5 41198 0 1.19844E-5
11-47266792-C-T p.Arg156Arg synonymous ACP2 1 82578 1.21098E-5 41289 0 NA
11-47266800-C-A p.Val154Phe missense ACP2 1 82824 1.20738E-5 41412 0 NA
11-47266808-T-G p.Gln151Pro missense+splice_region ACP2 14617 80426 0.181745 40213 1274 0.274979
11-47266809-G-C p.Gln151Glu missense+splice_region ACP2 2 83024 2.40894E-5 41512 0 NA
11-47266849-G-A c.639+7C>T splice_region ACP2 2 83342 2.39975E-5 41671 0 NA
11-47266853-C-T c.639+3G>A splice_region ACP2 1 83346 1.19982E-5 41673 0 NA
11-47266864-A-G p.Phe211Leu missense ACP2 1 83374 1.19941E-5 41687 0 9.56328E-5
11-47266868-T-C p.Thr209Thr synonymous ACP2 1 83370 1.19947E-5 41685 0 NA
11-47266875-T-C p.Tyr207Cys missense ACP2 3 83382 3.5979E-5 41691 0 6.25E-4
11-47266889-G-A p.Thr202Thr synonymous ACP2 8 83388 9.59371E-5 41694 0 2.94244E-4
11-47266899-G-A p.Thr199Ile missense ACP2 1 83396 1.1991E-5 41698 0 NA
11-47266913-C-A p.Gly194Gly synonymous ACP2 1 83394 1.19913E-5 41697 0 1.64728E-5
11-47266921-C-T p.Glu192Lys missense ACP2 1 83398 1.19907E-5 41699 0 1.19288E-5
11-47266934-G-A p.Asp187Asp synonymous ACP2 1 83400 1.19904E-5 41700 0 NA
11-47266945-GCTATGAAAAATGGATCAGGGTCTCAGTCCTGCTCTGGGGAAAAGACAGCGTGGTGAGCTGCACCTCTGCCCCCACTCAC-G p.Asp151fs frameshift ACP2 7 83398 8.39349E-5 41699 0 NA
11-47266948-A-G p.Ter161Glnext*? stop_lost ACP2 1 83402 1.19901E-5 41701 0 NA
11-47266949-T-C c.550-4A>G splice_region ACP2 1 83398 1.19907E-5 41699 0 3.97624E-6
11-47266975-T-A c.451-2A>T splice_acceptor ACP2 5 83396 5.99549E-5 41698 0 2.47093E-5
11-47266980-TG-T c.451-8delC splice_region ACP2 12 83392 1.43899E-4 41696 0 2.54793E-4
11-47266980-T-C c.451-2A>G splice_acceptor ACP2 1 83392 1.19916E-5 41696 0 3.97627E-5
11-47267032-C-T p.Arg181Gln missense ACP2 2 83362 2.39917E-5 41681 0 3.29473E-5
11-47267038-C-T p.Ser179Asn missense ACP2 1 83362 1.19959E-5 41681 0 8.23683E-6
11-47267046-C-T p.Gln176Gln synonymous ACP2 1 83358 1.19964E-5 41679 0 NA
11-47267057-G-A p.Pro173Ser missense ACP2 2 83342 2.39975E-5 41671 0 3.18309E-5
11-47267061-C-T p.Gln171Gln synonymous ACP2 2 83334 2.39998E-5 41667 0 6.36862E-5
11-47267065-C-T p.Arg170Gln missense ACP2 3 83326 3.60032E-5 41663 0 5.03525E-4
11-47267070-C-A p.Glu168Asp missense ACP2 2 83324 2.40027E-5 41662 0 1.19299E-5
11-47267072-C-T p.Glu168Lys missense ACP2 2 83316 2.4005E-5 41658 0 3.1837E-5
11-47267073-G-A p.Asn167Asn synonymous ACP2 1 83314 1.20028E-5 41657 0 NA
11-47267079-C-T p.Leu165Leu synonymous ACP2 2859 83254 0.0343407 41627 65 0.046875
11-47267080-A-G p.Leu165Pro missense ACP2 2 83304 2.40085E-5 41652 0 2.47113E-5
11-47267088-A-G p.Tyr162Tyr synonymous ACP2 3 83306 3.60118E-5 41653 0 2.47117E-5
11-47267092-C-T p.Arg161His missense ACP2 8 83316 9.602E-5 41658 0 5.76606E-5
11-47267099-A-G p.Cys159Arg missense ACP2 2 83292 2.40119E-5 41646 0 NA
11-47267109-C-T p.Pro155Pro synonymous ACP2 5 83290 6.00312E-5 41645 0 6.3678E-5
11-47267110-G-A p.Pro155Leu missense ACP2 2 83284 2.40142E-5 41642 0 1.59079E-5
11-47267117-T-G p.Lys153Gln missense ACP2 2 83282 2.40148E-5 41641 0 7.9538E-6
11-47267123-GCTGTAGAGCGAAGCGGGGAAACAGGCAGCGGGAAAAGGAGCCTGGCATCAGCAGGCCTACGGCCAGAGCTGTCCCCTCACCACCCCAGGGAAGGGCTGGCCACTCTTAC-G p.Val151fs frameshift ACP2 1 83284 1.20071E-5 41642 0 NA
11-47267123-G-T p.Leu151Met missense+splice_region ACP2 1 83294 1.20057E-5 41647 0 3.9769E-6
11-47267205-A-C p.Trp160Gly missense ACP2 1 83066 1.20386E-5 41533 0 NA
11-47267210-A-T p.Leu158Gln missense ACP2 1 83094 1.20346E-5 41547 0 NA
11-47267214-A-T p.Ser157Thr missense ACP2 3 83078 3.61106E-5 41539 0 1.27453E-4
11-47267218-G-A p.Ser155Ser synonymous ACP2 1 83062 1.20392E-5 41531 0 NA
11-47267219-C-G p.Ser155Thr missense ACP2 1 83060 1.20395E-5 41530 0 8.28638E-6
11-47267238-C-T p.Asp149Asn missense ACP2 1 83008 1.2047E-5 41504 0 NA
11-47267242-A-C p.Thr147Thr synonymous ACP2 2 82976 2.41034E-5 41488 0 NA
11-47267250-GCA-G p.Val144fs frameshift ACP2 1 82924 1.20592E-5 41462 0 NA
11-47267268-T-C p.Ile139Val missense ACP2 3 82882 3.6196E-5 41441 0 NA
11-47267269-A-G p.Pro138Pro synonymous ACP2 1 82898 1.2063E-5 41449 0 NA
11-47267278-C-T c.-86G>A 5_prime_UTR_premature_start_codon_gain ACP2 5 82874 6.03326E-5 41437 0 4.98455E-5
11-47267287-C-T p.Pro132Pro synonymous ACP2 2 82900 2.41255E-5 41450 0 5.03525E-4
11-47267288-G-A p.Pro132Leu missense ACP2 3 82874 3.61995E-5 41437 0 6.25E-4
11-47267297-C-T p.Arg129His missense ACP2 1 82930 1.20584E-5 41465 0 NA
11-47267298-G-A p.Arg129Cys missense ACP2 6 82878 7.23956E-5 41439 0 1.59215E-4
11-47267308-G-T p.Asn125Lys missense ACP2 2 82910 2.41225E-5 41455 0 3.1841E-5
11-47267309-T-C p.Asn125Ser missense ACP2 1 82910 1.20613E-5 41455 0 2.81258E-5
11-47267319-A-G p.Phe122Leu missense ACP2 2 82986 2.41005E-5 41493 0 1.0098E-4
11-47267344-A-G p.Ser113Ser synonymous ACP2 1 83000 1.20482E-5 41500 0 8.58207E-6
11-47267352-G-C p.Leu111Val missense ACP2 1 82974 1.2052E-5 41487 0 NA
11-47267356-C-G p.Arg109Arg synonymous ACP2 3 82918 3.61803E-5 41459 0 3.8693E-5
11-47267375-C-T p.Arg103Gln missense ACP2 3 82670 3.62889E-5 41335 0 7.93525E-5
11-47267376-G-A p.Arg103* stop_gained ACP2 1 82624 1.2103E-5 41312 0 4.57934E-5
11-47267385-C-T p.Val100Ile missense+splice_region ACP2 2 82346 2.42878E-5 41173 0 NA
11-47267389-C-G c.298-4G>C splice_region ACP2 2 82068 2.437E-5 41034 0 2.48566E-5
11-47268946-C-G c.*174G>C splice_region ACP2 1 42660 2.34412E-5 21330 0 3.1839E-5
11-47269126-T-C p.Gly121Gly synonymous ACP2 1 83010 1.20467E-5 41505 0 NA
11-47269129-C-T p.Gln120Gln synonymous ACP2 2784 82922 0.0335737 41461 40 0.0469889
11-47269130-T-G p.Gln120Pro missense ACP2 1 83066 1.20386E-5 41533 0 NA
11-47269133-G-A p.Pro119Leu missense ACP2 1 83088 1.20354E-5 41544 0 NA
11-47269136-CAAA-C p.Phe117del disruptive_inframe_deletion ACP2 1 83090 1.20351E-5 41545 0 NA
11-47269150-A-G p.Ala113Ala synonymous ACP2 2 83188 2.40419E-5 41594 0 NA
11-47269159-T-C p.Thr110Thr synonymous ACP2 19365 82658 0.234279 41329 2711 0.311838
11-47269188-T-A p.Arg101Trp missense ACP2 1 83294 1.20057E-5 41647 0 8.23737E-6
11-47269196-T-G p.Gln98Pro missense ACP2 5 83310 6.00168E-5 41655 0 1.91071E-4
11-47269200-G-A p.Arg97Trp missense ACP2 1 83332 1.20002E-5 41666 0 1.19287E-5
11-47269207-A-C p.Ser94Ser synonymous ACP2 32 83326 3.84034E-4 41663 1 2.06766E-4
11-47269224-C-T p.Gly89Ser missense ACP2 3 83334 3.59997E-5 41667 0 3.29511E-5
11-47269225-G-A c.-227C>T 5_prime_UTR_premature_start_codon_gain ACP2 1 83340 1.1999E-5 41670 0 8.23791E-6
11-47269227-G-T p.His88Asn missense ACP2 2 83340 2.39981E-5 41670 0 NA
11-47269232-C-T p.Arg86His missense ACP2 3 83324 3.6004E-5 41662 0 0.00100705
11-47269233-G-A p.Arg86Cys missense ACP2 4 83324 4.80054E-5 41662 0 6.36821E-5
11-47269235-T-C p.Gln85Arg missense ACP2 10 83328 1.20008E-4 41664 0 4.37407E-5
11-47269249-G-A p.Gly80Gly synonymous ACP2 1 83312 1.20031E-5 41656 0 NA
11-47269260-A-C p.Trp77Gly missense ACP2 1 83276 1.20083E-5 41638 0 3.18552E-5
11-47269263-G-C p.His76Asp missense ACP2 2 83268 2.40188E-5 41634 0 NA
11-47269265-T-C p.Gln75Arg missense ACP2 1 83270 1.20091E-5 41635 0 NA
11-47269267-T-C c.-269A>G 5_prime_UTR_premature_start_codon_gain ACP2 1 83262 1.20103E-5 41631 0 1.64943E-5
11-47269582-G-T c.210+7C>A splice_region ACP2 2 83308 2.40073E-5 41654 0 3.27263E-4
11-47269584-C-A c.210+5G>T splice_region ACP2 5 83326 6.00053E-5 41663 0 6.57704E-5
11-47269627-C-T p.Glu58Lys missense ACP2 11 83386 1.31917E-4 41693 0 1.91095E-4
11-47269639-C-T p.Asp54Asn missense ACP2 2 83388 2.39843E-5 41694 0 7.52508E-5
11-47269661-T-A p.Ser46Ser synonymous ACP2 4 83374 4.79766E-5 41687 0 3.18512E-4
11-47269667-G-C p.Asp44Glu missense ACP2 1 83360 1.19962E-5 41680 0 NA
11-47269671-C-T p.Gly43Glu missense ACP2 1 83354 1.1997E-5 41677 0 NA
11-47269677-C-A p.Arg41Leu missense ACP2 1 83344 1.19985E-5 41672 0 NA
11-47269686-T-C c.115-2A>G splice_acceptor ACP2 1 83310 1.20034E-5 41655 0 NA
11-47269691-G-T c.115-7C>A splice_region ACP2 6 83278 7.20478E-5 41639 0 3.52137E-5
11-47270028-A-G c.30+8T>C splice_region ACP2 1 69134 1.44647E-5 34567 0 NA
11-47270036-C-T p.Gly10Gly splice_region+synonymous ACP2 2 70058 2.85478E-5 35029 0 NA
11-47270045-T-G p.Glu7Asp missense ACP2 1 71650 1.39567E-5 35825 0 NA
11-47270105-A-G c.-40T>C 5_prime_UTR_premature_start_codon_gain ACP2 1 78738 1.27003E-5 39369 0 1.99108E-5
11-47270137-G-T c.-72C>A 5_prime_UTR_premature_start_codon_gain ACP2 8 80734 9.90908E-5 40367 0 3.18613E-4
11-47270222-A-C c.114+5T>G splice_region ACP2 3 82012 3.658E-5 41006 0 2.76564E-5
11-47270239-G-A p.Arg34Arg synonymous ACP2 1 82114 1.21782E-5 41057 0 3.49121E-5
11-47270242-C-A p.Leu33Leu synonymous ACP2 1 82078 1.21835E-5 41039 0 NA
11-47270246-C-G p.Ser32Thr missense ACP2 3 82088 3.65461E-5 41044 0 4.08497E-6
11-47270250-G-C p.Arg31Gly missense ACP2 3 82058 3.65595E-5 41029 0 5.72991E-5
11-47270253-CCC-TCT p.ArgAla29GlnThr missense ACP2 3 82082 3.65488E-5 41041 0 NA
11-47270255-C-T p.Arg29Gln missense ACP2 27058 81760 0.330944 40880 5023 0.418022
11-47270267-A-T p.Met25Lys missense ACP2 2 82032 2.43807E-5 41016 0 1.07289E-5
11-47270290-A-G p.Leu17Leu synonymous ACP2 1 81834 1.22199E-5 40917 0 3.18512E-5
11-47270304-G-C p.Leu13Val missense ACP2 1 81690 1.22414E-5 40845 0 3.1837E-5
11-47270313-G-A p.Arg10Trp missense ACP2 113 81600 0.0013848 40800 0 0.004522
11-47270314-G-A p.Ser9Ser synonymous ACP2 1 81570 1.22594E-5 40785 0 NA
11-47270321-C-G p.Gly7Ala missense ACP2 2 81550 2.45248E-5 40775 0 1.80174E-5
11-47270324-G-C p.Ser6Cys missense ACP2 1 81528 1.22657E-5 40764 0 NA
11-47270336-G-C p.Ala2Gly missense ACP2 2 81558 2.45224E-5 40779 0 1.46769E-4
11-47270418-A-C c.-78T>G 5_prime_UTR_premature_start_codon_gain ACP2 2 79774 2.50708E-5 39887 0 6.37186E-5
11-47270427-C-T c.-87G>A 5_prime_UTR_premature_start_codon_gain ACP2 2 79544 2.51433E-5 39772 0 NA